Steven Ning wrote:
How would I go about installing a new TeX class and using it from within
LyX? This class is an extension of the standard article class, as quoted
from the author. A copy is attached.
Read Help-Extended, section 5.
Basically, you will have to
1. Install the class to your
ADT writes:
I'm writing some technical documentation which covers the usage of GNU
style long-opts where multi-character options are preceded with two
dashes (--). However, when LyX sees two dashes together, it turns it
into an elongated single dash (en-dash) which is confusing/wrong.
What
Ahh right! There are none so blind as they who will not look
(carefully)!
Corrected and it works beautifully
Changed the Article to ARTICLE (for the same period flavour as the
original) as a little test and learned what that bit of the code does. A
step forward.
I have memoir and will update
hi
i experience a problem exporting HTML in lyx 1.3.5.
i get the following error:
Cannot convert file
Error while executing
tth -t -e2 -L'/tmp/lyx_tempdir234234/lyx_tmpbuf'
the problem seem to arise from
ERT with \dna{TGCCAATGACATCATGACCGA}
\dna is defined in the preamle as:
% The
Hei!
I have installed a new .sty file in Miktex and I have tried to use it from a
Lyx layout, but did not manage. I have followed the indications in the
Customization document, but they do not work for me (funny). Hope someone
can tell me what I do wrong.
Since I wanted to use the article
Hei!
When still a Word user I found quite useful to highlight text while working
with a document in order to include comments, notations, or just highlight
important things. This was useful for both me and other people reading and
reviewing a printed version of the document. I would like thus to
On 2.06.05, Andrew Sullivan wrote:
Hi,
I'm using the packages courier and stdpage in order to produce
correctly-formatted pages for a certain ASCII-based format. I then
use dvi2tty to create an actual ASCII document. This works, except
that the usual typesetting rules produce one space,
ADT wrote:
I'm writing some technical documentation which covers the usage of GNU
style long-opts where multi-character options are preceded with two
dashes (--). However, when LyX sees two dashes together, it turns it
into an elongated single dash (en-dash) which is confusing/wrong.
This
Georg == Georg Baum [EMAIL PROTECTED] writes:
Georg ADT wrote:
I'm writing some technical documentation which covers the usage of
GNU style long-opts where multi-character options are preceded with
two dashes (--). However, when LyX sees two dashes together, it
turns it into an elongated
On Fri, Jun 03, 2005 at 11:47:52AM +0200, G. Milde wrote:
Reading a LaTeX book, I found that typesetting rules differ between
European and North-American conventions. By default, LaTeX introduces an
extra large space after a sentence-ending full stop.
So this extra space is already in the
On Thu, 2 Jun 2005, ADT wrote:
I'm writing some technical documentation which covers the usage of GNU
style long-opts where multi-character options are preceded with two dashes
(--). However, when LyX sees two dashes together, it turns it into an
elongated single dash (en-dash) which is
Dear all,
I am a newbie in LyX. I have some questions of using
LyX. Could you please give me some help?
1. When I use Lyx-code, the line goes over the page
width. Is there any possible way to configure lyx-code
that auto address the paragraph into the document page
width with full justify, since
Thanks everyone for the advice. I've ended up using a mixture of
ligature breaks and LyX-Code because LyX-Code creates new paragraphs
and in many cases the -- exist inside an existing paragraph.
-Aaron
--
http://synfin.net/
I changed the bindings file to bind M-p to the Greek letter pi. I get the
following error messages:
Error: New binding for 'M-p p' is overriding old binding...
Error: New binding for 'M-p c' is overriding old binding...
Error: New binding for 'M-p a' is overriding old binding...
..etc...
Can
Does anyone know if there is a way to publish Matlab code in a lyx
document with the colors of the keywords, variables, comments and etc.
preserved?
I tried googling for lyx, code, and pretty print, but didn't really come
up with any solution that worked easily. There are a few matlab scripts
Srinivas Nedunuri wrote:
I am unable to get the multiline formula format to work as described in
the User Guide. It says that C-Enter ought to turn a formula into a
multiline one, and that C-Tab allows you to seperate the left from the
middle from the right. However, neither of these seem to
Does anyone know if there is a way to publish Matlab code in a lyx
document with the colors of the keywords, variables, comments and etc.
preserved?
There is a package called listings that might be useful, but colors on the
keywords, I'm not sure if that is supported.
A perl/sed script might
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 - A2 --- etc
Doing it as a 1x2 matrix it doesn't come out quite right
thanks!
Srinivas Nedunuri wrote:
I changed the bindings file to bind M-p to the Greek letter pi. I get the
following error messages:
Error: New binding for 'M-p p' is overriding old binding...
Error: New binding for 'M-p c' is overriding old binding...
Error: New binding for 'M-p a' is overriding old
Srinivas Nedunuri wrote:
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 - A2 --- etc
Doing it as a 1x2 matrix it doesn't come out
Srinivas Nedunuri wrote:
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 - A2 --- etc
You can use the commands \xleftarrow or
Its almost what I want. What I really want is a double arrow (==), and I
see that unfortunately latex doesn't have a \xRightarrow (or at least Lyx
doesn't recognize it). I tried using the \overset command (\underset just
produces a complete mess) and again its almost what I want but it doesnt
I am trying to figure out what Lyx's version of the AMS align environment is
supposed to do. According to the AMS documentation, align can be used to
produce either a single column or a multicolumn of relational terms, in which
in each column the terms are aligned by the relational operator
Dear all,
I am trying to use listings.sty in LyX since I would
like to include some files. However, I can only insert
one file. Can anyone tell me how to use it?
in preamble, I inserted:
\usepackage{listings}
in the document, I wrote:
\1stlistoflisting{
[include first verbatim file]
}
Steven Ning wrote:
How would I go about installing a new TeX class and using it from within
LyX? This class is an extension of the standard article class, as quoted
from the author. A copy is attached.
Read Help-Extended, section 5.
Basically, you will have to
1. Install the class to your
ADT writes:
I'm writing some technical documentation which covers the usage of GNU
style long-opts where multi-character options are preceded with two
dashes (--). However, when LyX sees two dashes together, it turns it
into an elongated single dash (en-dash) which is confusing/wrong.
What
Ahh right! There are none so blind as they who will not look
(carefully)!
Corrected and it works beautifully
Changed the Article to ARTICLE (for the same period flavour as the
original) as a little test and learned what that bit of the code does. A
step forward.
I have memoir and will update
hi
i experience a problem exporting HTML in lyx 1.3.5.
i get the following error:
Cannot convert file
Error while executing
tth -t -e2 -L'/tmp/lyx_tempdir234234/lyx_tmpbuf'
the problem seem to arise from
ERT with \dna{TGCCAATGACATCATGACCGA}
\dna is defined in the preamle as:
% The
Hei!
I have installed a new .sty file in Miktex and I have tried to use it from a
Lyx layout, but did not manage. I have followed the indications in the
Customization document, but they do not work for me (funny). Hope someone
can tell me what I do wrong.
Since I wanted to use the article
Hei!
When still a Word user I found quite useful to highlight text while working
with a document in order to include comments, notations, or just highlight
important things. This was useful for both me and other people reading and
reviewing a printed version of the document. I would like thus to
On 2.06.05, Andrew Sullivan wrote:
Hi,
I'm using the packages courier and stdpage in order to produce
correctly-formatted pages for a certain ASCII-based format. I then
use dvi2tty to create an actual ASCII document. This works, except
that the usual typesetting rules produce one space,
ADT wrote:
I'm writing some technical documentation which covers the usage of GNU
style long-opts where multi-character options are preceded with two
dashes (--). However, when LyX sees two dashes together, it turns it
into an elongated single dash (en-dash) which is confusing/wrong.
This
Georg == Georg Baum [EMAIL PROTECTED] writes:
Georg ADT wrote:
I'm writing some technical documentation which covers the usage of
GNU style long-opts where multi-character options are preceded with
two dashes (--). However, when LyX sees two dashes together, it
turns it into an elongated
On Fri, Jun 03, 2005 at 11:47:52AM +0200, G. Milde wrote:
Reading a LaTeX book, I found that typesetting rules differ between
European and North-American conventions. By default, LaTeX introduces an
extra large space after a sentence-ending full stop.
So this extra space is already in the
On Thu, 2 Jun 2005, ADT wrote:
I'm writing some technical documentation which covers the usage of GNU
style long-opts where multi-character options are preceded with two dashes
(--). However, when LyX sees two dashes together, it turns it into an
elongated single dash (en-dash) which is
Dear all,
I am a newbie in LyX. I have some questions of using
LyX. Could you please give me some help?
1. When I use Lyx-code, the line goes over the page
width. Is there any possible way to configure lyx-code
that auto address the paragraph into the document page
width with full justify, since
Thanks everyone for the advice. I've ended up using a mixture of
ligature breaks and LyX-Code because LyX-Code creates new paragraphs
and in many cases the -- exist inside an existing paragraph.
-Aaron
--
http://synfin.net/
I changed the bindings file to bind M-p to the Greek letter pi. I get the
following error messages:
Error: New binding for 'M-p p' is overriding old binding...
Error: New binding for 'M-p c' is overriding old binding...
Error: New binding for 'M-p a' is overriding old binding...
..etc...
Can
Does anyone know if there is a way to publish Matlab code in a lyx
document with the colors of the keywords, variables, comments and etc.
preserved?
I tried googling for lyx, code, and pretty print, but didn't really come
up with any solution that worked easily. There are a few matlab scripts
Srinivas Nedunuri wrote:
I am unable to get the multiline formula format to work as described in
the User Guide. It says that C-Enter ought to turn a formula into a
multiline one, and that C-Tab allows you to seperate the left from the
middle from the right. However, neither of these seem to
Does anyone know if there is a way to publish Matlab code in a lyx
document with the colors of the keywords, variables, comments and etc.
preserved?
There is a package called listings that might be useful, but colors on the
keywords, I'm not sure if that is supported.
A perl/sed script might
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 - A2 --- etc
Doing it as a 1x2 matrix it doesn't come out quite right
thanks!
Srinivas Nedunuri wrote:
I changed the bindings file to bind M-p to the Greek letter pi. I get the
following error messages:
Error: New binding for 'M-p p' is overriding old binding...
Error: New binding for 'M-p c' is overriding old binding...
Error: New binding for 'M-p a' is overriding old
Srinivas Nedunuri wrote:
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 - A2 --- etc
Doing it as a 1x2 matrix it doesn't come out
Srinivas Nedunuri wrote:
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 - A2 --- etc
You can use the commands \xleftarrow or
Its almost what I want. What I really want is a double arrow (==), and I
see that unfortunately latex doesn't have a \xRightarrow (or at least Lyx
doesn't recognize it). I tried using the \overset command (\underset just
produces a complete mess) and again its almost what I want but it doesnt
I am trying to figure out what Lyx's version of the AMS align environment is
supposed to do. According to the AMS documentation, align can be used to
produce either a single column or a multicolumn of relational terms, in which
in each column the terms are aligned by the relational operator
Dear all,
I am trying to use listings.sty in LyX since I would
like to include some files. However, I can only insert
one file. Can anyone tell me how to use it?
in preamble, I inserted:
\usepackage{listings}
in the document, I wrote:
\1stlistoflisting{
[include first verbatim file]
}
Steven Ning wrote:
> How would I go about installing a new TeX class and using it from within
> LyX? This class is "an extension of the standard article class," as quoted
> from the author. A copy is attached.
Read Help->Extended, section 5.
Basically, you will have to
1. Install the class to
ADT writes:
> I'm writing some technical documentation which covers the usage of GNU
> style long-opts where multi-character options are preceded with two
> dashes (--). However, when LyX sees two dashes together, it turns it
> into an elongated single dash (en-dash) which is confusing/wrong.
Ahh right! There are none so blind as they who will not look
(carefully)!
Corrected and it works beautifully
Changed the Article to ARTICLE (for the same period flavour as the
original) as a little test and learned what that bit of the code does. A
step forward.
I have memoir and will update
hi
i experience a problem exporting HTML in lyx 1.3.5.
i get the following error:
"
Cannot convert file
Error while executing
tth -t -e2 -L'/tmp/lyx_tempdir234234/lyx_tmpbuf'
"
the problem seem to arise from
ERT with \dna{TGCCAATGACATCATGACCGA}
\dna is defined in the preamle as:
% The
Hei!
I have installed a new .sty file in Miktex and I have tried to use it from a
Lyx layout, but did not manage. I have followed the indications in the
Customization document, but they do not work for me (funny). Hope someone
can tell me what I do wrong.
Since I wanted to use the "article
Hei!
When still a Word user I found quite useful to highlight text while working
with a document in order to include comments, notations, or just highlight
important things. This was useful for both me and other people reading and
reviewing a printed version of the document. I would like thus to
On 2.06.05, Andrew Sullivan wrote:
> Hi,
>
> I'm using the packages courier and stdpage in order to produce
> correctly-formatted pages for a certain ASCII-based format. I then
> use dvi2tty to create an actual ASCII document. This works, except
> that the usual typesetting rules produce one
ADT wrote:
> I'm writing some technical documentation which covers the usage of GNU
> style long-opts where multi-character options are preceded with two
> dashes (--). However, when LyX sees two dashes together, it turns it
> into an elongated single dash (en-dash) which is confusing/wrong.
> "Georg" == Georg Baum <[EMAIL PROTECTED]> writes:
Georg> ADT wrote:
>> I'm writing some technical documentation which covers the usage of
>> GNU style long-opts where multi-character options are preceded with
>> two dashes (--). However, when LyX sees two dashes together, it
>> turns it
On Fri, Jun 03, 2005 at 11:47:52AM +0200, G. Milde wrote:
>
> Reading a LaTeX book, I found that typesetting rules differ between
> European and North-American conventions. By default, LaTeX introduces an
> extra large space after a sentence-ending full stop.
> So this extra space is already in
On Thu, 2 Jun 2005, ADT wrote:
I'm writing some technical documentation which covers the usage of GNU
style long-opts where multi-character options are preceded with two dashes
(--). However, when LyX sees two dashes together, it turns it into an
elongated single dash (en-dash) which is
Dear all,
I am a newbie in LyX. I have some questions of using
LyX. Could you please give me some help?
1. When I use Lyx-code, the line goes over the page
width. Is there any possible way to configure lyx-code
that auto address the paragraph into the document page
width with full justify, since
Thanks everyone for the advice. I've ended up using a mixture of
ligature breaks and LyX-Code because LyX-Code creates new paragraphs
and in many cases the -- exist inside an existing paragraph.
-Aaron
--
http://synfin.net/
I changed the bindings file to bind M-p to the Greek letter pi. I get the
following error messages:
Error: New binding for 'M-p p' is overriding old binding...
Error: New binding for 'M-p c' is overriding old binding...
Error: New binding for 'M-p a' is overriding old binding...
..etc...
Can
Does anyone know if there is a way to publish Matlab code in a lyx
document with the colors of the keywords, variables, comments and etc.
preserved?
I tried googling for lyx, code, and pretty print, but didn't really come
up with any solution that worked easily. There are a few matlab scripts
Srinivas Nedunuri wrote:
I am unable to get the multiline formula format to work as described in
the User Guide. It says that C-Enter ought to turn a formula into a
multiline one, and that C-Tab allows you to seperate the left from the
middle from the right. However, neither of these seem to
> Does anyone know if there is a way to publish Matlab code in a lyx
> document with the colors of the keywords, variables, comments and etc.
> preserved?
>
There is a package called "listings" that might be useful, but colors on the
keywords, I'm not sure if that is supported.
A perl/sed script
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 -> A2 ---> etc
Doing it as a 1x2 matrix it doesn't come out quite right
thanks!
Srinivas Nedunuri wrote:
I changed the bindings file to bind M-p to the Greek letter pi. I get the
following error messages:
Error: New binding for 'M-p p' is overriding old binding...
Error: New binding for 'M-p c' is overriding old binding...
Error: New binding for 'M-p a' is overriding old
Srinivas Nedunuri wrote:
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 -> A2 ---> etc
Doing it as a 1x2 matrix it doesn't come
Srinivas Nedunuri wrote:
hello I was wondering how you get text or a symbol above some other symbol
in Lyx when you're doing it as part of some linear expression. For example:
xyz abc
A1 -> A2 ---> etc
You can use the commands \xleftarrow or
Its almost what I want. What I really want is a double arrow (==>), and I
see that unfortunately latex doesn't have a \xRightarrow (or at least Lyx
doesn't recognize it). I tried using the \overset command (\underset just
produces a complete mess) and again its almost what I want but it doesnt
I am trying to figure out what Lyx's version of the AMS align environment is
supposed to do. According to the AMS documentation, align can be used to
produce either a single column or a multicolumn of relational terms, in which
in each column the terms are aligned by the relational operator
Dear all,
I am trying to use listings.sty in LyX since I would
like to include some files. However, I can only insert
one file. Can anyone tell me how to use it?
in preamble, I inserted:
\usepackage{listings}
in the document, I wrote:
\1stlistoflisting{
[include first verbatim file]
}
72 matches
Mail list logo
