Hi Syed,

I doubt it is a space issue in this case as only 2 sequences are being
retrieved, unless some big table merge happens on your side first before
these two sequences are pulled out.

Cheers,
Steffen


On Thu, May 9, 2013 at 12:00 AM, Syed Haider <[email protected]> wrote:

> Hi Steffen and Tanvir,
>
> not replying to the R forum, i suppose, you will take care of that.
>
> There is nothing wrong with the R and XML query. In theory, it means
> either "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side
> OR the allocated space is just too small to accommodate mysql temp tables
> created by large queries such as sequence retrieval.
>
> Syed
>
>
> On 8 May 2013 19:12, Steffen Durinck <[email protected]> wrote:
>
>> Hi list,
>>
>> I included the actual XML query that results in the error Mohammad is
>> reporting:
>>
>> The query:
>> <?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query
>>  virtualSchemaName = 'default' uniqueRows = '1' count = '0'
>> datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name
>> = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name =
>> 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728'
>> /></Dataset></Query>
>>
>> gives:
>>
>> caught BioMart::Exception::Database: Error during query execution: Can't
>> create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)
>>
>> This comes from the central BioMart server (www.biomart.org), can anyone
>> help?
>>
>> Best,
>> Steffen
>>
>>
>> On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed <
>> [email protected]> wrote:
>>
>>> Hi,
>>> I can run the code some days ago . But cant run now.
>>>
>>> Problem 1: Output is ok
>>> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl)
>>> utr5 = getSequence(chromosome=3, start=185514033, end=185535839, 
>>> type="entrezgene",seqType="5utr",
>>> mart=ensembl)
>>> Output :
>>>
>>>                       5utr  entrezgene
>>>
>>>      Sequence unavailable      10644
>>>
>>>  GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>>> 3
>>> GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG
>>>      10644
>>>
>>>  CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG      10644
>>>                                                          No UTR is
>>> annotated for this transcript      10644
>>>
>>> Problem 2:Problem is here
>>> protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide",
>>> mart=ensembl)
>>>
>>> Error in getBM(c(seqType, type), filters = type, values = id, mart =
>>> mart,  :
>>>   Query ERROR: caught BioMart::Exception::Database: Error during query
>>> execution: Can't create/write to file
>>> '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2)
>>>
>>> I need help please
>>>
>>> */.......Tanvir Ahamed*
>>>
>>> _______________________________________________
>>> Users mailing list
>>> [email protected]
>>> https://lists.biomart.org/mailman/listinfo/users
>>>
>>
>>
>> _______________________________________________
>> Users mailing list
>> [email protected]
>> https://lists.biomart.org/mailman/listinfo/users
>>
>
>
_______________________________________________
Users mailing list
[email protected]
https://lists.biomart.org/mailman/listinfo/users

Reply via email to