Hi Syed, I doubt it is a space issue in this case as only 2 sequences are being retrieved, unless some big table merge happens on your side first before these two sequences are pulled out.
Cheers, Steffen On Thu, May 9, 2013 at 12:00 AM, Syed Haider <[email protected]> wrote: > Hi Steffen and Tanvir, > > not replying to the R forum, i suppose, you will take care of that. > > There is nothing wrong with the R and XML query. In theory, it means > either "'/mnt/ephemeral0/mysqltmp/" does not exist on biomart server side > OR the allocated space is just too small to accommodate mysql temp tables > created by large queries such as sequence retrieval. > > Syed > > > On 8 May 2013 19:12, Steffen Durinck <[email protected]> wrote: > >> Hi list, >> >> I included the actual XML query that results in the error Mohammad is >> reporting: >> >> The query: >> <?xml version='1.0' encoding='UTF-8'?><!DOCTYPE Query><Query >> virtualSchemaName = 'default' uniqueRows = '1' count = '0' >> datasetConfigVersion = '0.6' header='1' requestid= "biomaRt"> <Dataset name >> = 'hsapiens_gene_ensembl'><Attribute name = 'peptide'/><Attribute name = >> 'entrezgene'/><Filter name = 'entrezgene' value = '100,5728' >> /></Dataset></Query> >> >> gives: >> >> caught BioMart::Exception::Database: Error during query execution: Can't >> create/write to file '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2) >> >> This comes from the central BioMart server (www.biomart.org), can anyone >> help? >> >> Best, >> Steffen >> >> >> On Wed, May 8, 2013 at 5:27 AM, Mohammad Tanvir Ahamed < >> [email protected]> wrote: >> >>> Hi, >>> I can run the code some days ago . But cant run now. >>> >>> Problem 1: Output is ok >>> ensembl = useDataset("hsapiens_gene_ensembl",mart=ensembl) >>> utr5 = getSequence(chromosome=3, start=185514033, end=185535839, >>> type="entrezgene",seqType="5utr", >>> mart=ensembl) >>> Output : >>> >>> 5utr entrezgene >>> >>> Sequence unavailable 10644 >>> >>> GGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644 >>> 3 >>> GGGGGGCGGAGGAGGAGGAGAGACGAGGGCAGCGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG >>> 10644 >>> >>> CGGAGGAGGCGAGGAGCGCCGGGTACCGGGCCGGGGGAGCCGCGGGCTCTCGGGGAAGAGACGG 10644 >>> No UTR is >>> annotated for this transcript 10644 >>> >>> Problem 2:Problem is here >>> protein = getSequence(id=c(100, 5728),type="entrezgene",seqType="peptide", >>> mart=ensembl) >>> >>> Error in getBM(c(seqType, type), filters = type, values = id, mart = >>> mart, : >>> Query ERROR: caught BioMart::Exception::Database: Error during query >>> execution: Can't create/write to file >>> '/mnt/ephemeral0/mysqltmp/#sql_40a_0.MYI' (Errcode: 2) >>> >>> I need help please >>> >>> */.......Tanvir Ahamed* >>> >>> _______________________________________________ >>> Users mailing list >>> [email protected] >>> https://lists.biomart.org/mailman/listinfo/users >>> >> >> >> _______________________________________________ >> Users mailing list >> [email protected] >> https://lists.biomart.org/mailman/listinfo/users >> > >
_______________________________________________ Users mailing list [email protected] https://lists.biomart.org/mailman/listinfo/users
