s:g/T/U/ doesn't work ?
hello perl6 people,
On
This is perl6 version 2012.09.1
built on parrot 4.6.0 revision 0
When i try to run
use v6;
use Test;
for 'GATGGAACTTGACTACGTAAATT' {
s:g/T/U/;
is $_
, 'GAUGGAACUUGACUACGUAAAUU'
, 'RNA';
}
I get
Cannot assign to a non-container
in sub infix:= at src/gen/CORE.setting:11692
in block at /tmp/ZZZ:4
As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea?
regards
marc
the nature of a scalar?
hello perl6 people,
this code says foo, exactly as expected.
use v6;
my $path = ;
$path ||=foo;
say $path;
I'm trying to use the same thinh in a get callback of Baildador and it doesn't
work. i try to understand why is it so.
use v6;
use lib 'lib';
use Bailador;
get / (.*) '/' / = sub ($path) {
$path||=foo;
hello ($path) ({$path.WHAT};{$path.defined}) {so $path};
# curl localhost:3000
# hello () (;True) True
}
baile;
please help!
regards
marc
Re: s:g/T/U/ doesn't work ?
Marc ():
hello perl6 people,
On
This is perl6 version 2012.09.1
built on parrot 4.6.0 revision 0
When i try to run
use v6;
use Test;
for 'GATGGAACTTGACTACGTAAATT' {
s:g/T/U/;
is $_
, 'GAUGGAACUUGACUACGUAAAUU'
, 'RNA';
}
I get
Cannot assign to a non-container
in sub infix:= at src/gen/CORE.setting:11692
in block at /tmp/ZZZ:4
As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea?
It's valid syntax. The error you're getting is not a syntax error;
it's a run-time error complaining about assigning to something that
isn't a container.
What you're assigning to is 'GATGGAACTTGACTACGTAAATT', a Str object.
That's a bit like trying to assign to the number 5. It should produce
an error, and it does. You need to put it into a variable, or an array
element, or a hash value -- in short, a container -- for it to work.
I think part of what felt confusing about this is that you did things
in a 'for' loop, so the assignment directly to a Str isn't that
obvious.
By the way, that 'for' loop over a single element is usually spelled
'given' in Perl 6.
I would write your code like this:
use v6;
use Test;
{
$_ = 'GATGGAACTTGACTACGTAAATT';
s:g/T/U/;
is $_,
'GAUGGAACUUGACUACGUAAAUU',
'RNA';
}
// Carl
Re: s:g/T/U/ doesn't work ?
On Wed, Oct 24, 2012 at 5:35 AM, Marc Chantreux kha...@phear.org wrote:
Cannot assign to a non-container
in sub infix:= at src/gen/CORE.setting:11692
in block at /tmp/ZZZ:4
you're attempting to modify a string constant, which cannot be
modified. try something like (untested):
my $snippet = 'GATGGAACTTGACTACGTAAATT';
for $snippet {
...
~jerry
Re: s:g/T/U/ doesn't work ?
I imagine it's the same problem as this Perl 5 code:
use Test::More;
for ('GATGGAACTTGACTACGTAAATT') {
s/T/U/g;
is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA';
}
Since $_ is an alias for each element of the list and the only element in
the list is a constant string and you can't modify constants, you get the
error. Changing your code to:
use v6;
use Test;
my $x = 'GATGGAACTTGACTACGTAAATT';
for $x {
s:g/T/U/;
is $_ , 'GAUGGAACUUGACUACGUAAAUU' , 'RNA';
}
Does indeed work.
Though, if what I said is true, the error message is Less Than Awesome. I
wonder could it be made more helpful?
Hope this helps,
-Scott
On Wed, Oct 24, 2012 at 7:35 AM, Marc Chantreux kha...@phear.org wrote:
hello perl6 people,
On
This is perl6 version 2012.09.1
built on parrot 4.6.0 revision 0
When i try to run
use v6;
use Test;
for 'GATGGAACTTGACTACGTAAATT' {
s:g/T/U/;
is $_
, 'GAUGGAACUUGACUACGUAAAUU'
, 'RNA';
}
I get
Cannot assign to a non-container
in sub infix:= at src/gen/CORE.setting:11692
in block at /tmp/ZZZ:4
As far as i understand from the doc, s:g/T/U/ is a valid syntax. any idea?
regards
marc
Re: the nature of a scalar?
On 10/24/2012 02:46 PM, Marc Chantreux wrote:
use v6;
use lib 'lib';
use Bailador;
get / (.*) '/' / = sub ($path) {
$path||=foo;
$path is a subroutine parameter, and thus read-only by default.
If you want to modify $path locally, write
sub ($path is copy) { ... }
Also if Bailador passes Match objects instead of strings into the
function, $path evaluates to True in boolean context even if it matched
the empty string.
Cheers,
Moritz
Re: s:g/T/U/ doesn't work ?
hello again, i felt dumb reading your answers! it seems obvious now. thanks everyone. regards
