hello again,
i felt dumb reading your answers! it seems obvious now.
thanks everyone.
regards
I imagine it's the same problem as this Perl 5 code:
use Test::More;
for ('GATGGAACTTGACTACGTAAATT') {
s/T/U/g;
is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA';
}
Since $_ is an alias for each element of the list and the only element in
the list is a constant string and you can't modify constan
On Wed, Oct 24, 2012 at 5:35 AM, Marc Chantreux wrote:
> Cannot assign to a non-container
> in sub infix:<=> at src/gen/CORE.setting:11692
> in block at /tmp/ZZZ:4
>
you're attempting to modify a string constant, which cannot be
modified. try something like (untested):
my $snippet
Marc (>):
> hello perl6 people,
>
> On
>
> This is perl6 version 2012.09.1
> built on parrot 4.6.0 revision 0
>
> When i try to run
>
> use v6;
> use Test;
> for 'GATGGAACTTGACTACGTAAATT' {
> s:g/T/U/;
> is $_
> , 'GAUGGAACUUGACUACGUAAAUU'
> , 'RN
