Hi Steffen
FYI, Tanvir tried his query against the Ensembl mart database at 
www.ensembl.org and it works fine. Please point your host to 
http://www.ensembl.org/biomart/martview/ until the issue at www.biomart.org is 
fixed.
Regards
Rhoda

On 9 May 2013, at 08:00, Syed Haider <[email protected]> wrote:

> Hi Steffen and Tanvir,
> 
> not replying to the R forum, i suppose, you will take care of that.
> 
> There is nothing wrong with the R and XML query. In theory, it means either 
> "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the 
> allocated space is just too small to accommodate mysql temp tables created by 
> large queries such as sequence retrieval.
> 
> Syed
> 
> 
> On 8 May 2013 19:12, Steffen Durinck <[email protected]> wrote:
> Hi list,
> 
> I included the actual XML query that results in the error Mohammad is 
> reporting:
> 
> The query: 
> <?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query  
> virtualSchemaName = 'default' uniqueRows = '1' count = '0' 
> datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name = 
> 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = 
> 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' 
> /></Dataset></Query>
> 
> gives:
> 
> caught BioMart::Exception::Database: Error during query execution: Can't 
> create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)
> 
> This comes from the central BioMart server (www.biomart.org), can anyone help?
> 
> Best,
> Steffen
> 
> 
> On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <[email protected]> 
> wrote:
> Hi,
> I can run the code some days ago . But cant run now. 
> 
> Problem 1: Output is ok
> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
> utr5 = getSequence(chromosome=3, start=185514033, end=185535839, 
> type="entrezgene",seqType="5utr", mart=ensembl) 
> Output : 
>                                                                               
>                 5utr  entrezgene
>                                                                              
> Sequence unavailable      10644
>                                              
> GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
> 3 
> GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG
>       10644
>                                  
> CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>                                                          No UTR is annotated 
> for this transcript      10644
>  
> Problem 2:Problem is here
> protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", 
> mart=ensembl)
> 
> Error in getBM(c(seqType, type), filters = type, values = id, mart = mart,  : 
>   Query ERROR: caught BioMart::Exception::Database: Error during query 
> execution: Can't create/write to file 
> '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)
> 
> I need help please
>  
> /.......Tanvir Ahamed
> 
> _______________________________________________
> Users mailing list
> [email protected]
> https://lists.biomart.org/mailman/listinfo/users
> 
> 
> _______________________________________________
> Users mailing list
> [email protected]
> https://lists.biomart.org/mailman/listinfo/users
> 
> _______________________________________________
> Users mailing list
> [email protected]
> https://lists.biomart.org/mailman/listinfo/users

Rhoda Kinsella Ph.D.
Ensembl Production Project Leader,
European Bioinformatics Institute (EMBL-EBI),
Wellcome Trust Genome Campus,
Hinxton,
Cambridge,
CB10 1SD



_______________________________________________
Users mailing list
[email protected]
https://lists.biomart.org/mailman/listinfo/users

Reply via email to