Hi Steffen FYI, Tanvir tried his query against the Ensembl mart database at www.ensembl.org and it works fine. Please point your host to http://www.ensembl.org/biomart/martview/ until the issue at www.biomart.org is fixed. Regards Rhoda
On 9 May 2013, at 08:00, Syed Haider <[email protected]> wrote: > Hi Steffen and Tanvir, > > not replying to the R forum, i suppose, you will take care of that. > > There is nothing wrong with the R and XML query. In theory, it means either > "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side OR the > allocated space is just too small to accommodate mysql temp tables created by > large queries such as sequence retrieval. > > Syed > > > On 8 May 2013 19:12, Steffen Durinck <[email protected]> wrote: > Hi list, > > I included the actual XML query that results in the error Mohammad is > reporting: > > The query: > <?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query > virtualSchemaName = 'default' uniqueRows = '1' count = '0' > datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name = > 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = > 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' > /></Dataset></Query> > > gives: > > caught BioMart::Exception::Database: Error during query execution: Can't > create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2) > > This comes from the central BioMart server (www.biomart.org), can anyone help? > > Best, > Steffen > > > On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <[email protected]> > wrote: > Hi, > I can run the code some days ago . But cant run now. > > Problem 1: Output is ok > ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) > utr5 = getSequence(chromosome=3, start=185514033, end=185535839, > type="entrezgene",seqType="5utr", mart=ensembl) > Output : > > 5utr entrezgene > > Sequence unavailable 10644 > > GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644 > 3 > GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG > 10644 > > CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644 > No UTR is annotated > for this transcript 10644 > > Problem 2:Problem is here > protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", > mart=ensembl) > > Error in getBM(c(seqType, type), filters = type, values = id, mart = mart, : > Query ERROR: caught BioMart::Exception::Database: Error during query > execution: Can't create/write to file > '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2) > > I need help please > > /.......Tanvir Ahamed > > _______________________________________________ > Users mailing list > [email protected] > https://lists.biomart.org/mailman/listinfo/users > > > _______________________________________________ > Users mailing list > [email protected] > https://lists.biomart.org/mailman/listinfo/users > > _______________________________________________ > Users mailing list > [email protected] > https://lists.biomart.org/mailman/listinfo/users Rhoda Kinsella Ph.D. Ensembl Production Project Leader, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD
_______________________________________________ Users mailing list [email protected] https://lists.biomart.org/mailman/listinfo/users
