hello perl6 people,
On
This is perl6 version 2012.09.1
built on parrot 4.6.0 revision 0
When i try to run
use v6;
use Test;
for 'GATGGAACTTGACTACGTAAATT' {
s:g/T/U/;
is $_
, 'GAUGGAACUUGACUACGUAAAUU'
, 'RNA';
}
I get
Cannot assign
hello perl6 people,
this code says foo, exactly as expected.
use v6;
my $path = ;
$path ||=foo;
say $path;
I'm trying to use the same thinh in a get callback of Baildador and it doesn't
work. i try to understand why is it so.
use v6;
use lib 'lib';
use Bailador;
get / (.*)
Marc ():
hello perl6 people,
On
This is perl6 version 2012.09.1
built on parrot 4.6.0 revision 0
When i try to run
use v6;
use Test;
for 'GATGGAACTTGACTACGTAAATT' {
s:g/T/U/;
is $_
, 'GAUGGAACUUGACUACGUAAAUU'
, 'RNA';
}
I
On Wed, Oct 24, 2012 at 5:35 AM, Marc Chantreux kha...@phear.org wrote:
Cannot assign to a non-container
in sub infix:= at src/gen/CORE.setting:11692
in block at /tmp/ZZZ:4
you're attempting to modify a string constant, which cannot be
modified. try something like (untested):
I imagine it's the same problem as this Perl 5 code:
use Test::More;
for ('GATGGAACTTGACTACGTAAATT') {
s/T/U/g;
is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA';
}
Since $_ is an alias for each element of the list and the only element in
the list is a constant string and you can't modify
On 10/24/2012 02:46 PM, Marc Chantreux wrote:
use v6;
use lib 'lib';
use Bailador;
get / (.*) '/' / = sub ($path) {
$path||=foo;
$path is a subroutine parameter, and thus read-only by default.
If you want to modify $path locally, write
sub ($path is copy) { ... }
Also if Bailador
hello again,
i felt dumb reading your answers! it seems obvious now.
thanks everyone.
regards
