Hi Steffen and Tanvir,

not replying to the R forum, i suppose, you will take care of that.

There is nothing wrong with the R and XML query. In theory, it means either
"'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the
allocated space is just too small to accommodate mysql temp tables created
by large queries such as sequence retrieval.

Syed


On 8 May 2013 19:12, Steffen Durinck <[email protected]> wrote:

> Hi list,
>
> I included the actual XML query that results in the error Mohammad is
> reporting:
>
> The query:
> <?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query
>  virtualSchemaName = 'default' uniqueRows = '1' count = '0'
> datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name
> = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name =
> 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728'
> /></Dataset></Query>
>
> gives:
>
> caught BioMart::Exception::Database: Error during query execution: Can't
> create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)
>
> This comes from the central BioMart server (www.biomart.org), can anyone
> help?
>
> Best,
> Steffen
>
>
> On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <
> [email protected]> wrote:
>
>> Hi,
>> I can run the code some days ago . But cant run now.
>>
>> Problem 1: Output is ok
>> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
>> utr5 = getSequence(chromosome=3, start=185514033, end=185535839, 
>> type="entrezgene",seqType="5utr",
>> mart=ensembl)
>> Output :
>>
>>                     5utr  entrezgene
>>
>>    Sequence unavailable      10644
>>
>>  GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>> 3
>> GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG
>>      10644
>>
>>  CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>>                                                          No UTR is
>> annotated for this transcript      10644
>>
>> Problem 2:Problem is here
>> protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide",
>> mart=ensembl)
>>
>> Error in getBM(c(seqType, type), filters = type, values = id, mart =
>> mart,  :
>>   Query ERROR: caught BioMart::Exception::Database: Error during query
>> execution: Can't create/write to file
>> '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)
>>
>> I need help please
>>
>> */.......Tanvir Ahamed*
>>
>> _______________________________________________
>> Users mailing list
>> [email protected]
>> https://lists.biomart.org/mailman/listinfo/users
>>
>
>
> _______________________________________________
> Users mailing list
> [email protected]
> https://lists.biomart.org/mailman/listinfo/users
>
_______________________________________________
Users mailing list
[email protected]
https://lists.biomart.org/mailman/listinfo/users

Reply via email to