Hi Steffen and Tanvir, not replying to the R forum, i suppose, you will take care of that.
There is nothing wrong with the R and XML query. In theory, it means either "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the allocated space is just too small to accommodate mysql temp tables created by large queries such as sequence retrieval. Syed On 8 May 2013 19:12, Steffen Durinck <[email protected]> wrote: > Hi list, > > I included the actual XML query that results in the error Mohammad is > reporting: > > The query: > <?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query > virtualSchemaName = 'default' uniqueRows = '1' count = '0' > datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name > = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = > 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' > /></Dataset></Query> > > gives: > > caught BioMart::Exception::Database: Error during query execution: Can't > create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2) > > This comes from the central BioMart server (www.biomart.org), can anyone > help? > > Best, > Steffen > > > On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed < > [email protected]> wrote: > >> Hi, >> I can run the code some days ago . But cant run now. >> >> Problem 1: Output is ok >> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) >> utr5 = getSequence(chromosome=3, start=185514033, end=185535839, >> type="entrezgene",seqType="5utr", >> mart=ensembl) >> Output : >> >> 5utr entrezgene >> >> Sequence unavailable 10644 >> >> GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644 >> 3 >> GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG >> 10644 >> >> CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644 >> No UTR is >> annotated for this transcript 10644 >> >> Problem 2:Problem is here >> protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", >> mart=ensembl) >> >> Error in getBM(c(seqType, type), filters = type, values = id, mart = >> mart, : >> Query ERROR: caught BioMart::Exception::Database: Error during query >> execution: Can't create/write to file >> '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2) >> >> I need help please >> >> */.......Tanvir Ahamed* >> >> _______________________________________________ >> Users mailing list >> [email protected] >> https://lists.biomart.org/mailman/listinfo/users >> > > > _______________________________________________ > Users mailing list > [email protected] > https://lists.biomart.org/mailman/listinfo/users >
_______________________________________________ Users mailing list [email protected] https://lists.biomart.org/mailman/listinfo/users
