Re: [NTG-context] Installing VSCode extension?
> Am 29.07.2020 um 14:19 schrieb Alasdair McAndrew : > > Thank you very much, but in fact that script file "vscode-context.cmd" really > just contains the same command for installing extensions as I quoted above - > and so produces the same errors. Maybe I'll go back to trying SciTe - I gave > it a bit of a go, but wasn't successful. Of all the information on the > context-wiki, and the Pragma webpage - where would I go to find the most > up-to-date information about configuring an editor to work with ConTeXt in > Windows? You could try Atom and install the ConTeXt module from github.com/massifrg/language-context. Original language-context is outdated, but upstream didn’t react to mails from Massi and me. This version also isn’t perfect, but I’m using and occasionally updating it. (I should re-base it on the current work done for the wiki.) There’s also still no run command. Additionally you should install - language-latex (contains plain TeX commands) - language-lua - atom-ide-terminal (for running ConTeXt in place) - file-icons (only icon package that contains TeX icons) - pdf-view (not very good, but good enough for simple cases) Best, Hraban ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Installing VSCode extension?
Thank you very much, but in fact that script file "vscode-context.cmd" really just contains the same command for installing extensions as I quoted above - and so produces the same errors. Maybe I'll go back to trying SciTe - I gave it a bit of a go, but wasn't successful. Of all the information on the context-wiki, and the Pragma webpage - where would I go to find the most up-to-date information about configuring an editor to work with ConTeXt in Windows? Thanks again, Alasdair On Wed, Jul 29, 2020 at 2:51 AM Hans Hagen wrote: > On 7/28/2020 6:51 AM, Alasdair McAndrew wrote: > > I am installing the Windows version of ConTeXt, which comes with a > > VSCode extension, in > > > > \tex\texmf-context\context\data\vscode\extensions > > > > > > with instructions to run (from within the VSCode terminal): > > > > code -- extensions-dir -- install-extension context > > > > > > The trouble is that the current ConTeXt installation (as of 65 minutes > > ago), doesn't seem to contain an extension in the format that VSCode > > understands. Running that command produces the errors: > > > > Installing extensions... > > Extension 'context' not found. > > Make sure you use the full extension ID, including the publisher, > > e.g.: ms-dotnettools.csharp > > Failed Installing Extensions: context: > > > > > > For what it's worth, I'm running VSCode 1.46.0. > > > > How can I install the VSCode ConTeXt extension? > Here i just run this (seems to work with latest update): > > data/context/vscode-context.cmd > > (I only occasionally check vscode and will look into it again when there > is easy suffix dependent runner support. Of course I do generate the > syntax files.) > > Hans > > > - >Hans Hagen | PRAGMA ADE >Ridderstraat 27 | 8061 GH Hasselt | The Netherlands > tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl > - > > ___ > If your question is of interest to others as well, please add an entry to > the Wiki! > > maillist : ntg-context@ntg.nl / > http://www.ntg.nl/mailman/listinfo/ntg-context > webpage : http://www.pragma-ade.nl / http://context.aanhet.net > archive : https://bitbucket.org/phg/context-mirror/commits/ > wiki : http://contextgarden.net > > ___ > -- https://numbersandshapes.net ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Using variables and macros for styling of section title and line in table of contents
Thanks so much for such a quick reply Wolfgang
<https://www.avast.com/sig-email?utm_medium=email_source=link_campaign=sig-email_content=webmail>
Virus-free.
www.avast.com
<https://www.avast.com/sig-email?utm_medium=email_source=link_campaign=sig-email_content=webmail>
<#DAB4FAD8-2DD7-40BB-A1B8-4E2AA1F9FDF2>
On Wed, 22 Jul 2020 at 20:38, Wolfgang Schuster <
wolfgang.schuster.li...@gmail.com> wrote:
> James Withers schrieb am 22.07.2020 um 21:20:
> > Dear list
> >
> > I have a document with section headings which include a title, date and
> > reference spread over two lines with different font style and
> > justification, plus a slightly different text for the table of contents.
> >
> > So that I can alter the styling of the section headings without having
> > to recode each \startsection command, I have used variables and a macro
> > command for the style.
> >
> > This works for section 'title' and 'marking', but not for the 'list'
> > attribute.
>
> The title argument works only because it is placed in the text but it
> won't work when you try to show the argument in the ToC like the list
> argument.
>
> > The minimal working example below shows what I'm trying to do.
> >
> > Best wishes and many thanks in advance.
> >
> > James
> >
> >
> \define\mytitle{\getvariable{myvar}{title}\crlf{\tfx\getvariable{myvar}{date}\hfill\getvariable{myvar}{ref}}}
> > \define\mylist{\getvariable{myvar}{list}---{\bf
> \getvariable{myvar}{date}}}
>
> In this case you have to use \defineexpandable to create your commands
> and enable expansion for sections.
>
> \defineexpandable\mytitle{...}
> \defineexpandable\mylist {...}
>
> \setuphead[section][expansion=yes]
>
> Wolfgang
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Using variables and macros for styling of section title and line in table of contents
James Withers schrieb am 22.07.2020 um 21:20:
Dear list
I have a document with section headings which include a title, date and
reference spread over two lines with different font style and
justification, plus a slightly different text for the table of contents.
So that I can alter the styling of the section headings without having
to recode each \startsection command, I have used variables and a macro
command for the style.
This works for section 'title' and 'marking', but not for the 'list'
attribute.
The title argument works only because it is placed in the text but it
won't work when you try to show the argument in the ToC like the list
argument.
The minimal working example below shows what I'm trying to do.
Best wishes and many thanks in advance.
James
\define\mytitle{\getvariable{myvar}{title}\crlf{\tfx\getvariable{myvar}{date}\hfill\getvariable{myvar}{ref}}}
\define\mylist{\getvariable{myvar}{list}---{\bf \getvariable{myvar}{date}}}
In this case you have to use \defineexpandable to create your commands
and enable expansion for sections.
\defineexpandable\mytitle{...}
\defineexpandable\mylist {...}
\setuphead[section][expansion=yes]
Wolfgang
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
[NTG-context] Using variables and macros for styling of section title and line in table of contents
Dear list
I have a document with section headings which include a title, date and
reference spread over two lines with different font style and
justification, plus a slightly different text for the table of contents.
So that I can alter the styling of the section headings without having to
recode each \startsection command, I have used variables and a macro
command for the style.
This works for section 'title' and 'marking', but not for the 'list'
attribute.
The minimal working example below shows what I'm trying to do.
Best wishes and many thanks in advance.
James
\define\mytitle{\getvariable{myvar}{title}\crlf{\tfx\getvariable{myvar}{date}\hfill\getvariable{myvar}{ref}}}
\define\mylist{\getvariable{myvar}{list}---{\bf \getvariable{myvar}{date}}}
\starttext
\completecontent
\setvariables[myvar][
title={What I would like},
date={2020},
ref={Reference No 1},
list={Variation on title},
]
\startsection[title=\mytitle,list={Variation on title---{\bf 2020}}]
Contents line to look like this:
\mylist
\stopsection
\setvariables[myvar][
title={What I get},
date={2021},
ref={Reference No 2},
list={Something for the contents},
]
\startsection[title=\mytitle,list=\mylist]
Contents line to look like this:
\mylist
\stopsection
\stoptext
<https://www.avast.com/sig-email?utm_medium=email_source=link_campaign=sig-email_content=webmail>
Virus-free.
www.avast.com
<https://www.avast.com/sig-email?utm_medium=email_source=link_campaign=sig-email_content=webmail>
<#DAB4FAD8-2DD7-40BB-A1B8-4E2AA1F9FDF2>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Pre-registration for 14th ConTeXt Meeting, September 6–12, 2020
Dear list, there are ten days left for pre-registration to ConTeXt Meeting 2020 <https://meeting.contextgarden.net/2020/>. Pre-registration counts as early bird registration. In one week we will start to discuss the situation in the mailing list of participants and make a final decision whether to go on with the meeting preparations or cancel the meeting. From development in the Czech Republic so far one can guess, there will possibly be only light local restrictions (obligation to wear masks, serving only take-away food), if needed. The abstracts <https://meeting.contextgarden.net/2020/abstracts.shtml> of some talks are already available. We have fifteen pre-registered participants <https://meeting.contextgarden.net/2020/participants.shtml>, just enough to make the meeting possible. People will mostly arrive by car, some on foot or by bus/train. We have space for ten more participants. If you have never been at the meeting, do not hesitate to pre-register <https://meeting.contextgarden.net/2020/register.shtml> with discounts. Those who visited Sibřina two years ago already know what to expect (talks, friends, food, wine, beer, music, countryside, ...). Close to the capital, but far enough to be safe for the whole week. Take care, Jano On Tue, 2 Jun 2020 at 16:48, Jano Kula wrote: > Dear ConTeXt users! > > The 14th ConTeXt Meeting <https://meeting.contextgarden.net/2020/> in the > Czech Republic is in preparation as originally planned. As nobody is able > to predict the situation in September, we have started pre-registration > only and will discuss conditions at the end of July via the mailing list of > pre-registered participants. We will take into account up-to-date travel > restrictions and health risks and make the final decision on July 31, 2020, > based also on the number of pre-registrations. > > Till then no payment is wanted. All pre-registered participants qualify > for early bird discount to be paid during the first week of August. > Pre-registration doesn't bind you to pay or attend the meeting. > > The ConTeXt Group board has discussed other options (on-line meeting, > postponing the meeting), but these are unlikely to happen, in case the > meeting is cancelled. > > *14th ConTeXt Meeting* > *September 6–12, 2020, Sibřina, Czech Republic* > > For the second time we will held the meeting at the friendly farm U Škodů, > at the eastern border of Prague. See the gallery from 2018 > <http://kostverlorenvaart.nl/context2018/> by Frans Goddijn. > > Topics will cover usage and development of LuaMetaTeX, ConTeXt, and > everything related. Each meeting is source of inspiration for everybody, > from beginner to expert. Friendly company is always looking for meeting new > participants, users of LuaTeX, LuaMetaTeX, ConTeXt, Metapost, etc. > > There is a special discount for those, who attend the meeting for the > first time and for students. Also ConTeXt Group members are qualified for > the discount, so consider joining the group. > > For more details and pre-registration visit the 14th ConTeXt Meeting > <https://meeting.contextgarden.net/2020/> page. > > Hope to see you in September, > Jano > on behalf of the ConTeXt Group <https://group.contextgarden.net> > > > ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] french translation of ConTeXt interface - progress (v3)
I guess pdp is "Pied de page". I don't speak French, but it is close enough
to Spanish. Maybe we should do a translation to Spanish too.
Congratulations for your colossal effort, Garulfo.
Jairo :)
El dom., 19 de jul. de 2020 11:49 p. m., Aditya Mahajan
escribió:
> On Sun, 19 Jul 2020, Garulfo wrote:
>
> > Thanks a lot !!
> >
> > I'm beginning to be able to typeset some simple example without any
> struggle.
> >
> > https://wiki.contextgarden.net/File:modele_bonjour_le_monde.pdf
> >
> > The input file is attached in this mail.
>
> Thanks for all the hard work. Some minor comments on the sample file (some
> of them also apply to the English version).
>
> 1. You don't need
>
>\configurercouleurs[état=activé]
>
> That is the default in MkIV and LMTX.
>
> 2. Also:
>
> \utiliserURL[wiki] [http://wiki.contextgarden.net][][wiki
> \ConTeXt\ ]
>
> It may be better to use `\ConTeXT{}` with no space afterwards.
>
> 3. Why use abbreviated names:
>
> \configurerpdp[style=\italique]
> \configurertextespdp[\date \hfill Modèle \ConTeXt]
>
> I am guessing `pdp` is somehow an abbreviation of `footer`. One of the
> things that I really like about ConTeXt compared to LaTeX is that there are
> no funny abbreviations.
>
> It might be better to use
>
> \configurertextespdp[\date][Modèle \ConTeXt]
>
> 4. It may be better to reword \citer. That might create confusion with the
> bibliography commands which use \cite.
>
> 5. I am not sure why you include an example of buffers in this document.
> If it was just to have some filler text, I think that after all this work
> you can persuade Hans to include a sample file from a French author in the
> distribution :-)
>
> Aditya
>
>
> ___
> If your question is of interest to others as well, please add an entry to
> the Wiki!
>
> maillist : ntg-context@ntg.nl /
> http://www.ntg.nl/mailman/listinfo/ntg-context
> webpage : http://www.pragma-ade.nl / http://context.aanhet.net
> archive : https://bitbucket.org/phg/context-mirror/commits/
> wiki : http://contextgarden.net
>
> ___
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] french translation of ConTeXt interface - progress (v3)
On Sun, 19 Jul 2020, Garulfo wrote:
Thanks a lot !!
I'm beginning to be able to typeset some simple example without any struggle.
https://wiki.contextgarden.net/File:modele_bonjour_le_monde.pdf
The input file is attached in this mail.
Thanks for all the hard work. Some minor comments on the sample file (some of
them also apply to the English version).
1. You don't need
\configurercouleurs[état=activé]
That is the default in MkIV and LMTX.
2. Also:
\utiliserURL[wiki] [http://wiki.contextgarden.net][][wiki
\ConTeXt\ ]
It may be better to use `\ConTeXT{}` with no space afterwards.
3. Why use abbreviated names:
\configurerpdp[style=\italique]
\configurertextespdp[\date \hfill Modèle \ConTeXt]
I am guessing `pdp` is somehow an abbreviation of `footer`. One of the things
that I really like about ConTeXt compared to LaTeX is that there are no funny
abbreviations.
It might be better to use
\configurertextespdp[\date][Modèle \ConTeXt]
4. It may be better to reword \citer. That might create confusion with the
bibliography commands which use \cite.
5. I am not sure why you include an example of buffers in this document. If it
was just to have some filler text, I think that after all this work you can
persuade Hans to include a sample file from a French author in the distribution
:-)
Aditya
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] french translation of ConTeXt interface - progress (v3)
Thanks a lot !!
I'm beginning to be able to typeset some simple example without any
struggle.
https://wiki.contextgarden.net/File:modele_bonjour_le_monde.pdf
The input file is attached in this mail.
I have only one remaining issue with this example: the indentation.
Despite \setupindenting[medium, yes], the paragraphs are not
systematically indented, and I don't really understand the pattern
behind it.
The point is also visible on the original english version
https://wiki.contextgarden.net/File:Hello-world.pdf
Le 19/07/2020 à 15:13, Wolfgang Schuster a écrit :
Garulfo schrieb am 19.07.2020 um 13:23:
Hi Wolfgang,
still working on the translation... (Hans pointed out the
possibilities due to the support of UTF-8, which are just great for
french language)
zip: https://wiki.contextgarden.net/File:MWE_test_itemize_french.zip
I have difficulties with a simple example
file: MWE_test_itemize_french.tex
% interface=fr
\configurerdétailler[style=gras]
\débuttexte
\débutdétailler[a]
\élément Texte premiere
\élément Texte second
\findétailler
\fintexte
It works properly with "minimal" modifications of mult-def.lua
file: mult-def.lua.initial+diffminimalsetupitemize
https://wiki.contextgarden.net/File:MWE_test_itemize_french.zip
but with a more complete mult-def.lua
file: mult-def.lua.complet
I get "The control sequence at the end of the top line of your error
message was never \def'ed. You can just continue as I'll forget about
whatever was undefined."
Could you please help me find my way around: what do I need to pay
attention to so that my other modifications don't break the whole
mechanism?
Everything works as expected but you have set a string for the endsetup
element which has become part of your \setupitemize command.
Setup commands are created in the following way:
+ +
this creates in your case the command
\configurerdétaillerfinconfigurer
As you don't want this leave the value of endsetup empty.
Wolfgang
% interface=fr
% Document "Bonjour tout le monde!" pour le système de composition ConTeXt
%
% === Histoire ===
% 2020-07-18 Garulfo
% * Passage en français
% 2006-12-29 Sanjoy Mahajan
% * Création
%
% Ce document est du domaine public (pas de droits d'auteur).
%===
\configurercouleurs[état=activé] % sinon le document est en liveau de gris
\définircouleur[couleurtitre][r=0.80,b=0.1,g=0.1]
% Métadata du document
\configurerinteraction[état=activé,% rendre les liens hypertextes actifs
titre={Bonjour le monde!},
soustitre={Un modèle ConTeXt},
auteur={Garulfo},
motclé={modèle ConTeXt}]
% urls utiles
\utiliserURL[courriel-auteur][mailto:a.u.t...@quelque.part][][a.u.t...@quelque.part]
\utiliserURL[wiki] [http://wiki.contextgarden.net][][wiki \ConTeXt\ ]
\utiliserURL[garulfo][mailto:garu...@azules.eu] [][garu...@azules.eu]
% Composition format A4, impression format A4
\configurertaillepapier[A4][A4]
\configurermiseenpage
[ espacehaut=2cm,
espacearrière=2.5cm,
entête=24pt,
pdp=36pt,
hauteur=milieu,
largeur=milieu]
% Décommenté ma migne suivant pour visualier la mise en page
% \montrercadre
% en-tête et pied de page
\configurerpdp[style=\italique]
\configurertextespdp[\date \hfill Modèle \ConTeXt]
\configurernumérotationpage[emplacement={entête,droite}, style=gras]
\configurerpolicedecorps[11pt] % 12pt par défaut
\configurertête[section,chapitre,sujet][couleur=couleurtitre]
\configurertête[section,sujet][style={\ss\bfa},
avant={\grandespace\grandespace}, après={}]
\configurertête[chapitre][style={\ss\bfd}]
\configurertête[titre][style={\ss\bfd},
avant={\begingroup\configurerpolicedecorps[14pt]},
après={\lignegauche{\ss\tfa A. U. Teur $\langle$\de[courriel-auteur]$\rangle$}
\grandespace\grandespace\endgroup}]
\configurerdétailler[entre={}, style=gras]
% configurer l'espacement inter-paragraphes
\configurerespaceblanc[moyen]
% Commenter la ligne suivante pour ne pas indenter les paragraphes
\configurerindentation[oui, moyen, toujours]
\langueprincipale[fr]
\langue[fr]
\configureraligner[tolerant]
\débuttampon[tuftefr]
Nous nous épanouissons dans les mondes de l'information - des mondes épais -
grâce à notre merveilleuse et quotidienne capacité à sélectionner, éditer,
isoler, structurer, mettre en évidence, regrouper, jumeler, fusionner,
harmoniser, synthétiser, concentrer, organiser, condenser, réduire, réduire,
choisir, catégoriser, cataloguer, classer, énumérer, résumer, scanner, examiner,
idéaliser, isoler, discriminer, distinguer, cribler, mettre en boîte,
sélectionner, trier, intégrer, mélanger, Inspecter, filtrer, regrouper, sauter,
lisser, en morceaux, moyenner, approximer, regrouper, agréger, délimiter,
résumer, détailler, passer en revue, plonger, feuilleter, parcourir, j
Re: [NTG-context] french translation of ConTeXt interface - progress (v3)
On 7/18/2020 8:56 PM, Garulfo wrote: > @Garulfo: Do you have a special use case in mind, or do you do this > for fun? "for fun" isn't quite right, although there's probably some truth to it. Actually, translating 6,300 keywords isn't fun, and it's even worst when you don't really master the material behind... but i guess you learn a lot in the process The point is that I am sad to not be able to offer the use of ConTeXt (such a great piece of software) to friends and childrens. And ConTeXt complexity or ConTeXt documentation are not the first hurdles. indeed (which is why for instance we use the dutch for e.g. family members) most users actually can do with a limited set of commands to start with ... and writing a tutorial for that is doable ... it's still on my agenda to come up with something for kids and translated interfaces are needed for that (unless we ditch all languages for english .. but if that happens, we can actually do without tex because a large portion, at least in context, is dedicated to dealing with scripts and languages) When you start with a new software, a new methodology, having first to struggle with vocabulary in a foreign language is definitively a (BIG) thorn in your side (in fact, usually you just don't start). Many popular softwares offer multi-language early in their development (netscape / firefox, scratch, wordpress, krita...). ConTeXt did it, the infrastructure is ready, the translations exist, at least partially or at an early stage. indeed, it was there right from the start ... as a historic note: the reason what that we had a subsystem for chemistry which could be configured usinng key values (we're talking early nineties) and in order to be used in german we made the multi lingual interface (after that the english and others lists were added) .. the german was done with Tobias Burnus who also helped with the early multi language support) context goes along way back ... And when I started to use it, I thought that it could easily be improved and updated without requiring any Tex / Lua skills. One remark : I was wrong, I spend hours to put all the content (from mult-def and context-en.xml) in a simple csv table and building quick scripts to put it back in mult-def. (normally i then put up some music or a movies i already saw before in the background or some podcast or ...) > With our small developer and user base we struggle enough with keeping > documentation current. Struggle likely appears about not-so-trivial needs. It's a shame not to use it in Italian / Russian / Chinese / French etc... for a letter, for a 10 to 20 pages report, for an internal note. exactly ... (btw, tex promotion is often tight to scientific publishing but the interesting fact there is that as soon as you drop the formulas it often doesn't look that pretty any more .. another property of context is that users should be able to make a nice layout) All the more so as the software allows it. The point is that the interface just deserves a minimal update and documentation, and that, as you point it, the small developer and user base doesn't have time to do it. indeed, and sorry for not keeping it up to date Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Space after Round bracket before Punctuation
Thank you Hans, this was very helpful. I found that the following
worked (apart from in two or three cases):
\startluacode
fonts.handlers.otf.addfeature {
name = "iebpkerns",
type = "kern",
data = {
[")"] = {
[","] = -80,
["."] = -80,
[":"] = -80,
[";"] = -80,
[")"] = -80,
["]"] = -80,
},
["]"] = {
[","] = -80,
["."] = -80,
[":"] = -80,
[";"] = -80,
[")"] = -80,
["]"] = -80,
},
},
}
\stopluacode
Best, Richard
-Original Message-
From: Hans Hagen
To: mailing list for ConTeXt users , Richard
Mahoney | Indica et Buddhica
Subject: Re: [NTG-context] Space after Round bracket before
Punctuation
Date: Thu, 9 Jul 2020 12:21:02 +0200
Mailer: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:68.0)
Gecko/20100101
Thunderbird/68.10.0
X-Spam-Score: 0.0
On 7/9/2020 11:59 AM, Richard Mahoney | Indica et Buddhica wrote:
> I'm typesetting some proceedings which include a good number of
> roundbrackets followed by punctuation. This often occurs in the body
> of thetext, but also in the hand coded bibliographies, e.g.:
> ) plus . , ; :
> The trouble is that excessive space is often introduced between
> thebracket and the punctuation. I can control the excessive space
> thatsometimes occurs between ) and . by using )\periods[1], although
> thisruins the protrusion if it occurs at the end of a line.
> Does anyone know how I might be able to somehow "tie" ) to . , ; :
> sothat the distance remains reasonable, and so that protrusion
> stillworks?
you first have to make an MWE that demonstrates how protrusion works
here ... then we can see how we can best deal with it
Anyway, often tricks for this can be found in the test suite of font
manual(s) ... here is a variant ...
\startluacode fonts.handlers.otf.addfeature { name =
"mykerns", type = "kern", data =
{ [")"] = { [","] =
-300, ["."] = -300, [":"] =
-250, [";"] = -250, [")"] =
-100, }, }, }\stopluacode
\definefontfeature[default][default][mykerns=true]
\setupbodyfont [dejavu,12pt]
\startTEXpage[offset=10pt] whatever), whatever): whatever)
; whatever). whatever))\stopTEXpage
Hans
---
-- Hans Hagen | PRAGMA
ADE Ridderstraat 27 | 8061 GH Hasselt | The
Netherlandstel: 038 477 53 69 | www.pragma-ade.nl |
www.pragma-pod.nl
-
--
Richard Mahoney | Indica et Buddhica
Littledene Bay Road Oxford NZT: +64 3 312 1699 M: +64 210 640 216IM: @rmahoney
https://t.me/rmahoneyrmaho...@indica-et-buddhica.org
https://indica-et-buddhica.org/
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Store images and text in the right margin
Hi Taco,
Thank you for your help. What I want to do is write a course for my
students, and the definitions, theorems ... will be illustrated by graphs,
examples, remarks ... placed in the right margin. The idea is to consider
that a text or a graphic is an element to place in the right margin without
worrying about the nature and that a single command does the job. What you
are proposing goes in the right direction. However, I noticed a little
problem with the hyphenation.
Fabrice
Le lun. 6 juil. 2020 à 16:35, Taco Hoekwater a écrit :
> Hi Fabrice,
>
> Like this maybe? It depends on what you want to achieve exactly, I think
>
> \useMPlibrary[dum]
>
> \setuppapersize[A4]
>
> \setuplayout
> [width=12cm,
>rightmargin=5cm]
>
> \defineuserdata [margintext] [alternative=margintext]
>
> \defineuserdataalternative [margintext]
> [renderingsetup=userdata:margintext]
>
> \startsetups [userdata:margintext]
> \margindata
> [inright]
> [style={\switchtobodyfont[9pt]},
> width=\rightmarginwidth,
> align={flushleft,broad},
> stack=yes]
> {\startframedtext[before=,after=,offset=0pt,width=max,frame=off]
> \getinlineuserdata
> \stopframedtext}
> \stopsetups
>
> \showframe
> \starttext
> \startuserdata[margintext]
> {\bf Remarque — }\input ward
> \stopuserdata
> \startuserdata[margintext]
> \externalfigure[dummy][width=\rightmarginwidth]
> \stopuserdata
> \startchapter[title=First chapter]
> \dorecurse{2}{\input knuth}
> \stopchapter
> \stoptext
>
>
> > On 6 Jul 2020, at 16:18, Fabrice Couvreur
> wrote:
> >
> >
> >
> > -- Forwarded message -
> > De : Fabrice Couvreur
> > Date: lun. 6 juil. 2020 à 12:10
> > Subject: Re: [NTG-context] Store images and text in the right margin
> > To: Marco
> >
> >
> > Hello,
> > What has been proposed by Wolfgang and Marco works correctly but is it
> possible to define a single environment margintext which would allow to
> include both text and figures ?
> > Thank you
> > Fabrice
>
> ___
> If your question is of interest to others as well, please add an entry to
> the Wiki!
>
> maillist : ntg-context@ntg.nl /
> http://www.ntg.nl/mailman/listinfo/ntg-context
> webpage : http://www.pragma-ade.nl / http://context.aanhet.net
> archive : https://bitbucket.org/phg/context-mirror/commits/
> wiki : http://contextgarden.net
>
> ___
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Store images and text in the right margin
Hi Fabrice,
Like this maybe? It depends on what you want to achieve exactly, I think
\useMPlibrary[dum]
\setuppapersize[A4]
\setuplayout
[width=12cm,
rightmargin=5cm]
\defineuserdata [margintext] [alternative=margintext]
\defineuserdataalternative [margintext] [renderingsetup=userdata:margintext]
\startsetups [userdata:margintext]
\margindata
[inright]
[style={\switchtobodyfont[9pt]},
width=\rightmarginwidth,
align={flushleft,broad},
stack=yes]
{\startframedtext[before=,after=,offset=0pt,width=max,frame=off]
\getinlineuserdata
\stopframedtext}
\stopsetups
\showframe
\starttext
\startuserdata[margintext]
{\bf Remarque — }\input ward
\stopuserdata
\startuserdata[margintext]
\externalfigure[dummy][width=\rightmarginwidth]
\stopuserdata
\startchapter[title=First chapter]
\dorecurse{2}{\input knuth}
\stopchapter
\stoptext
> On 6 Jul 2020, at 16:18, Fabrice Couvreur wrote:
>
>
>
> -- Forwarded message -
> De : Fabrice Couvreur
> Date: lun. 6 juil. 2020 à 12:10
> Subject: Re: [NTG-context] Store images and text in the right margin
> To: Marco
>
>
> Hello,
> What has been proposed by Wolfgang and Marco works correctly but is it
> possible to define a single environment margintext which would allow to
> include both text and figures ?
> Thank you
> Fabrice
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
[NTG-context] Fwd: Store images and text in the right margin
-- Forwarded message -
De : Fabrice Couvreur
Date: lun. 6 juil. 2020 à 12:10
Subject: Re: [NTG-context] Store images and text in the right margin
To: Marco
Hello,
What has been proposed by Wolfgang and Marco works correctly but is it
possible to define a single environment margintext which would allow to
include both text and figures ?
Thank you
Fabrice
Le sam. 4 juil. 2020 à 11:36, Fabrice Couvreur
a écrit :
> Hi Marco,
> Without being a specialist, I knew the \blank command, but I too thought
> that there must be another solution.
> Thank you for your help.
> Fabrice
>
> Le ven. 3 juil. 2020 à 11:04, Marco a écrit :
>
>> On Fri, 3 Jul 2020 10:39:41 +0200
>> Fabrice Couvreur wrote:
>>
>> > I think there should be a space between comments and figures.
>>
>> Maybe you can add manual \blank[…] in the margindata setups, e.g.
>>
>> ...
>> {\blank{\bf Remarque — }\getinlineuserdata\blank}
>>
>> Otherwise I'm sure there's a more elegant solution using dedicated
>> keys, but as I haven't used that mechanism for a while I can't tell
>> which works. Maybe manual blanks already do the job.
>>
>> Marco
>>
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
[NTG-context] Fwd: Radicals are broken (again)
I broke my own installation some hours ago and I fixed it. My sincere
apologies for any inconvenience.
Jairo :)
-- Forwarded message -
De: Jairo A. del Rio
Date: dom., 5 de jul. de 2020 a la(s) 16:06
Subject: Radicals are broken (again)
To: mailing list for ConTeXt users
The following gives wrong outputs both in LuaTeX and LuaMetaTeX:
\starttext $\sqrt{3}$ \stoptext
The beta date is 2020.7.5. Thank you very much.
Jairo :)
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
[NTG-context] Radicals are broken (again)
The following gives wrong outputs both in LuaTeX and LuaMetaTeX:
\starttext $\sqrt{3}$ \stoptext
The beta date is 2020.7.5. Thank you very much.
Jairo :)
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
[NTG-context] Fwd: TeX Annual Meeting 2020 going online
Hi all, See the announcement for the (online) TUG 2020 meeting below. Best wishes, Taco > Begin forwarded message: > > From: Paulo Ney DE SOUZA > Subject: TeX Annual Meeting 2020 going online > Date: 1 July 2020 at 21:32:35 CEST > > --- > The TeX annual user conference TUG 2020 is going digital on July 24, 25, 26. > Register for free! > > As we move TUG 2020 completely online, we look forward to offering you the > same vibrant programming, innovative and timely content from presenters, and > opportunities to reflect and connect over the emerging topics in TeX and > typography with users across the world. The online conference will include > our regular offerings and opportunities for engagement, including sessions, > workshops, keynotes, and space to connect with users, from across the globe. > > We will have keynote addresses by Steven Matteson, the designer of the NOTO > fonts and John MacFarlane the author of Pandoc. We will also feature > interviews with Javier Bezos of Babel and Philip Kime of BibLaTeX. > > In addition to participating in the live event, all attendees will have > access to break-out rooms for networking and social engagement. Moving our > face-to-face conference to a fully online format presents us with the unique > opportunity to spotlight the best of what the online modality affords – > meaningful collaboration and the ability to reflect and connect with > colleagues around the world. We hope that you will join us for this > reimagined event, and celebrate our collective resilience and dedication to > forging connections without boundaries. > > We look forward to welcoming you to the TUG 2020 Online Conference in July, > and we are here to help you however we can with questions and requests for > support. Please feel free to reach out to us with requests related to TUG > 2020 at > > tug-conferen...@tug.org <mailto:tug-conferen...@tug.org> > > Registration is required. While access to the meeting will be free to > everyone, you will be required to register to view the meeting. Even if you > registered to attend the TUG 2020 at RIT, you will need to register again for > TUG 2020 Online. Registration for the meeting is open at > > https://tug.org/tug2020/ <https://tug.org/tug2020/> > > Paulo Ney de Souza > TUG 2020 Organizers Taco Hoekwater Elvenkind BV ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] using modeset
Thank you for your advice Hraban. From: Henning Hraban RammSent: Monday, 15 June 2020 20:23To: mailing list for ConTeXt usersSubject: Re: [NTG-context] using modeset > Am 12.06.2020 um 11:26 schrieb Jan Willem Flamma :> > Thank you Wolfgang, BPJ and Robert for your answers and feedback. Much appreciated. > > I will explorer the solutions that have been offered to extend my knowledge on using ConTeXt but at the same time I value the advice of not going down that route for large document. The project that pays my bills is technical documentation in several languages (in LaTeX3, setup by Marei). Each manual is constructed from many small building blocks of text. Each block is in its own file.That makes editing one whole manual somewhat tedious, but pays off if you recycle the same blocks. E.g. each block is only translated once, even if it appears in several manuals (think of security instructions or legal stuff that is the same in all). Each block has an explicite change date to keep track of the state of the different translations.The two main files of each product are one that contains just a few settings and one that pulls in all the needed building blocks. In this case all blocks with the same content in different languages are kept together in one directory (files have a language code). Another approach would be same structures and file names below a main language directory.If you have only one translation, the latter might be better. If you need to keep several translations in sync, the first approach might make more sense. Hraban___If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-contextwebpage : http://www.pragma-ade.nl / http://context.aanhet.netarchive : https://bitbucket.org/phg/context-mirror/commits/wiki : http://contextgarden.net___ ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] using modeset
> Am 12.06.2020 um 11:26 schrieb Jan Willem Flamma : > > Thank you Wolfgang, BPJ and Robert for your answers and feedback. Much > appreciated. > > I will explorer the solutions that have been offered to extend my knowledge > on using ConTeXt but at the same time I value the advice of not going down > that route for large document. The project that pays my bills is technical documentation in several languages (in LaTeX3, setup by Marei). Each manual is constructed from many small building blocks of text. Each block is in its own file. That makes editing one whole manual somewhat tedious, but pays off if you recycle the same blocks. E.g. each block is only translated once, even if it appears in several manuals (think of security instructions or legal stuff that is the same in all). Each block has an explicite change date to keep track of the state of the different translations. The two main files of each product are one that contains just a few settings and one that pulls in all the needed building blocks. In this case all blocks with the same content in different languages are kept together in one directory (files have a language code). Another approach would be same structures and file names below a main language directory. If you have only one translation, the latter might be better. If you need to keep several translations in sync, the first approach might make more sense. Hraban ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
[NTG-context] Pre-registration for 14th ConTeXt Meeting, September 6–12, 2020
Dear ConTeXt users! The 14th ConTeXt Meeting <https://meeting.contextgarden.net/2020/> in the Czech Republic is in preparation as originally planned. As nobody is able to predict the situation in September, we have started pre-registration only and will discuss conditions at the end of July via the mailing list of pre-registered participants. We will take into account up-to-date travel restrictions and health risks and make the final decision on July 31, 2020, based also on the number of pre-registrations. Till then no payment is wanted. All pre-registered participants qualify for early bird discount to be paid during the first week of August. Pre-registration doesn't bind you to pay or attend the meeting. The ConTeXt Group board has discussed other options (on-line meeting, postponing the meeting), but these are unlikely to happen, in case the meeting is cancelled. *14th ConTeXt Meeting* *September 6–12, 2020, Sibřina, Czech Republic* For the second time we will held the meeting at the friendly farm U Škodů, at the eastern border of Prague. See the gallery from 2018 <http://kostverlorenvaart.nl/context2018/> by Frans Goddijn. Topics will cover usage and development of LuaMetaTeX, ConTeXt, and everything related. Each meeting is source of inspiration for everybody, from beginner to expert. Friendly company is always looking for meeting new participants, users of LuaTeX, LuaMetaTeX, ConTeXt, Metapost, etc. There is a special discount for those, who attend the meeting for the first time and for students. Also ConTeXt Group members are qualified for the discount, so consider joining the group. For more details and pre-registration visit the 14th ConTeXt Meeting <https://meeting.contextgarden.net/2020/> page. Hope to see you in September, Jano on behalf of the ConTeXt Group <https://group.contextgarden.net> ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Proposal to update the "Manuals" wiki page
This is great work. Many thanks! Kind regards,Jan Willem Flamma From: GarulfoSent: Tuesday, 19 May 2020 15:23To: ntg-context@ntg.nlSubject: [NTG-context] Proposal to update the "Manuals" wiki page Hi, I hope you're all doing well. Please, you will find a proposal to update the Manuals page on the wiki:https://wiki.contextgarden.net/ManualsGallery 2 objectives:1/ to make something more visual, to help the user identify the different documents, their organization, their date of release.2/ to gather all the updated documents in one place Sources were :- http://www.pragma-ade.com/overview.htm- https://wiki.contextgarden.net/Manuals, and wiki snippets here and there.- https://github.com/hmenke/context-examples/blob/master/GUIDE.md Depending on your comments, and if there is an interest, I would be happy to improve it (correct errors, change document segmentation, better colors choice, additional data such as authors, number of pages). It's mainly built from cvs table + script. Finally, if you approve this update, I can arrange to clean up some pages of the wiki about the manuals. Best, ___If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-contextwebpage : http://www.pragma-ade.nl / http://context.aanhet.netarchive : https://bitbucket.org/phg/context-mirror/commits/wiki : http://contextgarden.net___ ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Proposal to update the "Manuals" wiki page
> On 19 May 2020, at 15:22, Garulfo wrote: > > Hi, > > I hope you're all doing well. > > Please, you will find a proposal to update the Manuals page on the wiki: > https://wiki.contextgarden.net/ManualsGallery > > 2 objectives: > 1/ to make something more visual, to help the user identify the different > documents, their organization, their date of release. > 2/ to gather all the updated documents in one place > > Sources were : > - http://www.pragma-ade.com/overview.htm > - https://wiki.contextgarden.net/Manuals, and wiki snippets here and there. > - https://github.com/hmenke/context-examples/blob/master/GUIDE.md > > Depending on your comments, and if there is an interest, I would be happy to > improve it (correct errors, change document segmentation, better colors > choice, additional data such as authors, number of pages). > > It's mainly built from cvs table + script. > > Finally, if you approve this update, I can arrange to clean up some pages of > the wiki about the manuals. > > > Best, > Very helpful addition. G > > > > > > > ___ > If your question is of interest to others as well, please add an entry to the > Wiki! > > maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context > webpage : http://www.pragma-ade.nl / http://context.aanhet.net > archive : https://bitbucket.org/phg/context-mirror/commits/ > wiki : http://contextgarden.net > ___ ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] ntg-context Digest, Vol 191, Issue 66
> Message: 5
> Date: Wed, 20 May 2020 15:38:23 -0400 (EDT)
> From: Aditya Mahajan mailto:adit...@umich.edu>>
> Subject: Re: [NTG-context] metapost boxes error
>
> On Wed, 20 May 2020, jk...@inradius.net <mailto:jk...@inradius.net> wrote:
>
>> Is there a different approach to use boxes.mp?
>>
>> MNWE:
>>
>> \startMPpage
>> input boxes.mp;
>> boxit.bl("left");
>> boxit.br <http://boxit.br/>("right");
>> br.sw - bl.ne = (20,0);
>> drawboxed(bl,br);
>> \stopMPpage
>
> Move `input boxes` outside the `\startMPpage`.
>
>
> \startMPdefinitions
> input boxes.mp;
> \stopMPdefinitions
>
> \starttext
> \startMPpage
> boxit.bl("left");
> boxit.br <http://boxit.br/>("right");
> br.sw - bl.ne = (20,0);
> drawboxed(bl,br);
> \stopMPpage
> \stoptext
>
>
> Aditya
>
Of all things. Thanks Aditya!
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Proposal to update the "Manuals" wiki page
Hello Garulfo, thanks for the great work! Two suggestions: 1. Obsolete manuals: Could their pictures be scratched somehow? One will see on the first sight that he is to investigate "no-more-valid" stuff. 2. Could you add a "download all manuals" hlink/button next to each (sub)title to download appropriate manuals as .zip, so to get: " Up-to-date Documentation (title) [download-all-up-to-date-manuals-in-this-section-inc-subsections (hlink)] ... Graphics and Colors (subtitle) [download-all-graphics-and-colors-manuals-inc-subsections (hlink)] ... " - IMHO it would be good for offline users (and for those who prefer printed form). Best regards, Lukas On 2020-05-19 15:22, Garulfo wrote: Hi, I hope you're all doing well. Please, you will find a proposal to update the Manuals page on the wiki: https://wiki.contextgarden.net/ManualsGallery 2 objectives: 1/ to make something more visual, to help the user identify the different documents, their organization, their date of release. 2/ to gather all the updated documents in one place Sources were : - http://www.pragma-ade.com/overview.htm - https://wiki.contextgarden.net/Manuals, and wiki snippets here and there. - https://github.com/hmenke/context-examples/blob/master/GUIDE.md Depending on your comments, and if there is an interest, I would be happy to improve it (correct errors, change document segmentation, better colors choice, additional data such as authors, number of pages). It's mainly built from cvs table + script. Finally, if you approve this update, I can arrange to clean up some pages of the wiki about the manuals. Best, ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___ ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Proposal to update the "Manuals" wiki page
Am 19.05.2020 um 15:22 schrieb Garulfo: Hi, I hope you're all doing well. Please, you will find a proposal to update the Manuals page on the wiki: https://wiki.contextgarden.net/ManualsGallery 2 objectives: 1/ to make something more visual, to help the user identify the different documents, their organization, their date of release. 2/ to gather all the updated documents in one place Sources were : - http://www.pragma-ade.com/overview.htm - https://wiki.contextgarden.net/Manuals, and wiki snippets here and there. - https://github.com/hmenke/context-examples/blob/master/GUIDE.md Depending on your comments, and if there is an interest, I would be happy to improve it (correct errors, change document segmentation, better colors choice, additional data such as authors, number of pages). It's mainly built from cvs table + script. Finally, if you approve this update, I can arrange to clean up some pages of the wiki about the manuals. Best, Thanks! That's very helpful. Best, Denis ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Proposal to update the "Manuals" wiki page
On 5/19/2020 3:22 PM, Garulfo wrote: Hi, I hope you're all doing well. Please, you will find a proposal to update the Manuals page on the wiki: https://wiki.contextgarden.net/ManualsGallery 2 objectives: 1/ to make something more visual, to help the user identify the different documents, their organization, their date of release. 2/ to gather all the updated documents in one place Sources were : - http://www.pragma-ade.com/overview.htm - https://wiki.contextgarden.net/Manuals, and wiki snippets here and there. - https://github.com/hmenke/context-examples/blob/master/GUIDE.md Depending on your comments, and if there is an interest, I would be happy to improve it (correct errors, change document segmentation, better colors choice, additional data such as authors, number of pages). It's mainly built from cvs table + script. Finally, if you approve this update, I can arrange to clean up some pages of the wiki about the manuals. Nicely done. Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Proposal to update the "Manuals" wiki page
On Tue, May 19, 2020 at 03:22:47PM +0200, Garulfo wrote: > Hi, > > I hope you're all doing well. > > Please, you will find a proposal to update the Manuals page on the wiki: > https://wiki.contextgarden.net/ManualsGallery > > 2 objectives: > 1/ to make something more visual, to help the user identify the different > documents, their organization, their date of release. > 2/ to gather all the updated documents in one place > > Sources were : > - http://www.pragma-ade.com/overview.htm > - https://wiki.contextgarden.net/Manuals, and wiki snippets here and there. > - https://github.com/hmenke/context-examples/blob/master/GUIDE.md > > Depending on your comments, and if there is an interest, I would be happy to > improve it (correct errors, change document segmentation, better colors > choice, additional data such as authors, number of pages). > > It's mainly built from cvs table + script. > > Finally, if you approve this update, I can arrange to clean up some pages of > the wiki about the manuals. > > > Best, > Hi Garulfo, thank you very much for your excellent work! It will be of great help. Best wishes, Rudolf ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] LMTX not working in Windows 10
On 5/19/2020 6:46 PM, Rik Kabel wrote: On 5/19/2020 12:12, Pablo Rodriguez wrote: On 5/19/20 5:55 PM, Wolfgang Schuster wrote: Pablo Rodriguez schrieb am 19.05.2020 um 16:42: [...] I’m getting exactly the same error on Windows (x64). Where could we get the latest binary? You can download the binary from the following link but only the 32bit version for Windows is up-to-date. http://dl.contextgarden.net/build/luametatex/ Wolfgang, many thanks for the information. Pablo -- http://www.ousia.tk ___ Hallelulah! I now have a working LMTX again. The version at http://dl.contextgarden.net/build/luametatex/x86_64-w64-mingw32/luametatex.exe, when put into place, did the job. Normally the installer should have the right one, not sure why that failed as I make those bins here. Anyway, there is some new low level stuff so hopefully nothing gets broken. And some more coming, even more fundamental (and so tricky that first wolfgang need to check that). Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] LMTX not working in Windows 10
On 5/19/2020 12:12, Pablo Rodriguez wrote: On 5/19/20 5:55 PM, Wolfgang Schuster wrote: Pablo Rodriguez schrieb am 19.05.2020 um 16:42: [...] I’m getting exactly the same error on Windows (x64). Where could we get the latest binary? You can download the binary from the following link but only the 32bit version for Windows is up-to-date. http://dl.contextgarden.net/build/luametatex/ Wolfgang, many thanks for the information. Pablo -- http://www.ousia.tk ___ Hallelulah! I now have a working LMTX again. The version at http://dl.contextgarden.net/build/luametatex/x86_64-w64-mingw32/luametatex.exe, when put into place, did the job. -- Rik ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] LMTX not working in Windows 10
On 5/19/20 5:55 PM, Wolfgang Schuster wrote: > Pablo Rodriguez schrieb am 19.05.2020 um 16:42: >> [...] >> I’m getting exactly the same error on Windows (x64). >> >> Where could we get the latest binary? > > You can download the binary from the following link but only the 32bit > version for Windows is up-to-date. > > http://dl.contextgarden.net/build/luametatex/ Wolfgang, many thanks for the information. Pablo -- http://www.ousia.tk ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] LMTX not working in Windows 10
Pablo Rodriguez schrieb am 19.05.2020 um 16:42: On 5/19/20 8:57 AM, Hans Hagen wrote: On 5/19/2020 1:41 AM, Jairo A. del Rio wrote: Hi everyone! I've tried installing LMTX on Windows 10 (x64) (I use Ubuntu, but my PC isn't available now). Whatever. When I try to execute context.exe the following appears: ! Parameters must be numbered consecutively. 0 l.214 \def\gobbleoneargument #0 then your binary is not updated and in sync with the rest of the tex code Hans, I’m getting exactly the same error on Windows (x64). Where could we get the latest binary? You can download the binary from the following link but only the 32bit version for Windows is up-to-date. http://dl.contextgarden.net/build/luametatex/ Wolfgang ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
[NTG-context] Proposal to update the "Manuals" wiki page
Hi, I hope you're all doing well. Please, you will find a proposal to update the Manuals page on the wiki: https://wiki.contextgarden.net/ManualsGallery 2 objectives: 1/ to make something more visual, to help the user identify the different documents, their organization, their date of release. 2/ to gather all the updated documents in one place Sources were : - http://www.pragma-ade.com/overview.htm - https://wiki.contextgarden.net/Manuals, and wiki snippets here and there. - https://github.com/hmenke/context-examples/blob/master/GUIDE.md Depending on your comments, and if there is an interest, I would be happy to improve it (correct errors, change document segmentation, better colors choice, additional data such as authors, number of pages). It's mainly built from cvs table + script. Finally, if you approve this update, I can arrange to clean up some pages of the wiki about the manuals. Best, ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
[NTG-context] ConTeXt doesn't recognize source on network drive?
Hello,
after I've updated ConTeXt to the latest version, a new problem appeared
- see the steps:
(Note that "X:" is a network drive mapped as "\\192.168.112.xxx\px" - if
it was of importance.)
X:\Users\MMi\Akce\Stechovice-I-etapa.RDS\Projekt.RDS\P.Prac\SO_251\TZ>set
path=d:\Ctx-Beta\tex\texmf-mswin\bin;%PATH%
X:\Users\MMi\Akce\Stechovice-I-etapa.RDS\Projekt.RDS\P.Prac\SO_251\TZ>findfile
context.exe
d:\Ctx-Beta\tex\texmf-mswin\bin\context.exe
X:\Users\MMi\Akce\Stechovice-I-etapa.RDS\Projekt.RDS\P.Prac\SO_251\TZ>context.exe
x:\Users\MMi\Akce\Stechovice-I-etapa.RDS\Projekt.RDS\P.Prac\SO_251\TZ\14-001-TZ.mkiv
resolvers | formats | executing runner 'run luatex format':
d:/Ctx-Beta/tex/texmf-mswin/bin/luatex --jobname="14-001-TZ"
--fmt=d:/Ctx-Beta/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/format
-c:texmfbinpath="d:/Ctx-Beta/tex/texmf-mswin/bin"
This is LuaTeX, Version 1.13.0 (TeX Live 2020/W32TeX)
system commands enabled.
open source > level 1, order 1, name
'd:/Ctx-Beta/tex/texmf-context/tex/context/base/mkiv/cont-yes.mkiv'
system >
system > ConTeXt ver: 2020.05.08 20:46 MKIV beta fmt:
2020.5.11 int: english/english
system >
system > 'cont-new.mkiv' loaded
open source > level 2, order 2, name
'd:/Ctx-Beta/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv'
system > beware: some patches loaded from cont-new.mkiv
close source> level 2, order 2, name
'd:/Ctx-Beta/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv'
system > files > jobname '14-001-TZ', input
'x:\\Users\\MMi\\Akce\\Stechovice-I-etapa.RDS\\Projekt.RDS\\P.Prac\\SO_251\\TZ\\14-001-TZ.mkiv',
result '14-001-TZ'
fonts > latin modern fonts are not preloaded
languages > language 'en' is active
tex error > tex error on line 8 in file
d:/Ctx-Beta/tex/texmf-context/tex/context/base/mkiv/cont-yes.mkiv: ! I
can't find file
`x://Users/MMi/Akce/Stechovice-I-etapa.RDS/Projekt.RDS/P.Prac/SO_251/TZ/14-001-TZ.mkiv'.
l.8 }
l.97 \getvalue{clf_processjob}
% from cont-run.lua
1 %D \module
2 %D [ file=cont-yes,
3 %Dversion=2012.06.01,
4 %D title=\CONTEXT\ Miscellaneous Macros,
5 %D subtitle=Startup Stub,
6 %D author=Hans Hagen,
7 %D date=\currentdate,
8 >> %D copyright={PRAGMA ADE \& \CONTEXT\ Development Team}]
9 %C
10 %C This module is part of the \CONTEXT\ macro||package and is
11 %C therefore copyrighted by \PRAGMA. See mreadme.pdf for
12 %C details.
13
14 % At some point I will reconsider the \starttext .. \stoptext
15 % wraping as we can assume proper styling. It's a left-over from
16 % mkii that we need to get rid of.
17
18 % now moved to cont-run.lua
mtx-context | fatal error: return code: 1
So:
1. "ConTeXt ver: 2020.05.08 20:46 MKIV beta fmt: 2020.5.11" should be
the newest, OK.
2. The new probles seems to be: "I can't find file `x://Users...
^^-- Why
this replacement of "\"?
Best regards,
Lukas
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Retrieving original value of enviroment variable HOME
Hello, Hans,
I've just renewed the Ctx Beta installation, but 'environment.oldhome'
seems be unavailable.
Was I "too quick" with renewing Ctx?
Testing sample:
\starttext
Ahoj
\startluacode
context(environment.oldhome or "??")
\stopluacode
\stoptext
- prints "??".
I also attache the "status-of-update.lua" and the batch
"first-setup.bat" (maybe a bit obsolete, but working so far) I used to
renew Ctx.
Also result of "dir /s" is available here (~84 k packed):
http://leteckaposta.cz/302654804
What am I doing wrong?
Best regards,
Lukas
On 2020-05-08 14:18, Hans Hagen wrote:
You can check it. Btw, when you're using lmtx there should be no real
differences between for instance unix and windows, although on windows
lmtx does support wide characters in environment variables, command
line arguments, filenames, filelinks etc. (not that that matters much
as one will seldom use more than ascii). Specific environment
variables like HOME are a bit tricky on windows as they come in
variants, so let me know if some more magic is needed.
Hans
\starttext
Ahoj
\startluacode
context(environment.oldhome or "??")
\stopluacode
\stoptext
ChkEnv.pdf
Description: Adobe PDF document
-- generator : luat-sta.lua
-- state tag : whatever
return {
["context"]={
["version"]="beta",
},
["engines"]={
["luatex"]=true,
["pdftex"]=true,
["xetex"]=true,
},
["formats"]={
["cont-en"]=true,
["cont-nl"]=true,
["metafun"]=true,
},
["info"]={
["comment"]="this file contains the settings of the last 'mtxrun --script
update' run",
["count"]=138,
["date"]="2020-05-10 11:59:36",
["runtime"]=94.039,
["version"]=0.1,
},
["modules"]={
["all"]=true,
},
["paths"]={
["root"]="d:\\Ctx-Beta\\tex",
},
["platforms"]={
["mswin"]=true,
["win64"]=true,
},
["repositories"]={
["current"]=true,
},
["rsync"]={
["flags"]={
["delete"]="--delete",
["normal"]="-rpztlv",
},
["module"]="minimals",
["program"]="rsync",
["server"]="contextgarden.net::",
},
}@echo off
setlocal
echo okay > ok.log
ruby -e "File.delete('ok.log')"
if not exist "ok.log" goto okay
echo.
echo You need to install Ruby first (if you want to use pdfTeX or XeTeX).
echo Fetching files anyway.
echo.
:okay
set OWNPATH=%~dp0
set CONTEXTROOT=%OWNPATH%tex
set PATH=%OWNPATH%bin;%CONTEXTROOT%\texmf-mswin\bin;%PATH%
set CYGWIN=nontsec
rsync -av --exclude 'rsync.exe' --exclude 'cygwin1.dll' --exclude 'cygiconv-2.dll' rsync://contextgarden.net/minimals/setup/mswin/bin/ bin
mtxrun --script ./bin/mtx-update.lua --force --update --make --engine=all --context=beta --texroot=%CONTEXTROOT% %*
echo.
echo When you want to use context, you need to initialize the tree with:
echo.
echo %CONTEXTROOT%\setuptex.bat %CONTEXTROOT%
echo.
echo You can associate this command with a shortcut to the cmd prompt.
echo.
if not exist "ok.log" goto end
echo.
echo If you want to use pdfTeX or XeTeX you need to install Ruby first.
echo Remake formats or rerun this script afterwards.
echo.
del /q ok.log
:end
endlocal
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] error during the installation of luametatex
On 5/9/2020 12:26, Giulio Bertellini wrote: * * *about LuaMetaTeX, Version 2.06.02* On Mac OS Catalina 10.15.4 . Hope this may convey some useful information. On Mac OS Catalina 10.15.4 ( Mac mini late 2012, I5, 16GB RAM), using the current LMTX version just downloaded from Pragma Ade, I installed Context LMTX and tested the download by compiling the Metafun manual sources as indicated below: >>>> sh-3.2# context metafun resolvers | formats | executing runner 'run luametatex format': /System/Volumes/Data/opt/data/context/tex/texmf-osx-64/bin/luametatex --jobname="metafun" --fmt=/System/Volumes/Data/opt/data/context/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.fmt --lua=/System/Volumes/Data/opt/data/context/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.lui cont-yes.mkiv --c:currentrun=1 --c:fulljobname="./metafun" --c:input="./metafun" --c:kindofrun=1 --c:maxnofruns=9 --c:texmfbinpath="/System/Volumes/Data/opt/data/context/tex/texmf-osx-64/bin" This is LuaMetaTeX, Version 2.06.02 open source > level 1, order 1, name 'cont-yes.mkiv' system> system> ConTeXtver: 2020.05.09 15:37 MKIV betafmt: 2020.5.9int: english/english system> system> 'cont-new.mkiv' loaded open source > level 2, order 2, name '/System/Volumes/Data/opt/data/context/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv' system> beware: some patches loaded from cont-new.mkiv close source> level 2, order 2, name '/System/Volumes/Data/opt/data/context/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv' system> files > jobname 'metafun', input './metafun', result 'metafun' * * *Final result of this compilation:* mkiv lua stats> used engine: luametatex version: 2.0602, functionality level: 20200508, format id: 498, compiler: clang mkiv lua stats> control sequences: 51925 of 65536 + 10 mkiv lua stats> lua properties: engine: lua 5.4, used memory: 179 MB, ctx: 166 MB, max: 168 MB, hash chars: min(64,40), symbol mask: utf (τεχ) mkiv lua stats> runtime: 20.702 seconds, 392 processed pages, 392 shipped pages, 18.936 pages/second system| total runtime: 113.221 seconds of 113.291 seconds Please consider that this mac mini is quite old and I am running mac OS Catalina on an external SSD. This was the first installation on Mac of Context today. I am quite happy with the results. I wish to express my appreciation for the outstanding work that Hans and the entire Context contributors team have carried out with focus and perseverance through the years. Hello to Otared and Luigi with whom I was in contact many years ago at the time of MKII . I also installed the same LMTX Context release on the Linux Subsystem for Microsoft Windows 10 and on different versions of Arch Linux. with the same excellent results. Thanks again for the excellent work, Giulio Giulio Bertellini On Sat, May 9, 2020 at 4:41 PM Rik Kabel <mailto:cont...@rik.users.panix.com>> wrote: On 5/9/2020 09:33, Hans Hagen wrote: On 5/9/2020 3:27 PM, Rik Kabel wrote: On 5/9/2020 02:52, Hans Hagen wrote: looks like a wrong binary .. should be 2.06.02 .. can you try this binary: http://dl.contextgarden.net/build/luametatex/x86_64-darwin/ (the farm generates two binaries for osx and it looks like the legacy machine has gone off line which happens when osx updates itself and gets stuck half way, i'll look into it) Hans I have the following update log entries (left column is EDT), indicating a roll-back of the binary: 2020-05-07T10:59:03 ConTeXt updated from 2020.04.30T11:15 to 2020.05.07T11:03 2020-05-07T10:59:03 LuaMetaTeX updated from 2.05.01 to 2.06.01 2020-05-07T10:59:03 LuaMetaTeX functionality updated from 20200402 to 20200506 2020-05-07T10:59:03 2020-05-08T15:14:26 ConTeXt updated from 2020.05.07T11:03 to 2020.05.08T20:50 2020-05-08T15:14:26 LuaMetaTeX downdated from 2.06.01 to 2.05.01 2020-05-08T15:14:26 LuaMetaTeX functionality downdated from 20200506 to 20200402 2020-05-08T15:14:26 2020-05-09T09:19:39 ConTeXt updated from 2020.05.08T20:50 to 2020.05.09T08:55 2020-05-09T09:19:39 LuaMetaTeX unchanged at 2.05.01 2020-05-09T09:19:39 LuaMetaTeX functionality unchanged at 20200402 2020-05-09T09:19:39 Perhaps there is an problem with the installation files? no, i uploaded a new lmtx only (not sure why the date is old then) what version does the binary report? It reports what the log says. My update program simply scrapes the version report. The version report in full is: This is LuaMetaTeX, Version 2.05.01 Execute 'luametatex --credits' for credits
Re: [NTG-context] error during the installation of luametatex
*about LuaMetaTeX, Version 2.06.02* On Mac OS Catalina 10.15.4 . Hope this may convey some useful information. On Mac OS Catalina 10.15.4 ( Mac mini late 2012, I5, 16GB RAM), using the current LMTX version just downloaded from Pragma Ade, I installed Context LMTX and tested the download by compiling the Metafun manual sources as indicated below: >>>> sh-3.2# context metafun resolvers | formats | executing runner 'run luametatex format': /System/Volumes/Data/opt/data/context/tex/texmf-osx-64/bin/luametatex --jobname="metafun" --fmt=/System/Volumes/Data/opt/data/context/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.fmt --lua=/System/Volumes/Data/opt/data/context/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.lui cont-yes.mkiv --c:currentrun=1 --c:fulljobname="./metafun" --c:input="./metafun" --c:kindofrun=1 --c:maxnofruns=9 --c:texmfbinpath="/System/Volumes/Data/opt/data/context/tex/texmf-osx-64/bin" This is LuaMetaTeX, Version 2.06.02 open source > level 1, order 1, name 'cont-yes.mkiv' system > system > ConTeXt ver: 2020.05.09 15:37 MKIV beta fmt: 2020.5.9 int: english/english system > system > 'cont-new.mkiv' loaded open source > level 2, order 2, name '/System/Volumes/Data/opt/data/context/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv' system > beware: some patches loaded from cont-new.mkiv close source> level 2, order 2, name '/System/Volumes/Data/opt/data/context/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv' system > files > jobname 'metafun', input './metafun', result 'metafun' *Final result of this compilation:* mkiv lua stats > used engine: luametatex version: 2.0602, functionality level: 20200508, format id: 498, compiler: clang mkiv lua stats > control sequences: 51925 of 65536 + 10 mkiv lua stats > lua properties: engine: lua 5.4, used memory: 179 MB, ctx: 166 MB, max: 168 MB, hash chars: min(64,40), symbol mask: utf (τεχ) mkiv lua stats > runtime: 20.702 seconds, 392 processed pages, 392 shipped pages, 18.936 pages/second system | total runtime: 113.221 seconds of 113.291 seconds Please consider that this mac mini is quite old and I am running mac OS Catalina on an external SSD. This was the first installation on Mac of Context today. I am quite happy with the results. I wish to express my appreciation for the outstanding work that Hans and the entire Context contributors team have carried out with focus and perseverance through the years. Hello to Otared and Luigi with whom I was in contact many years ago at the time of MKII . I also installed the same LMTX Context release on the Linux Subsystem for Microsoft Windows 10 and on different versions of Arch Linux. with the same excellent results. Thanks again for the excellent work, Giulio Giulio Bertellini On Sat, May 9, 2020 at 4:41 PM Rik Kabel wrote: > > On 5/9/2020 09:33, Hans Hagen wrote: > > On 5/9/2020 3:27 PM, Rik Kabel wrote: > > > On 5/9/2020 02:52, Hans Hagen wrote: > > looks like a wrong binary .. should be 2.06.02 .. can you try this binary: > > http://dl.contextgarden.net/build/luametatex/x86_64-darwin/ > > (the farm generates two binaries for osx and it looks like the legacy > machine has gone off line which happens when osx updates itself and gets > stuck half way, i'll look into it) > > Hans > > > I have the following update log entries (left column is EDT), indicating a > roll-back of the binary: > > 2020-05-07T10:59:03 ConTeXt updated from 2020.04.30T11:15 to > 2020.05.07T11:03 > 2020-05-07T10:59:03 LuaMetaTeX updated from 2.05.01 to 2.06.01 > 2020-05-07T10:59:03 LuaMetaTeX functionality updated from 20200402 > to 20200506 > 2020-05-07T10:59:03 > 2020-05-08T15:14:26 ConTeXt updated from 2020.05.07T11:03 to > 2020.05.08T20:50 > 2020-05-08T15:14:26 LuaMetaTeX downdated from 2.06.01 to 2.05.01 > 2020-05-08T15:14:26 LuaMetaTeX functionality downdated from > 20200506 to 20200402 > 2020-05-08T15:14:26 > 2020-05-09T09:19:39 ConTeXt updated from 2020.05.08T20:50 to > 2020.05.09T08:55 > 2020-05-09T09:19:39LuaMetaTeX unchanged at 2.05.01 > 2020-05-09T09:19:39LuaMetaTeX functionality unchanged at 20200402 > 2020-05-09T09:19:39 > > Perhaps there is an problem with the installation files? > > no, i uploaded a new lmtx only (not sure why the date is old then) > > > what version does the binary report? > > > It reports what the log says. My update program simply scrapes the version > report. The version report in full is: > > This is LuaMetaTeX, Version 2.05.0
Re: [NTG-context] error during the installation of luametatex
On 5/9/2020 09:33, Hans Hagen wrote: On 5/9/2020 3:27 PM, Rik Kabel wrote: On 5/9/2020 02:52, Hans Hagen wrote: looks like a wrong binary .. should be 2.06.02 .. can you try this binary: http://dl.contextgarden.net/build/luametatex/x86_64-darwin/ (the farm generates two binaries for osx and it looks like the legacy machine has gone off line which happens when osx updates itself and gets stuck half way, i'll look into it) Hans I have the following update log entries (left column is EDT), indicating a roll-back of the binary: 2020-05-07T10:59:03 ConTeXt updated from 2020.04.30T11:15 to 2020.05.07T11:03 2020-05-07T10:59:03 LuaMetaTeX updated from 2.05.01 to 2.06.01 2020-05-07T10:59:03 LuaMetaTeX functionality updated from 20200402 to 20200506 2020-05-07T10:59:03 2020-05-08T15:14:26 ConTeXt updated from 2020.05.07T11:03 to 2020.05.08T20:50 2020-05-08T15:14:26 LuaMetaTeX downdated from 2.06.01 to 2.05.01 2020-05-08T15:14:26 LuaMetaTeX functionality downdated from 20200506 to 20200402 2020-05-08T15:14:26 2020-05-09T09:19:39 ConTeXt updated from 2020.05.08T20:50 to 2020.05.09T08:55 2020-05-09T09:19:39 LuaMetaTeX unchanged at 2.05.01 2020-05-09T09:19:39 LuaMetaTeX functionality unchanged at 20200402 2020-05-09T09:19:39 Perhaps there is an problem with the installation files? no, i uploaded a new lmtx only (not sure why the date is old then) what version does the binary report? It reports what the log says. My update program simply scrapes the version report. The version report in full is: This is LuaMetaTeX, Version 2.05.01 Execute 'luametatex --credits' for credits and version details. There is NO warranty. Redistribution of this software is covered by the terms of the GNU General Public License, version 2 or (at your option) any later version. For more information about these matters, see the file named COPYING and the LuaTeX source. Functionality : level 20200402 Support : cont...@ntg.nl Copyright : The Lua(Meta)TeX Team(s) (2005-2020+) The LuaMetaTeX project is related to ConTeXt development. This macro package tightly integrates TeX and MetaPost in close cooperation with Lua. And the context version report is: mtx-context | ConTeXt Process Management 1.03 mtx-context | mtx-context | main context file: C:/LMTX/tex/texmf-context/tex/context/base/mkiv/context.mkiv mtx-context | current version: 2020.05.09 08:55 mtx-context | main context file: C:/LMTX/tex/texmf-context/tex/context/base/mkiv/context.mkxl mtx-context | current version: 2020.05.09 08:55 -- Rik ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] error during the installation of luametatex
On 5/9/2020 3:27 PM, Rik Kabel wrote: On 5/9/2020 02:52, Hans Hagen wrote: looks like a wrong binary .. should be 2.06.02 .. can you try this binary: http://dl.contextgarden.net/build/luametatex/x86_64-darwin/ (the farm generates two binaries for osx and it looks like the legacy machine has gone off line which happens when osx updates itself and gets stuck half way, i'll look into it) Hans I have the following update log entries (left column is EDT), indicating a roll-back of the binary: 2020-05-07T10:59:03 ConTeXt updated from 2020.04.30T11:15 to 2020.05.07T11:03 2020-05-07T10:59:03 LuaMetaTeX updated from 2.05.01 to 2.06.01 2020-05-07T10:59:03 LuaMetaTeX functionality updated from 20200402 to 20200506 2020-05-07T10:59:03 2020-05-08T15:14:26 ConTeXt updated from 2020.05.07T11:03 to 2020.05.08T20:50 2020-05-08T15:14:26 LuaMetaTeX downdated from 2.06.01 to 2.05.01 2020-05-08T15:14:26 LuaMetaTeX functionality downdated from 20200506 to 20200402 2020-05-08T15:14:26 2020-05-09T09:19:39 ConTeXt updated from 2020.05.08T20:50 to 2020.05.09T08:55 2020-05-09T09:19:39 LuaMetaTeX unchanged at 2.05.01 2020-05-09T09:19:39 LuaMetaTeX functionality unchanged at 20200402 2020-05-09T09:19:39 Perhaps there is an problem with the installation files? no, i uploaded a new lmtx only (not sure why the date is old then) what version does the binary report? - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Vertical lines in matrices
Dear Weber Mattias,
Please see page 10 of “mathalign.pdf” made by Aditya.
He showed the way of writing aligned math including matrices.
For example,
\startformula
\startmatrix[left={\left(\,},right={\,\right)}]
\NC 1 \NC 0 \NC 0 \NR
\NC 0 \NC 1 \NC 0 \NR
\NC 0 \NC 0 \NC 1 \NR
\stopmatrix
\stopformula
There are many other examples that you can use.
Best regards,
Dalyoung
> Message: 2
> Date: Sun, 3 May 2020 17:47:24 +
> From: "Weber, Matthias"
> To: mailing list for ConTeXt users
> Subject: [NTG-context] Vertical lines in matrices
> Message-ID:
> Content-Type: text/plain; charset="utf-8"
>
> Dear List,
>
> I am trying to get vertical (separating) lines into matrices, as is possible
> in tables:
>
> \starttext
> \startformula
> \left(
> \starttable[|c|c|c|]
> \NC 0 \NC 0\VL 0 \FR
> \NC 1 \NC 0\VL 1 \FR
> \stoptable
> \right)
> \stopformula
> \stoptext
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Vertical lines in matrices
Thanks Jeong,
I was aware of this. While there is no solution that adds vertical lines into
matrices, one can juxtapose two (or more) of them with
properly chosen delimiters, like so:
\definemathmatrix
[bvmatrix]
[left={\left(\,},right={\ \right\vert}]
\definemathmatrix
[rbmatrix]
[left={\left.\,},right={\,\right)}]
\starttext
\startformula
\startbvmatrix
\NC 0 \NC 0\NC 0 \NR
\NC 1 \NC 0\NC 1 \NR
\stopbvmatrix
\startrbmatrix
\NC 0 \NR
\NC 1 \NR
\stoprbmatrix
\stopformula
\stoptext
> On May 4, 2020, at 04:25, Jeong Dal wrote:
>
> Dear Weber Mattias,
>
> Please see page 10 of “mathalign.pdf” made by Aditya.
> He showed the way of writing aligned math including matrices.
> For example,
>
> \startformula
>
> \startmatrix[left={\left(\,},right={\,\right)}]
>
> \NC 1 \NC 0 \NC 0 \NR
> \NC 0 \NC 1 \NC 0 \NR
> \NC 0 \NC 0 \NC 1 \NR
>
> \stopmatrix
> \stopformula
> There are many other examples that you can use.
>
> Best regards,
> Dalyoung
>
>> Message: 2
>> Date: Sun, 3 May 2020 17:47:24 +
>> From: "Weber, Matthias"
>> To: mailing list for ConTeXt users
>> Subject: [NTG-context] Vertical lines in matrices
>> Message-ID:
>> Content-Type: text/plain; charset="utf-8"
>>
>> Dear List,
>>
>> I am trying to get vertical (separating) lines into matrices, as is possible
>> in tables:
>>
>> \starttext
>> \startformula
>> \left(
>> \starttable[|c|c|c|]
>> \NC 0 \NC 0\VL 0 \FR
>> \NC 1 \NC 0\VL 1 \FR
>> \stoptable
>> \right)
>> \stopformula
>> \stoptext
>>
>
>
> ___
> If your question is of interest to others as well, please add an entry to the
> Wiki!
>
> maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
> webpage : http://www.pragma-ade.nl / http://context.aanhet.net
> archive : https://bitbucket.org/phg/context-mirror/commits/
> wiki : http://contextgarden.net
> ___
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works
Although this specific issue might have been solved meanwhile by the helpful suggestions of Wolfang, Thomas and others, I would like to point out that I have recently also encountered an odd behaviour of the mtxrun fontloader in the standalone, in which not all typefaces are available/properly identified. (I’m sorry to hijack this thread if this is unrelated.) Basically, when I load “Helvetica Neue”, I get instead of “regular/normal” always “light/italic”. I have switched to heros for the meantime, but potentially there is some bug behind this. (My documents with the version from Dec/Jan worked fine.) I recite my example from Wed: ConTeXt ver: 2020.01.30 14:13 MKIV beta fmt: 2020.4.22 (LuaTeX 1.11.1) and I’m running now into troubles with system font indexing: mtxrun --script fonts --reload locates fonts in macOS directories appropriately (*.afm fonts placed in .../tex/texmf-fonts are not found, but at the moment I don’t care too much), however it resolves only to a single font variant for *.ttc instead of all variants: mtxrun --script fonts --list --all --pattern=helvetica helvetica helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 helveticalightoblique helvetica helveticalightoblique /System/Library/Fonts/Helvetica.ttc 6 helveticaneuedeskinterfaceheavy helveticaneuedeskinterface helveticaneuedeskinterfaceheavy /System/Library/Fonts/HelveticaNeueDeskInterface.ttc 10 helveticaneuethinitalic helveticaneue helveticaneuethinitalic /System/Library/Fonts/HelveticaNeue.ttc 14 As a consequence, when I run \definefontfamily[mainface][ss][Helvetica Neue] \setupbodyfont[mainface, 12pt, sans] I get the light oblique variant instead of the regular one. I have tried to fix this via a \definefontfamily[mainface][ss][Helvetica Neue][tf=style:normal] but apparently I understand too little about this setup altogether … Thanks already for any suggestions! > On 24 Apr 2020, at 08:53, ntg-context-requ...@ntg.nl wrote: > > Send ntg-context mailing list submissions to > ntg-context@ntg.nl > > To subscribe or unsubscribe via the World Wide Web, visit > https://mailman.ntg.nl/mailman/listinfo/ntg-context > or, via email, send a message with subject or body 'help' to > ntg-context-requ...@ntg.nl > > You can reach the person managing the list at > ntg-context-ow...@ntg.nl > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of ntg-context digest..." > Today's Topics: > > 1. Re: Basic font question (Optima, but no bold, no italics). > Standalone ConTeXt does not work. TeX Live 2019 works > (Wolfgang Schuster) > > From: Wolfgang Schuster > Subject: Re: [NTG-context] Basic font question (Optima, but no bold, no > italics). Standalone ConTeXt does not work. TeX Live 2019 works > Date: 24 April 2020 at 08:53:52 CEST > To: mailing list for ConTeXt users , Gerben Wierda > > > > Gerben Wierda schrieb am 24.04.2020 um 08:48: >> With Arial: >> >> \definefontfamily[mainface][rm][Arial] >> \setupbodyfont[mainface,10pt] >> >> >> >> with Optima: >> >> \definefontfamily[mainface][rm][Optima] >> \setupbodyfont[mainface,10pt] >> >> >> It doesn’t matter if the font statements are before or after \starttext >> >> Then I thought, let’s test some other things. I logged in as another user, >> and used ConTeXt from TeX Live 2019: >> >> >> It seems to be that on my system, the standalone installed ConTeXt does not >> work with Optima, but the TeX Live installed one does. > > Can you try this: > > \definefontfamily [mainface] [rm] [Optima] > [it=optimaitalic, >bf=optimabold, >bi=optimabolditalic] > > Wolfgang > > > > ___ > If your question is of interest to others as well, please add an entry to the > Wiki! > > maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context > webpage : http://www.pragma-ade.nl / http://tex.aanhet.net > archive : https://foundry.supelec.fr/projects/contextrev/ > wiki : http://contextgarden.net > ___ ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Basic font question (Optima, but no bold, no italics)
It's noticed that Optima is a Sans Serif font.
Maybe it conflicts with MacOS way to handle fonts.
Le ven. 24 avr. 2020 à 01:10, Vladimir Lomov a écrit :
> Hello,
> ** Gerben Wierda [2020-04-23 23:57:26 +0200]:
>
> >> On 23 Apr 2020, at 19:18, Henning Hraban Ramm wrote:
> >>
> >>>
> >>> Am 23.04.2020 um 16:42 schrieb Gerben Wierda :
> >>>
> >>>>
> >>>> On 23 Apr 2020, at 16:34, Henning Hraban Ramm wrote:
> >>>>
>
> [...]
>
> >>>> What do you get from
> >>>> mtxrun --script=fonts --list --all --pattern=Optima
> >>>
> >>> hermione:Export and Metapost gerben$ mtxrun --script fonts --list
> --all --pattern=optima
> >>> identifier familyname fontname filename
>subfont instances
> >>>
> >>> optimablackoptima optimaextrablack
> /System/Library/Fonts/Optima.ttc 5
> >>> optimabold optima optimabold
> /System/Library/Fonts/Optima.ttc 2
> >>> optimabolditalic optima optimabolditalic
> /System/Library/Fonts/Optima.ttc 4
> >>> optimaextrablack optima optimaextrablack
> /System/Library/Fonts/Optima.ttc 5
> >>> optimaitalic optima optimaitalic
> /System/Library/Fonts/Optima.ttc 3
> >>> optimanormal optima optimaregular
> /System/Library/Fonts/Optima.ttc 1
> >>> optimaregular optima optimaregular
> /System/Library/Fonts/Optima.ttc 1
> >>
> >> Hm. Here, ConTeXt only found subfont #5 until I rebuilt the font cache,
> then it looked like yours.
> >>
> >> And the minimal example (plus \starttext ... \stoptext) worked.
> >>
> >> (Latest ConTeXt on MacOS Mojave.)
>
> > No such luck for me. Any help welcome. I did remove the macOS font cache
> > with sudo atsutil databases -remove and I rebooted. I am running an up to
> > date macOS Mojave.
>
> I think Henning Hraban Ramm meant not OS font cache (but may be including
> it,
> I'm not a Mac OS user) but context font cache. Run
>
> $ mtxrun --script fonts --reload --force
>
> and try above '--list --all ...' command again and your example:
>
> > \starttext
> > \definefontfamily[mainface][rm][Optima]
> > \setupbodyfont[mainface,10pt]
>
> > {\bf Bold} and {\it Italic} and {\rm Regular} text.
> > \stoptext
>
> Hope this will resolve you issue.
>
> [...]
>
> ---
> WBR, Vladimir Lomov
>
> --
> Practically perfect people never permit sentiment to muddle their thinking.
> -- Mary Poppins
>
> ___
> If your question is of interest to others as well, please add an entry to
> the Wiki!
>
> maillist : ntg-context@ntg.nl /
> http://www.ntg.nl/mailman/listinfo/ntg-context
> webpage : http://www.pragma-ade.nl / http://context.aanhet.net
> archive : https://bitbucket.org/phg/context-mirror/commits/
> wiki : http://contextgarden.net
>
> ___
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Basic font question (Optima, but no bold, no italics)
Hello,
** Gerben Wierda [2020-04-23 23:57:26 +0200]:
>> On 23 Apr 2020, at 19:18, Henning Hraban Ramm wrote:
>>
>>>
>>> Am 23.04.2020 um 16:42 schrieb Gerben Wierda :
>>>
>>>>
>>>> On 23 Apr 2020, at 16:34, Henning Hraban Ramm wrote:
>>>>
[...]
>>>> What do you get from
>>>> mtxrun --script=fonts --list --all --pattern=Optima
>>>
>>> hermione:Export and Metapost gerben$ mtxrun --script fonts --list --all
>>> --pattern=optima
>>> identifier familyname fontname filename
>>> subfont instances
>>>
>>> optimablackoptima optimaextrablack
>>> /System/Library/Fonts/Optima.ttc 5
>>> optimabold optima optimabold
>>> /System/Library/Fonts/Optima.ttc 2
>>> optimabolditalic optima optimabolditalic
>>> /System/Library/Fonts/Optima.ttc 4
>>> optimaextrablack optima optimaextrablack
>>> /System/Library/Fonts/Optima.ttc 5
>>> optimaitalic optima optimaitalic
>>> /System/Library/Fonts/Optima.ttc 3
>>> optimanormal optima optimaregular
>>> /System/Library/Fonts/Optima.ttc 1
>>> optimaregular optima optimaregular
>>> /System/Library/Fonts/Optima.ttc 1
>>
>> Hm. Here, ConTeXt only found subfont #5 until I rebuilt the font cache, then
>> it looked like yours.
>>
>> And the minimal example (plus \starttext ... \stoptext) worked.
>>
>> (Latest ConTeXt on MacOS Mojave.)
> No such luck for me. Any help welcome. I did remove the macOS font cache
> with sudo atsutil databases -remove and I rebooted. I am running an up to
> date macOS Mojave.
I think Henning Hraban Ramm meant not OS font cache (but may be including it,
I'm not a Mac OS user) but context font cache. Run
$ mtxrun --script fonts --reload --force
and try above '--list --all ...' command again and your example:
> \starttext
> \definefontfamily[mainface][rm][Optima]
> \setupbodyfont[mainface,10pt]
> {\bf Bold} and {\it Italic} and {\rm Regular} text.
> \stoptext
Hope this will resolve you issue.
[...]
---
WBR, Vladimir Lomov
--
Practically perfect people never permit sentiment to muddle their thinking.
-- Mary Poppins
signature.asc
Description: PGP signature
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Basic font question (Optima, but no bold, no italics)
> On 23 Apr 2020, at 19:18, Henning Hraban Ramm wrote:
>
>>
>> Am 23.04.2020 um 16:42 schrieb Gerben Wierda :
>>
>>>
>>> On 23 Apr 2020, at 16:34, Henning Hraban Ramm wrote:
>>>
>>>>
>>>> Am 23.04.2020 um 16:22 schrieb Gerben Wierda :
>>>>
>>>>
>>>>
>>>>> On 23 Apr 2020, at 16:16, Vladimir Lomov wrote:
>>>>>
>>>>> Hello,
>>>>> ** Gerben Wierda [2020-04-23 16:00:34 +0200]:
>>>>>
>>>>>> On my Mac, I am trying:
>>>>>
>>>>>> \definefontfamily[mainface][rm][Optima]
>>>>>> \setupbodyfont[mainface,10pt]
>>>>>
>>>>>> {\bf Bold} and {\it Italic} and {\rm Regular} text.
>>>>>
>>>>> https://wiki.contextgarden.net/Font_Switching
>>>>>
>>>>>> What do I need to do to get actual bold and italics in my output?
>>>>>
>>>>> \bi == \bf\it
>>>>>
>>>>> Or by "actual bold" you mean something different?
>>>>
>>>> Yes, in my output everything is regular, there is no bold or italics text,
>>>> even when I use \bf or \it
>>>
>>> What do you get from
>>> mtxrun --script=fonts --list --all --pattern=Optima
>>
>> hermione:Export and Metapost gerben$ mtxrun --script fonts --list --all
>> --pattern=optima
>> identifier familyname fontname filename
>> subfont instances
>>
>> optimablackoptima optimaextrablack
>> /System/Library/Fonts/Optima.ttc 5
>> optimabold optima optimabold
>> /System/Library/Fonts/Optima.ttc 2
>> optimabolditalic optima optimabolditalic
>> /System/Library/Fonts/Optima.ttc 4
>> optimaextrablack optima optimaextrablack
>> /System/Library/Fonts/Optima.ttc 5
>> optimaitalic optima optimaitalic
>> /System/Library/Fonts/Optima.ttc 3
>> optimanormal optima optimaregular
>> /System/Library/Fonts/Optima.ttc 1
>> optimaregular optima optimaregular
>> /System/Library/Fonts/Optima.ttc 1
>
> Hm. Here, ConTeXt only found subfont #5 until I rebuilt the font cache, then
> it looked like yours.
>
> And the minimal example (plus \starttext ... \stoptext) worked.
>
> (Latest ConTeXt on MacOS Mojave.)
No such luck for me. Any help welcome. I did remove the macOS font cache with
sudo atsutil databases -remove and I rebooted. I am running an up to date macOS
Mojave.
\starttext
\definefontfamily[mainface][rm][Optima]
\setupbodyfont[mainface,10pt]
{\bf Bold} and {\it Italic} and {\rm Regular} text.
\stoptext
results in
Gerben Wierda
Chess and the Art of Enterprise Architecture <https://ea.rna.nl/the-book/>
Mastering ArchiMate <https://ea.rna.nl/the-book-edition-iii/>
Architecture for Real Enterprises
<https://www.infoworld.com/blog/architecture-for-real-enterprises/> at InfoWorld
On Slippery Ice <https://eapj.org/on-slippery-ice/> at EAPJ
Console:
$ context test.tex
resolvers | formats | executing runner 'run luametatex format':
/usr/local/context-osx-64/tex/texmf-osx-64/bin/luametatex --jobname="test"
--fmt=/usr/local/context-osx-64/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.fmt
--lua=/usr/local/context-osx-64/tex/texmf-cache/luatex-cache/context/5fe67e0bfe781ce0dde776fb1556f32e/formats/luametatex/cont-en.lui
cont-yes.mkiv --c:currentrun=1 --c:fulljobname="./test.tex"
--c:input="./test.tex" --c:kindofrun=1 --c:maxnofruns=9
--c:texmfbinpath="/usr/local/context-osx-64/tex/texmf-osx-64/bin"
This is LuaMetaTeX, Version 2.05.01
open source > level 1, order 1, name 'cont-yes.mkiv'
system >
system > ConTeXt ver: 2020.04.03 10:31 MKIV beta fmt: 2020.4.7 int:
english/english
system >
system > 'cont-new.mkiv' loaded
open source > level 2, order 2, name
'/usr/local/context-osx-64/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv'
system > beware: some patches loaded from cont-new.mkiv
close source> level 2, order 2, name
'/usr/local/context-osx-64/tex/texmf-context/tex/context/base/mkiv/cont-new.mkiv'
system > files > jobname 'test', input './test', result 'test'
fonts > latin modern fonts are not preloaded
languages > language 'en' is active
open source > level 2, order 3, name './test.tex'
fonts > preloading latin modern fonts (second s
Re: [NTG-context] Hyphentation/Linebreak after x characters
Hi Rik,
Thanks for the fast reply! Your example works indeed nicely. However, within
this solution my problem has shifted now (fully) towards breaking after the
same number of characters, which seems to work for your sample string, but not
for the sequences that I need to place.
What I would like to achieve is something like:
5’-GATTGCTTACTCCTGGTTGG
TCTTACATTCTGTCGCCTC
CTACTAGAGCCGGCATATT
CTAGAAGGGCCGCCTTCATGTGG
etc.
(There might be hyphens or not, this is not so much important to me.)
But what I get is currently:
5'-GATTGCTTACTCCTG-
GTTGGTCTTACATTCT-
GTCGCCTCCTACTA-
GAGCCGGCATATTCTA-
GAAGGGCCGCCTTCATGTGGC-
etc.
Which looks ragged with \tt. Certainly, this is because ConTeXt applies the
default hyphenation pattern. But I guess, there might be no “no language”
pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem to
make no difference towards the result.
This is the MWE based on your solution:
\define[2]\mycommandc{
\startxrow
\startxcell o#1 \stopxcell
\startxcell \tt\WORD{5'-#2} \stopxcell
\stopxrow
}
\definebreakpoint[mybreaks][][nright=100,nleft=100,type=1]
\setbreakpoints[mybreaks]
\starttext
\setupxtable[width=5cm]
\startxtable
\mycommandc{C}{GATTGCTTACTCCTGGTTGGTCTTACATTCTGTCGCCTCCTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGGCCTAGGGCACCATCGCGTACGAGGGCAATGAGTTTACCGCTGCGAAGTCTCTACGTCACGGCCAACCACAGTCCTGCTCCCAACGAAATTTAGACGCTGTCGTGAAACCTGAATTCGAGGATAAGCCGCGTCATGAAGAGTCTACTG}
\stopxtable
\stoptext
> On 23 Apr 2020, at 22:02, ntg-context-requ...@ntg.nl wrote:
>
> Send ntg-context mailing list submissions to
> ntg-context@ntg.nl
>
> To subscribe or unsubscribe via the World Wide Web, visit
> https://mailman.ntg.nl/mailman/listinfo/ntg-context
> or, via email, send a message with subject or body 'help' to
> ntg-context-requ...@ntg.nl
>
> You can reach the person managing the list at
> ntg-context-ow...@ntg.nl
>
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of ntg-context digest..."
> Today's Topics:
>
> 1. Re: Hyphentation/Linebreak after x characters inside \WORD?
> (Rik Kabel)
>
> From: Rik Kabel
> Subject: Re: [NTG-context] Hyphentation/Linebreak after x characters inside
> \WORD?
> Date: 23 April 2020 at 21:46:59 CEST
> To: ntg-context@ntg.nl, benjamin.buchmul...@gmail.com
>
>
>
>
> On 4/23/2020 15:01, Benjamin Buchmuller wrote:
>> Sorry, I have just realized that the problem might not be \WORD{} actually,
>> so this one hyphenates:
>>
>> \define[2]\mycommand{
>> \startxrow
>> \startxcell o#1 \stopxcell
>> \startxcell \tt\WORD #2 \stopxcell
>> \stopxrow
>> }
>>
>> Whereas these ones don’t:
>>
>>
>> \define[2]\mycommand{
>> \startxrow
>> \startxcell o#1 \stopxcell
>> \startxcell \tt\WORD #2-3' \stopxcell
>> \stopxrow
>> }
>>
>> \define[2]\mycommand{
>> \startxrow
>> \startxcell o#1 \stopxcell
>> \startxcell 5'-\tt\WORD #2 \stopxcell
>> \stopxrow
>> }
>>
>> Assuming that this has to do with the presence of “-“ which will be the
>> preferred breakpoint. So, I guess the questions boils down to how to define
>> the second argument of
>>
>> \definebreakpoint[mybreaks][][nright=12,nleft=12,type=1]
>>
>> in this case or how to “deactivate” the default \setbreakpoints[compound]?
>>
>>
>>
>>> On 23 Apr 2020, at 20:46, Benjamin Buchmuller
>>>
>>> wrote:
>>>
>>> Hi again,
>>>
>>> I am reading a CSV file into ConTeXt which contains long DNA sequences (>>
>>> 40 characters) to place in xtables. So far, this works fine. However, I
>>> need to uppercase the entries and need to \tt them. When I do this inside
>>> \WORD however, they don’t hyphenate any more.
>>>
>>> I’m using:
>>>
>>> \defineseparatedlist
>>> [mylist]
>>> [
>>> separator={,}, quotechar={"},
>>> command=\mycommand
>>> ]
>>>
>>> \define[2]\mycommand{
>>> \startxrow
>>> \startxcell o#1 \stopxcell
>>> \startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell
>>> \stopxrow
>>> }
>>>
>>> Since I don’t have access to each entry, I cant place hyphenation marks
>>> directly. Is there a way to tell ConTeXt to hyphenate after say, 12
>>> characters?
>>>
>>> Thanks for your help.
>>>
>>>
>>&
[NTG-context] Fwd: Adding optional enumeration text to framed enumeration header
Sorry, I resend my question because I forgot the subject
-- Forwarded message -
De: Jairo A. del Rio
Date: sáb., 18 de abr. de 2020 a la(s) 23:53
Subject:
To: mailing list for ConTeXt users
I've seen the following solution in Stack Exchange to add referenceable
enumeration labels to a framed enumeration environment:
https://tex.stackexchange.com/questions/438588/context-and-metafun-framed-enumeration-with-counter-as-part-of-overlay
It uses \wrappedcurrentconstruction. However, it only prints the counter
label and the counter name. What if I need the text enclosed by braces in
the frame header too? E. g. \starttheorem[thm1]{Residue theorem} so the
framed title includes "Residue theorem" also. Thank you in advance.
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Lmtx + pgfplots compilation error
Hi,
Sorry to restart the discussion, but I have updated my entire system and
the problem remains. I used the example of Aditya.
Thank you.
Fabrice
\usemodule[pgfplots]
\starttext
\starttikzpicture
\startaxis
\addplot {x};
\stopaxis
\stoptikzpicture
\stoptext
tex error > tex error on line 5 in file pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
}\advance\counter by1
lua error:
?
Le jeu. 9 avr. 2020 à 00:07, Aditya Mahajan a écrit :
> On Wed, 8 Apr 2020, Aditya Mahajan wrote:
>
> > Simpler example:
>
> Sorry, pasted the wrong thing:
>
> \usemodule[pgfplots]
>
> \starttext
> \starttikzpicture
>\startaxis
> \addplot {x};
>\stopaxis
> \stoptikzpicture
> \stoptext
>
> > Works with LMTX 2019.12.31 but fails with the most recent LMTX (same
> error as
> > below) using the same pgfplots module.
> >
> > Aditya
> >
> > On Wed, 8 Apr 2020, Fabrice Couvreur wrote:
> >
> >> Hi Henri,
> >> Sorry !
> >>
> >> \usemodule[pgfplots]
> >> \pgfplotsset{compat=newest}
> >> \starttext
> >> \starttikzpicture
> >> \startaxis
> >>[
> >> xlabel=$x$,
> >> ylabel={$f(x) = x^2 - x +4$}
> >>]
> >>\addplot {x^2 - x +4};
> >> \stopaxis
> >> \stoptikzpicture
> >> \stoptext
> >>
> >>
> >> tex error > tex error on line 5 in file
> pgfplotsbinary.data.code.tex:
> >> ! Undefined control sequence
> >>
> >> l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
> >> \endcsname{^0
> >>
> >>}\advance\counter by1
> >> lua error:
> >>
> >> ?
> >>
> >>
> >> Le mer. 8 avr. 2020 à 12:40, Henri Menke a
> écrit :
> >>
> >>> MINIMAL working example...
> >>>
> >>> Cheers, Henri
> >>>
> >>> On 08/04/20, 11:52, Fabrice Couvreur wrote:
> >>>> Hi Henri,
> >>>> This file works well with context but does not work with lmtx.
> >>>>
> >>>> \usemodule[pgfplots]
> >>>> \usemodule[pgfpltstable]
> >>>> \pgfplotsset{compat=newest}
> >>>> \starttext
> >>>> \starttikzpicture
> >>>> \startaxis[
> >>>> title={\bf Relevé de notes chronologique},
> >>>> ymajorgrids=true,
> >>>> grid style={cyan!30},
> >>>> ymin=0,
> >>>> ymax=22,
> >>>> xmin=0,
> >>>> xmax=14,
> >>>> x=1cm,
> >>>> y=0.3cm,
> >>>> axis x line =bottom,
> >>>> axis y line =left,
> >>>> axis on top=true,
> >>>> axis line style =very thick,
> >>>> tick align=outside,
> >>>> tickwidth=0.12cm,
> >>>> tick style=very thick,
> >>>> xtick={\empty},
> >>>> ytick={0,2,...,18,20},
> >>>> extra x ticks={2,5,7,9,11,13},
> >>>> extra x tick labels={octobre,novembre,janvier,mars,avril, juin},
> >>>> extra x tick style={tick label style={rotate=45}},
> >>>> extra tick style={tick style={draw=none}},
> >>>> xlabel={Date},ylabel={Note},
> >>>> xlabel={Date},ylabel={Effectif},
> >>>> every axis x label/.style={
> >>>> at={(ticklabel* cs:1.01)},
> >>>> anchor=west,
> >>>> },
> >>>> every axis y label/.style={
> >>>> at={(ticklabel* cs:1.01)},
> >>>> anchor=south,
> >>>> },
> >>>> samples=1000,
> >>>> >=stealth,
> >>>> ]
> >>>> \addplot [color=green,only marks] coordinates {
> >>>> (1,5)
> >>>> (2,7)
> >>>> (3,5)
> >>>> (4,10)
> >>>> (5,5)
> >>>> (6,8)
> >>>> (7,10)
> >>>> (8,8)
> >>>> (9,10)
> >>>> (10,14)
> >>>> (11,18)
> >>>> (12,14)
> >>>> (13,11)
> >>>> };
> >>>> \stopaxis
> >>>> \stoptikzpicture
> >>>> \stoptext
> >>>>
> >>>>
> >>>> open source > level 7, order 88, name
> 'pgfplotsbinary.
Re: [NTG-context] Lmtx + pgfplots compilation error
On Wed, 8 Apr 2020, Aditya Mahajan wrote:
Simpler example:
Sorry, pasted the wrong thing:
\usemodule[pgfplots]
\starttext
\starttikzpicture
\startaxis
\addplot {x};
\stopaxis
\stoptikzpicture
\stoptext
Works with LMTX 2019.12.31 but fails with the most recent LMTX (same error as
below) using the same pgfplots module.
Aditya
On Wed, 8 Apr 2020, Fabrice Couvreur wrote:
Hi Henri,
Sorry !
\usemodule[pgfplots]
\pgfplotsset{compat=newest}
\starttext
\starttikzpicture
\startaxis
[
xlabel=$x$,
ylabel={$f(x) = x^2 - x +4$}
]
\addplot {x^2 - x +4};
\stopaxis
\stoptikzpicture
\stoptext
tex error > tex error on line 5 in file pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
}\advance\counter by1
lua error:
?
Le mer. 8 avr. 2020 à 12:40, Henri Menke a écrit :
MINIMAL working example...
Cheers, Henri
On 08/04/20, 11:52, Fabrice Couvreur wrote:
Hi Henri,
This file works well with context but does not work with lmtx.
\usemodule[pgfplots]
\usemodule[pgfpltstable]
\pgfplotsset{compat=newest}
\starttext
\starttikzpicture
\startaxis[
title={\bf Relevé de notes chronologique},
ymajorgrids=true,
grid style={cyan!30},
ymin=0,
ymax=22,
xmin=0,
xmax=14,
x=1cm,
y=0.3cm,
axis x line =bottom,
axis y line =left,
axis on top=true,
axis line style =very thick,
tick align=outside,
tickwidth=0.12cm,
tick style=very thick,
xtick={\empty},
ytick={0,2,...,18,20},
extra x ticks={2,5,7,9,11,13},
extra x tick labels={octobre,novembre,janvier,mars,avril, juin},
extra x tick style={tick label style={rotate=45}},
extra tick style={tick style={draw=none}},
xlabel={Date},ylabel={Note},
xlabel={Date},ylabel={Effectif},
every axis x label/.style={
at={(ticklabel* cs:1.01)},
anchor=west,
},
every axis y label/.style={
at={(ticklabel* cs:1.01)},
anchor=south,
},
samples=1000,
>=stealth,
]
\addplot [color=green,only marks] coordinates {
(1,5)
(2,7)
(3,5)
(4,10)
(5,5)
(6,8)
(7,10)
(8,8)
(9,10)
(10,14)
(11,18)
(12,14)
(13,11)
};
\stopaxis
\stoptikzpicture
\stoptext
open source > level 7, order 88, name 'pgfplotsbinary.data.code.tex'
tex error > tex error on line 5 in file
pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
}\advance\counter by1
lua error:
?
The control sequence at the end of the top line of your error message was
never
\def'ed. You can just continue as I'll forget about whatever was
undefined.
mtx-context | fatal error: return code: 256
TeX Output exited abnormally with code 1 at Wed Apr 8 11:49:56
Le mer. 8 avr. 2020 à 11:21, Henri Menke a écrit
:
Hi Fabrice,
Could you provide a MWE, or maybe even open an issue on the bugtracker?
https://github.com/pgf-tikz/pgfplots/issues
Cheers, Henri
On 07/04/20, 14:22, Fabrice Couvreur wrote:
Hi Henri,
Thank you for answering me. We're entering an area that I don't
really
know. I
replaced all ^^ by ^ but I'm not sure I understood. I now have the
following message :
Thank you
Fabrice
tex error > tex error on line 5 in file
pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 \catcode`\^00=11 \expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
0}\advance\counter by1
lua error:
?
The control sequence at the end of the top line of your error
message was
never
\def'ed. You can just continue as I'll forget about whatever was
undefined.
mtx-context | fatal error: return code: 256
TeX Output exited abnormally with code 1 at Tue Apr 7 14:15:58
Le mar. 7 avr. 2020 à 04:21, Henri Menke a
écrit
:
The problem is that pgfplots uses the ^^ syntax to access
characters
but
this relies on ^ having catcode 7 which is not the case by default
in
ConTeXt. I had a similar issue in PGF before and that was fixed by
just
replacing the ^^ syntax with the ascii code constants from
syst-ini.mkxl.
Cheers, Henri
On 06/04/20, 22:23, Fabrice Couvreur wrote:
Hi,
Still with the idea of using lmtx, I get a compilation error
when I
use
pgfplots.
Thank you.
Fabrice
open source > level 9, order 92, name
'pgfplotsbinary.data.code.tex'
tex error > tex error on line 42 in file
pgfplotsbinary.data.code.tex: ! Undefined control sequence
l.42 \catcode`\ =11^^I\expandafter\xdef\csname pgfp@bin@
\the\counter^^I\endcsname{^^20}\endgroup\advance\counter by1
lua error:
?
The control sequence at the end of the top line of your error
message was
never
\def'ed. You can just continue as I'll forget about whatever was
undefined.
mtx-context | fatal error: return code: 256
TeX Output exited abnormally with code 1 a
Re: [NTG-context] Lmtx + pgfplots compilation error
Simpler example:
\usemodule[pgfplots]
\pgfplotsset{compat=newest}
\starttext
\starttikzpicture
\startaxis
[
xlabel=$x$,
ylabel={$f(x) = x^2 - x +4$}
]
\addplot {x^2 - x +4};
\stopaxis
\stoptikzpicture
\stoptext
Works with LMTX 2019.12.31 but fails with the most recent LMTX (same error
as below) using the same pgfplots module.
Aditya
On Wed, 8 Apr 2020, Fabrice Couvreur wrote:
Hi Henri,
Sorry !
\usemodule[pgfplots]
\pgfplotsset{compat=newest}
\starttext
\starttikzpicture
\startaxis
[
xlabel=$x$,
ylabel={$f(x) = x^2 - x +4$}
]
\addplot {x^2 - x +4};
\stopaxis
\stoptikzpicture
\stoptext
tex error > tex error on line 5 in file pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
}\advance\counter by1
lua error:
?
Le mer. 8 avr. 2020 à 12:40, Henri Menke a écrit :
MINIMAL working example...
Cheers, Henri
On 08/04/20, 11:52, Fabrice Couvreur wrote:
Hi Henri,
This file works well with context but does not work with lmtx.
\usemodule[pgfplots]
\usemodule[pgfpltstable]
\pgfplotsset{compat=newest}
\starttext
\starttikzpicture
\startaxis[
title={\bf Relevé de notes chronologique},
ymajorgrids=true,
grid style={cyan!30},
ymin=0,
ymax=22,
xmin=0,
xmax=14,
x=1cm,
y=0.3cm,
axis x line =bottom,
axis y line =left,
axis on top=true,
axis line style =very thick,
tick align=outside,
tickwidth=0.12cm,
tick style=very thick,
xtick={\empty},
ytick={0,2,...,18,20},
extra x ticks={2,5,7,9,11,13},
extra x tick labels={octobre,novembre,janvier,mars,avril, juin},
extra x tick style={tick label style={rotate=45}},
extra tick style={tick style={draw=none}},
xlabel={Date},ylabel={Note},
xlabel={Date},ylabel={Effectif},
every axis x label/.style={
at={(ticklabel* cs:1.01)},
anchor=west,
},
every axis y label/.style={
at={(ticklabel* cs:1.01)},
anchor=south,
},
samples=1000,
>=stealth,
]
\addplot [color=green,only marks] coordinates {
(1,5)
(2,7)
(3,5)
(4,10)
(5,5)
(6,8)
(7,10)
(8,8)
(9,10)
(10,14)
(11,18)
(12,14)
(13,11)
};
\stopaxis
\stoptikzpicture
\stoptext
open source > level 7, order 88, name 'pgfplotsbinary.data.code.tex'
tex error > tex error on line 5 in file
pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
}\advance\counter by1
lua error:
?
The control sequence at the end of the top line of your error message was
never
\def'ed. You can just continue as I'll forget about whatever was
undefined.
mtx-context | fatal error: return code: 256
TeX Output exited abnormally with code 1 at Wed Apr 8 11:49:56
Le mer. 8 avr. 2020 à 11:21, Henri Menke a écrit
:
Hi Fabrice,
Could you provide a MWE, or maybe even open an issue on the bugtracker?
https://github.com/pgf-tikz/pgfplots/issues
Cheers, Henri
On 07/04/20, 14:22, Fabrice Couvreur wrote:
Hi Henri,
Thank you for answering me. We're entering an area that I don't
really
know. I
replaced all ^^ by ^ but I'm not sure I understood. I now have the
following message :
Thank you
Fabrice
tex error > tex error on line 5 in file
pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 \catcode`\^00=11 \expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
0}\advance\counter by1
lua error:
?
The control sequence at the end of the top line of your error
message was
never
\def'ed. You can just continue as I'll forget about whatever was
undefined.
mtx-context | fatal error: return code: 256
TeX Output exited abnormally with code 1 at Tue Apr 7 14:15:58
Le mar. 7 avr. 2020 à 04:21, Henri Menke a
écrit
:
The problem is that pgfplots uses the ^^ syntax to access
characters
but
this relies on ^ having catcode 7 which is not the case by default
in
ConTeXt. I had a similar issue in PGF before and that was fixed by
just
replacing the ^^ syntax with the ascii code constants from
syst-ini.mkxl.
Cheers, Henri
On 06/04/20, 22:23, Fabrice Couvreur wrote:
Hi,
Still with the idea of using lmtx, I get a compilation error
when I
use
pgfplots.
Thank you.
Fabrice
open source > level 9, order 92, name
'pgfplotsbinary.data.code.tex'
tex error > tex error on line 42 in file
pgfplotsbinary.data.code.tex: ! Undefined control sequence
l.42 \catcode`\ =11^^I\expandafter\xdef\csname pgfp@bin@
\the\counter^^I\endcsname{^^20}\endgroup\advance\counter by1
lua error:
?
The control sequence at the end of the top line of your error
message was
never
\def'ed. You can just continue as I'll forget about whatever was
undefined.
mtx-context | fatal error: return code: 256
TeX Output exited abnormally with code 1 a
Re: [NTG-context] Lmtx + pgfplots compilation error
Hi Henri,
Sorry !
\usemodule[pgfplots]
\pgfplotsset{compat=newest}
\starttext
\starttikzpicture
\startaxis
[
xlabel=$x$,
ylabel={$f(x) = x^2 - x +4$}
]
\addplot {x^2 - x +4};
\stopaxis
\stoptikzpicture
\stoptext
tex error > tex error on line 5 in file pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
}\advance\counter by1
lua error:
?
Le mer. 8 avr. 2020 à 12:40, Henri Menke a écrit :
> MINIMAL working example...
>
> Cheers, Henri
>
> On 08/04/20, 11:52, Fabrice Couvreur wrote:
> > Hi Henri,
> > This file works well with context but does not work with lmtx.
> >
> > \usemodule[pgfplots]
> > \usemodule[pgfpltstable]
> > \pgfplotsset{compat=newest}
> > \starttext
> > \starttikzpicture
> > \startaxis[
> > title={\bf Relevé de notes chronologique},
> > ymajorgrids=true,
> > grid style={cyan!30},
> > ymin=0,
> > ymax=22,
> > xmin=0,
> > xmax=14,
> > x=1cm,
> > y=0.3cm,
> > axis x line =bottom,
> > axis y line =left,
> > axis on top=true,
> > axis line style =very thick,
> > tick align=outside,
> > tickwidth=0.12cm,
> > tick style=very thick,
> > xtick={\empty},
> > ytick={0,2,...,18,20},
> > extra x ticks={2,5,7,9,11,13},
> > extra x tick labels={octobre,novembre,janvier,mars,avril, juin},
> > extra x tick style={tick label style={rotate=45}},
> > extra tick style={tick style={draw=none}},
> > xlabel={Date},ylabel={Note},
> > xlabel={Date},ylabel={Effectif},
> > every axis x label/.style={
> > at={(ticklabel* cs:1.01)},
> > anchor=west,
> > },
> > every axis y label/.style={
> > at={(ticklabel* cs:1.01)},
> > anchor=south,
> > },
> > samples=1000,
> > >=stealth,
> > ]
> > \addplot [color=green,only marks] coordinates {
> > (1,5)
> > (2,7)
> > (3,5)
> > (4,10)
> > (5,5)
> > (6,8)
> > (7,10)
> > (8,8)
> > (9,10)
> > (10,14)
> > (11,18)
> > (12,14)
> > (13,11)
> > };
> > \stopaxis
> > \stoptikzpicture
> > \stoptext
> >
> >
> > open source > level 7, order 88, name 'pgfplotsbinary.data.code.tex'
> >
> > tex error > tex error on line 5 in file
> pgfplotsbinary.data.code.tex:
> > ! Undefined control sequence
> >
> > l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
> > \endcsname{^0
> >
> > }\advance\counter by1
> > lua error:
> >
> > ?
> >
> >
> >
> >
> >
> >
> > The control sequence at the end of the top line of your error message was
> > never
> > \def'ed. You can just continue as I'll forget about whatever was
> undefined.
> >
> >
> > mtx-context | fatal error: return code: 256
> >
> > TeX Output exited abnormally with code 1 at Wed Apr 8 11:49:56
> >
> >
> > Le mer. 8 avr. 2020 à 11:21, Henri Menke a écrit
> :
> >
> > > Hi Fabrice,
> > >
> > > Could you provide a MWE, or maybe even open an issue on the bugtracker?
> > > https://github.com/pgf-tikz/pgfplots/issues
> > >
> > > Cheers, Henri
> > >
> > > On 07/04/20, 14:22, Fabrice Couvreur wrote:
> > > > Hi Henri,
> > > > Thank you for answering me. We're entering an area that I don't
> really
> > > know. I
> > > > replaced all ^^ by ^ but I'm not sure I understood. I now have the
> > > > following message :
> > > > Thank you
> > > > Fabrice
> > > >
> > > > tex error > tex error on line 5 in file
> > > pgfplotsbinary.data.code.tex:
> > > > ! Undefined control sequence
> > > >
> > > > l.5 \catcode`\^00=11 \expandafter\xdef\csname pgfp@bin@\the\counter
> > > > \endcsname{^0
> > > >
> > > >0}\advance\counter by1
> > > > lua error:
> > > >
> > > > ?
> > > >
> > > >
> > > >
> > > >
> > > >
> > > >
> > > > The control sequence at the end of the top line of your error
> message was
> > > > never
> > > > \def'ed. You can just continue as I'll forget about whatever was
> > > undefined.
> > > >
> > > >
> > > > mtx-conte
Re: [NTG-context] Short weekday option for date command
Thank you Wolfgang!
Adam
On Wed, Apr 8, 2020 at 9:11 PM Wolfgang Schuster <
wolfgang.schuster.li...@gmail.com> wrote:
> Adam Reviczky schrieb am 08.04.2020 um 21:53:
> > Thank you Hans and Wolfgang,
> >
> > I have updated the wiki (https://wiki.contextgarden.net/Command/date)
> > with the new dayshort/daylong options, but I seem to get an empty value
> > for every day after day 7, see example:
> >
> > \starttext
> > \date[d=7,m=4,y=2008][{\dayshort\normalday},{,~},day,~,month,~,year] \par
> > \date[d=8,m=4,y=2008][{\dayshort\normalday},{,~},day,~,month,~,year]
> > \stoptext
> >
> > This gives me (note "sun" is missing in the second line):
> >
> > sat, 7 April 2008
> > , 8 April 2008
> >
> > Am I using the options correctly?
>
> No, the \daylong and \dayshort expect a number between 1 and 7 and
> result in a label for the requested day of the week but it's not meant
> to be used in \currentdate.
>
> > Still using luatex and not luametatex.
>
> To get the short names with \currentdate you have to append ":mnem" to
> the weekday, w, WEEKDAY or W keywords.
>
> \starttext
>
> \startlines
> \date[d=7,m=4,y=2008][weekday,{,~},day,~,month,~,year]
> \date[d=7,m=4,y=2008][weekday:mnem,{,~},day,~,month,~,year]
> \date[d=8,m=4,y=2008][weekday,{,~},day,~,month,~,year]
> \date[d=8,m=4,y=2008][weekday:mnem,{,~},day,~,month,~,year]
> \stoplines
>
> \stoptext
>
> Wolfgang
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Short weekday option for date command
Adam Reviczky schrieb am 08.04.2020 um 21:53:
Thank you Hans and Wolfgang,
I have updated the wiki (https://wiki.contextgarden.net/Command/date)
with the new dayshort/daylong options, but I seem to get an empty value
for every day after day 7, see example:
\starttext
\date[d=7,m=4,y=2008][{\dayshort\normalday},{,~},day,~,month,~,year] \par
\date[d=8,m=4,y=2008][{\dayshort\normalday},{,~},day,~,month,~,year]
\stoptext
This gives me (note "sun" is missing in the second line):
sat, 7 April 2008
, 8 April 2008
Am I using the options correctly?
No, the \daylong and \dayshort expect a number between 1 and 7 and
result in a label for the requested day of the week but it's not meant
to be used in \currentdate.
Still using luatex and not luametatex.
To get the short names with \currentdate you have to append ":mnem" to
the weekday, w, WEEKDAY or W keywords.
\starttext
\startlines
\date[d=7,m=4,y=2008][weekday,{,~},day,~,month,~,year]
\date[d=7,m=4,y=2008][weekday:mnem,{,~},day,~,month,~,year]
\date[d=8,m=4,y=2008][weekday,{,~},day,~,month,~,year]
\date[d=8,m=4,y=2008][weekday:mnem,{,~},day,~,month,~,year]
\stoplines
\stoptext
Wolfgang
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Short weekday option for date command
Thank you Hans and Wolfgang,
I have updated the wiki (https://wiki.contextgarden.net/Command/date) with
the new dayshort/daylong options, but I seem to get an empty value for
every day after day 7, see example:
\starttext
\date[d=7,m=4,y=2008][{\dayshort\normalday},{,~},day,~,month,~,year] \par
\date[d=8,m=4,y=2008][{\dayshort\normalday},{,~},day,~,month,~,year]
\stoptext
This gives me (note "sun" is missing in the second line):
sat, 7 April 2008
, 8 April 2008
Am I using the options correctly?
Still using luatex and not luametatex.
ConTeXt ver: 2020.04.08 14:34 MKIV beta fmt: 2020.4.8 int:
english/english
mtx-context | current version: 2020.04.08 14:34
This is LuaTeX, Version 1.13.0 (TeX Live 2020/Debian)
Compiled with libpng 1.6.37; using 1.6.37
Compiled with lua version 5.3.5
Compiled with mplib version 2.00
Compiled with zlib 1.2.11; using 1.2.11
Development id: 7330
Thanks,
Adam
On Sat, Apr 4, 2020 at 11:24 AM Hans Hagen wrote:
> On 4/4/2020 11:47 AM, Adam Reviczky wrote:
> > Hi,
> >
> > Is there a way to achieve a short weekday option with \date[] to get 3
> > letter equivalents (Mon, Tue, Wed, Thu, Fri, Sat, Sun) similar to the
> > monthshort either through context or lua?
> Not currently but I will add the basics (I have to double check with WS
> to see where if conflicts as such an extension involves additional
> commands it has to go into the setups too) but others have to add the
> abbreviations.
>
> Hans
>
> -
>Hans Hagen | PRAGMA ADE
>Ridderstraat 27 | 8061 GH Hasselt | The Netherlands
> tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl
> -
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Lmtx + pgfplots compilation error
MINIMAL working example...
Cheers, Henri
On 08/04/20, 11:52, Fabrice Couvreur wrote:
> Hi Henri,
> This file works well with context but does not work with lmtx.
>
> \usemodule[pgfplots]
> \usemodule[pgfpltstable]
> \pgfplotsset{compat=newest}
> \starttext
> \starttikzpicture
> \startaxis[
> title={\bf Relevé de notes chronologique},
> ymajorgrids=true,
> grid style={cyan!30},
> ymin=0,
> ymax=22,
> xmin=0,
> xmax=14,
> x=1cm,
> y=0.3cm,
> axis x line =bottom,
> axis y line =left,
> axis on top=true,
> axis line style =very thick,
> tick align=outside,
> tickwidth=0.12cm,
> tick style=very thick,
> xtick={\empty},
> ytick={0,2,...,18,20},
> extra x ticks={2,5,7,9,11,13},
> extra x tick labels={octobre,novembre,janvier,mars,avril, juin},
> extra x tick style={tick label style={rotate=45}},
> extra tick style={tick style={draw=none}},
> xlabel={Date},ylabel={Note},
> xlabel={Date},ylabel={Effectif},
> every axis x label/.style={
> at={(ticklabel* cs:1.01)},
> anchor=west,
> },
> every axis y label/.style={
> at={(ticklabel* cs:1.01)},
> anchor=south,
> },
> samples=1000,
> >=stealth,
> ]
> \addplot [color=green,only marks] coordinates {
> (1,5)
> (2,7)
> (3,5)
> (4,10)
> (5,5)
> (6,8)
> (7,10)
> (8,8)
> (9,10)
> (10,14)
> (11,18)
> (12,14)
> (13,11)
> };
> \stopaxis
> \stoptikzpicture
> \stoptext
>
>
> open source > level 7, order 88, name 'pgfplotsbinary.data.code.tex'
>
> tex error > tex error on line 5 in file pgfplotsbinary.data.code.tex:
> ! Undefined control sequence
>
> l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
> \endcsname{^0
>
> }\advance\counter by1
> lua error:
>
> ?
>
>
>
>
>
>
> The control sequence at the end of the top line of your error message was
> never
> \def'ed. You can just continue as I'll forget about whatever was undefined.
>
>
> mtx-context | fatal error: return code: 256
>
> TeX Output exited abnormally with code 1 at Wed Apr 8 11:49:56
>
>
> Le mer. 8 avr. 2020 à 11:21, Henri Menke a écrit :
>
> > Hi Fabrice,
> >
> > Could you provide a MWE, or maybe even open an issue on the bugtracker?
> > https://github.com/pgf-tikz/pgfplots/issues
> >
> > Cheers, Henri
> >
> > On 07/04/20, 14:22, Fabrice Couvreur wrote:
> > > Hi Henri,
> > > Thank you for answering me. We're entering an area that I don't really
> > know. I
> > > replaced all ^^ by ^ but I'm not sure I understood. I now have the
> > > following message :
> > > Thank you
> > > Fabrice
> > >
> > > tex error > tex error on line 5 in file
> > pgfplotsbinary.data.code.tex:
> > > ! Undefined control sequence
> > >
> > > l.5 \catcode`\^00=11 \expandafter\xdef\csname pgfp@bin@\the\counter
> > > \endcsname{^0
> > >
> > >0}\advance\counter by1
> > > lua error:
> > >
> > > ?
> > >
> > >
> > >
> > >
> > >
> > >
> > > The control sequence at the end of the top line of your error message was
> > > never
> > > \def'ed. You can just continue as I'll forget about whatever was
> > undefined.
> > >
> > >
> > > mtx-context | fatal error: return code: 256
> > >
> > > TeX Output exited abnormally with code 1 at Tue Apr 7 14:15:58
> > >
> > > Le mar. 7 avr. 2020 à 04:21, Henri Menke a écrit
> > :
> > >
> > > > The problem is that pgfplots uses the ^^ syntax to access characters
> > but
> > > > this relies on ^ having catcode 7 which is not the case by default in
> > > > ConTeXt. I had a similar issue in PGF before and that was fixed by
> > just
> > > > replacing the ^^ syntax with the ascii code constants from
> > > > syst-ini.mkxl.
> > > >
> > > > Cheers, Henri
> > > >
> > > > On 06/04/20, 22:23, Fabrice Couvreur wrote:
> > > > > Hi,
> > > > > Still with the idea of using lmtx, I get a compilation error when I
> > use
> > > > > pgfplots.
> > > > > Thank you.
> > > > > Fabrice
> > > > >
> > > > > open source > level 9, order 92, name
> > 'pgfplotsbinary.data.code.tex'
> > &
Re: [NTG-context] Lmtx + pgfplots compilation error
Hi Henri,
This file works well with context but does not work with lmtx.
\usemodule[pgfplots]
\usemodule[pgfpltstable]
\pgfplotsset{compat=newest}
\starttext
\starttikzpicture
\startaxis[
title={\bf Relevé de notes chronologique},
ymajorgrids=true,
grid style={cyan!30},
ymin=0,
ymax=22,
xmin=0,
xmax=14,
x=1cm,
y=0.3cm,
axis x line =bottom,
axis y line =left,
axis on top=true,
axis line style =very thick,
tick align=outside,
tickwidth=0.12cm,
tick style=very thick,
xtick={\empty},
ytick={0,2,...,18,20},
extra x ticks={2,5,7,9,11,13},
extra x tick labels={octobre,novembre,janvier,mars,avril, juin},
extra x tick style={tick label style={rotate=45}},
extra tick style={tick style={draw=none}},
xlabel={Date},ylabel={Note},
xlabel={Date},ylabel={Effectif},
every axis x label/.style={
at={(ticklabel* cs:1.01)},
anchor=west,
},
every axis y label/.style={
at={(ticklabel* cs:1.01)},
anchor=south,
},
samples=1000,
>=stealth,
]
\addplot [color=green,only marks] coordinates {
(1,5)
(2,7)
(3,5)
(4,10)
(5,5)
(6,8)
(7,10)
(8,8)
(9,10)
(10,14)
(11,18)
(12,14)
(13,11)
};
\stopaxis
\stoptikzpicture
\stoptext
open source > level 7, order 88, name 'pgfplotsbinary.data.code.tex'
tex error > tex error on line 5 in file pgfplotsbinary.data.code.tex:
! Undefined control sequence
l.5 ...ode`\^0=11\expandafter\xdef\csname pgfp@bin@\the\counter
\endcsname{^0
}\advance\counter by1
lua error:
?
The control sequence at the end of the top line of your error message was
never
\def'ed. You can just continue as I'll forget about whatever was undefined.
mtx-context | fatal error: return code: 256
TeX Output exited abnormally with code 1 at Wed Apr 8 11:49:56
Le mer. 8 avr. 2020 à 11:21, Henri Menke a écrit :
> Hi Fabrice,
>
> Could you provide a MWE, or maybe even open an issue on the bugtracker?
> https://github.com/pgf-tikz/pgfplots/issues
>
> Cheers, Henri
>
> On 07/04/20, 14:22, Fabrice Couvreur wrote:
> > Hi Henri,
> > Thank you for answering me. We're entering an area that I don't really
> know. I
> > replaced all ^^ by ^ but I'm not sure I understood. I now have the
> > following message :
> > Thank you
> > Fabrice
> >
> > tex error > tex error on line 5 in file
> pgfplotsbinary.data.code.tex:
> > ! Undefined control sequence
> >
> > l.5 \catcode`\^00=11 \expandafter\xdef\csname pgfp@bin@\the\counter
> > \endcsname{^0
> >
> >0}\advance\counter by1
> > lua error:
> >
> > ?
> >
> >
> >
> >
> >
> >
> > The control sequence at the end of the top line of your error message was
> > never
> > \def'ed. You can just continue as I'll forget about whatever was
> undefined.
> >
> >
> > mtx-context | fatal error: return code: 256
> >
> > TeX Output exited abnormally with code 1 at Tue Apr 7 14:15:58
> >
> > Le mar. 7 avr. 2020 à 04:21, Henri Menke a écrit
> :
> >
> > > The problem is that pgfplots uses the ^^ syntax to access characters
> but
> > > this relies on ^ having catcode 7 which is not the case by default in
> > > ConTeXt. I had a similar issue in PGF before and that was fixed by
> just
> > > replacing the ^^ syntax with the ascii code constants from
> > > syst-ini.mkxl.
> > >
> > > Cheers, Henri
> > >
> > > On 06/04/20, 22:23, Fabrice Couvreur wrote:
> > > > Hi,
> > > > Still with the idea of using lmtx, I get a compilation error when I
> use
> > > > pgfplots.
> > > > Thank you.
> > > > Fabrice
> > > >
> > > > open source > level 9, order 92, name
> 'pgfplotsbinary.data.code.tex'
> > > >
> > > > tex error > tex error on line 42 in file
> > > > pgfplotsbinary.data.code.tex: ! Undefined control sequence
> > > >
> > > > l.42 \catcode`\ =11^^I\expandafter\xdef\csname pgfp@bin@
> > > >
> > > > \the\counter^^I\endcsname{^^20}\endgroup\advance\counter by1
> > > > lua error:
> > > >
> > > > ?
> > > >
> > > >
> > > >
> > > >
> > > >
> > > >
> > > > The control sequence at the end of the top line of your error
> message was
> > > > never
> > > > \def'ed. You can just continue as I'll forget about whateve
[NTG-context] Fwd: Using Lua files in project structure
-- Forwarded message - De: Jairo A. del Rio Date: lun., 6 de abr. de 2020 a la(s) 08:58 Subject: Re: [NTG-context] Using Lua files in project structure To: Wolfgang Schuster Well, I'll be more specific. I attach a zip file showing a minimal example of what I achieved so far and its output (labelled "Works") and what I actually want, but does not work (labelled "Doesnotwork"). I've tried different commands and combinations, all of them useless. As a side note, I'm porting some TikZ functions. Although it is not recommended in ConTeXt, some of them are really necessary to me. El dom., 5 de abr. de 2020 a la(s) 11:05, Wolfgang Schuster ( wolfgang.schuster.li...@gmail.com) escribió: > Jairo A. del Rio schrieb am 05.04.2020 um 17:49: > > None of them work. Maybe I'm doing something wrong. > > I guess so because > > \loadluafile[testh.lua] > > and > > \luaenvironment testh.lua > > work for me. > > Wolfgang > <> ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
[NTG-context] splitted xtable with repeating headers and placetable
Hello,
Code below shows some behaviour I cannot explain (csv file attached):
- If I run the code below as is, I get what I want, except that the
header line of the table does not repeat at the top of each page.
- Changing "split=yes" to "split=repeat" in the setupxtable gives me
repeating headers, but the table starts at the second page, leaving the
first page with only the text line and all the rest as blank spaces.
- Placing the table in a float by activating the 3 commented lines gives
me an error ("extra } or forgotten endgroup") pointing to the external
figure in my page header overlay. Replacing the \placefigure. in
the page header by ordinary text makes the error go away, but is no
solution, since I need the company logo picture there, and even then
with no error, the headers do not repeat.
- With the table in a float, I manage to get repeating headers when I
change to "split=yes" and "headers=repeat" in the \setupxtable, but I
still get the abovementioned error as soon as I want to put my figure
back in the page header..
Any suggestions ?
Geert
\usemodule[handlecsv]
\opencsvfile{systaprov2.csv}
\setuppapersize[A4, landscape]
\setuplayout[location=middle, width=27.5cm, height=18cm,
backspace=1cm,header=4cm]
\setuppagenumbering[state=stop]
\setupcaptions[location=none]
\setupbackgrounds[header][text][background={Logos}, state=repeat]
\setupnumbering [location=]
\setupframed[offset=none]
\defineoverlay
[Logos][{
\framed[width=\textwidth,
height=3cm,
align=right,
strut=no,
offset=none,
frame=on,
frameoffset=0.1cm,
corner=round,
radius=0.15cm,
framecolor=darkgray,
background=color,
backgroundcolor=gray,
framecorner=round,
frameradius=0.15cm,
rulethickness=0.05cm]{
\framed[width=0.280\textwidth,
height=3cm,
align=right,
frame=off]
{\placefigure[force][]{none}{\externalfigure[somepic.png][height=1.9cm]} }
\framed[width=0.430\textwidth,
height=3cm,
align=middle,
frame=off]
{\crlf\tfa \crlf \bf Technical Report}
\framed[width=0.370\textwidth,
height=3cm,
align=middle,
frame=off]
{\tfx \crlf Annex T.2.3. \crlf \tfx Date of issue: \crlf \currentdate
\crlf page \pagenumber of \lastpage}
}
}]
%\setupfloat[table][default={force,split}]
\setupxtable[offset=0cm,
frame=off,
bottomframe=on,
framecolor=gray,
option=stretch,
split=yes,
header=repeat,
align=middle]
\setupxtable[head][background=color,
backgroundcolor=gray,
topframe=on,
bottomframe=on,
framecolor=black,
foregroundcolor=blue]
\setupxtable[left][align=right]
\starttext
Some lines of text. This text must come just before the table, but only
on the first page of the table
\startbuffer[loop]
\startxrow
\startxcell[left] \cA \stopxcell
\startxcell[left] \cB \stopxcell
\startxcell[left] \cC \stopxcell
\startxcell[left] \cD \stopxcell
\startxcell \cE \stopxcell
\startxcell[left] \cF \stopxcell
\startxcell \cG \stopxcell
\startxcell \cH \stopxcell
\doifdefined{cI}{\startxcell \cI \stopxcell}
\doifdefined{cJ}{\startxcell \cJ \stopxcell}
\doifdefined{cK}{\startxcell [left] \cK \stopxcell}
\stopxrow
\stopbuffer
%\startplacetable[]
\startxtable
\startxtablehead[head]
\doloopif{\lineno}{<}{2}{\getbuffer[loop]}
\stopxtablehead
\startxtablebody
\doloopif{\lineno}{>}{1}{\getbuffer[loop]}
\stopxtablebody
\stopxtable
%\stopplacetable
\stoptext
Nº;Subject;Dirno;Tano; Date;Corr;VAVE; Stage; Remark
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-65-89-45; -; 2018/1832; all; N/A;
ab;asdfa a fasddf qgt qhq tr hq qhqhr ;EFERT;21-54-322-32-;12/12/20;ERTF; all;1;b
sg;afae a t hyj wy thjqh jqtj ;7GSD;25-
Re: [NTG-context] Short weekday option for date command
On 4/4/2020 11:47 AM, Adam Reviczky wrote: Hi, Is there a way to achieve a short weekday option with \date[] to get 3 letter equivalents (Mon, Tue, Wed, Thu, Fri, Sat, Sun) similar to the monthshort either through context or lua? Not currently but I will add the basics (I have to double check with WS to see where if conflicts as such an extension involves additional commands it has to go into the setups too) but others have to add the abbreviations. Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
[NTG-context] Short weekday option for date command
Hi, Is there a way to achieve a short weekday option with \date[] to get 3 letter equivalents (Mon, Tue, Wed, Thu, Fri, Sat, Sun) similar to the monthshort either through context or lua? Thanks, Adam ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Indenting entries in the table of contents?
This is what I'm using at the moment:
% Tables of Contents
\setuplist[part][textstyle={\sl},pagestyle={\tf}]
\setuplist[chapter][textstyle={\sl},pagestyle={\tf},label=yes,width=fi
t,stopper=~~]
\setuplist[section][width=42pt,margin=10pt,style={\tf}]
\setuplist[subsection][width=42pt,margin=18pt,style={\tf}]
\setupcombinedlist[content][alternative=c,aligntitle=no,width=2.5em,li
st={part,chapter,section,subsection}]
Best, Richard
--
Richard Mahoney | Indica et Buddhica
Littledene Bay Road Oxford NZ
T: +6433121699 M: +64210640216
r.maho...@indica-et-buddhica.org
https://indica-et-buddhica.org/
-Original Message-
From: Henning Hraban Ramm
Reply-To: mailing list for ConTeXt users
To: mailing list for ConTeXt users
Subject: Re: [NTG-context] Indenting entries in the table of contents?
Date: Sat, 21 Mar 2020 09:15:12 +0100
Mailer: Apple Mail (2.3445.104.11)
> Am 2020-03-21 um 03:10 schrieb T. Kurt Bond :
>
> I'd like subsection entries in the table of contents to be indented
> slightly, and subsubsection entries to be indented slightly more,
> and subsubsubsection entries to be indented some more.
>
> Is there any way to do this?
It’s not obvious in https://wiki.contextgarden.net/Table_of_Contents
but you need
\setuplist[subsection][margin=2cm] etc.
see
https://wiki.contextgarden.net/Command/setuplist
Greetlings, Hraban
---
https://www.fiee.net
http://wiki.contextgarden.net
https://www.dreiviertelhaus.de
GPG Key ID 1C9B22FD
__
_
If your question is of interest to others as well, please add an entry
to the Wiki!
maillist : ntg-context@ntg.nl /
http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
__
_
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] METAPOST vardef returning multiple and non-numeric types as a single answer?
> On 16 Mar 2020, at 10:23, Taco Hoekwater wrote:
>
>
>
>> On 16 Mar 2020, at 10:10, Taco Hoekwater wrote:
>>
>>
>>
>>> On 16 Mar 2020, at 09:53, Gerben Wierda wrote:
>>>
>>> Hola! So, the arguments passed to macros are by reference and not by value?
>>> I could have known of course, they are simple expansions, but I’d like to
>>> be sure. IfI assign to a variable inside a vardef macro and that variable
>>> is not ’save’d I’m changing the original?
>>
>> Yes. (A simple test would have confirmed that)
>
> Oops, sorry, no! I was wrong on that… it must be too early for me.
Coffee! Thanks anyway, Taco, your help is really appreciated.
>
> vardef Foo(text y) =
>scantokens(y&":=5”);
> enddef;
> Foo("x");
>
> This would work, but that is weird.
Which is somewhat intuitive to parse as a human. I understand it as that after
the last statement x has the value 5.
> This also works, and that is why
> I had the erroneous memory that it would work always:
>
> vardef Foo(expr a)(text y) =
>y[a] := 5;
> enddef;
> numeric foo[];
> foo[1] = 6;
> Foo(1,foo);
This was initially complete gobbledegook to me. But I now think that after the
last statement foo[1] equals 5. Very weird/counterintuitive that y[a] := 5
works here without the use of scantokens. The first one is less weird to me
because scantokens actually calls the METAPOST parser on a string as if read
from a file.
> or you could use global variables, of course.
>
> Main point: Metapost is not an easy language to grasp. If you want to
> really understand how it works, you should study the Metafont book by DEK.
I actually have that book and did a try small bit of METAFONT long, long ago to
create a logo in it. Maybe that explains things better. (Unearthing the book
for later use…)
> As you can clearly see, even experienced users are likely to make mistakes.
The main problem with all of this (ConTeXt, METAPOST, etc.) remains the
learning curve and the lack of good and up-to-date educational materials. I.e.
the METAPOST manual is terse, probably because it relies on people
understanding the background that is in the METAFONT book.
And, if one is used to thinking in terms of functional programming, all that
‘expansion’ stuff (‘replacement’ programming?) is very counterintuitive for
me. Lua then adds a functional model to the mix (or I think it does). Very hard
to make progress. I learned Python in a day and produced a complex program in a
matter of weeks. This is far less easy. And not being able so far to see what
intermediate results lea to errors adds to the slow going.
I.e., the whole chapter on vardef in the METAFONT book is
G
>
>
> Best wishes,
> Taco
>
>
>
>
> ___
> If your question is of interest to others as well, please add an entry to the
> Wiki!
>
> maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
> webpage : http://www.pragma-ade.nl / http://context.aanhet.net
> archive : https://bitbucket.org/phg/context-mirror/commits/
> wiki : http://contextgarden.net
> ___
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] ntg-context Digest, Vol 189, Issue 28
Hello Wolfgang, after a few attempts that didn't work I copy-pasted the
example from the wiki:
\definetyping[C][option=commands]\startC
#include
int main(){
return 0;
/BTEX{\em unreachedCode;}/ETEX}\stopC
This did not work.
However following the example you provided this works perfectly! Many thanks.
On Sun, Mar 15, 2020 at 6:26 AM wrote:
> Send ntg-context mailing list submissions to
> ntg-context@ntg.nl
>
> To subscribe or unsubscribe via the World Wide Web, visit
> https://mailman.ntg.nl/mailman/listinfo/ntg-context
> or, via email, send a message with subject or body 'help' to
> ntg-context-requ...@ntg.nl
>
> You can reach the person managing the list at
> ntg-context-ow...@ntg.nl
>
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of ntg-context digest..."
>
>
> Today's Topics:
>
>1. Source Code with Bolded Keywords (Yves Cloutier)
>2. Re: Source Code with Bolded Keywords (Wolfgang Schuster)
>3. Quizz (Fabrice Couvreur)
>4. Re: Quizz (Henning Hraban Ramm)
>5. METAPOST vardef returning multiple and non-numeric types as a
> single answer? (Gerben Wierda)
>
>
> --
>
> Message: 1
> Date: Sat, 14 Mar 2020 11:54:31 -0400
> From: Yves Cloutier
> To: mailing list for ConTeXt users
> Subject: [NTG-context] Source Code with Bolded Keywords
> Message-ID:
> j5f28-8qv3ykrp+ev+ukrf0q+sp3mabskapxbkvn956...@mail.gmail.com>
> Content-Type: text/plain; charset="utf-8"
>
> Hello,
>
> I am trying to typeset source code for a custom programming language and
> would like to have the keywords in bold text.
>
> I tried following the example found here regarding verbatim displays:
>
> https://www.contextgarden.net/Verbatim_text#Displayed_text
>
> Specifically the C example, however this does not seem to work. No
> formatting is applied to my keywords.
>
> Just wondering if the way to do it has changed or if there are other
> examples I could look at to compare with what I'm doing.
>
> Regards,
>
> yc
> -- next part --
> An HTML attachment was scrubbed...
> URL: <
> http://mailman.ntg.nl/pipermail/ntg-context/attachments/20200314/d14dd25f/attachment-0001.htm
> >
>
> --
>
> Message: 2
> Date: Sat, 14 Mar 2020 20:03:34 +0100
> From: Wolfgang Schuster
> To: mailing list for ConTeXt users , Yves Cloutier
>
> Subject: Re: [NTG-context] Source Code with Bolded Keywords
> Message-ID:
> Content-Type: text/plain; charset=utf-8; format=flowed
>
> Yves Cloutier schrieb am 14.03.2020 um 16:54:
> > Hello,
> >
> > I am trying to typeset source code for a custom programming language and
> > would like to have the keywords in bold text.
> >
> > I tried following the example found here regarding verbatim displays:
> >
> > https://www.contextgarden.net/Verbatim_text#Displayed_text
> >
> > Specifically the C example, however this does not seem to work. No
> > formatting is applied to my keywords.
>
> Can you provide a minimal example what you have tried.
>
> > Just wondering if the way to do it has changed or if there are other
> > examples I could look at to compare with what I'm doing.
>
> \starttext
>
> \starttyping[escape=yes]
> This is /BTEX\bf formatted/ETEX text.
> \stoptyping
>
> \starttyping[escape={<<,>>}]
> This is <<\bf formatted>> text.
> \stoptyping
>
> \starttyping[escape={}]
> This is text.
> \stoptyping
>
> \stoptext
>
> Wolfgang
>
>
> --
>
> Message: 3
> Date: Sun, 15 Mar 2020 10:34:43 +0100
> From: Fabrice Couvreur
> To: mailing list for ConTeXt users
> Subject: [NTG-context] Quizz
> Message-ID:
> smfmjke3lc_-ptxwhw09g+ultk1...@mail.gmail.com>
> Content-Type: text/plain; charset="utf-8"
>
> Hi,
> With the Coronavirus pandemic, my school will close like all the others. We
> chose to work with Microsoft Teams. I know how to file Math exercises
> written with ConteXt and export to pdf format. Is it possible with ConteXt
> to create interactive Quizz?
> Thank you
> Fabrice
> -- next part --
> An HTML attachment was scrubbed...
> URL: <
> http://mailman.ntg.nl/pipermail/ntg-context/attachments/20200315/17fa9887/attachment-0001.htm
> >
>
> --
>
> Message: 4
> Date: Sun, 15 Mar 2020 10:46:17 +0100
> From: Henning Hraban Ramm
> To: ntg-context@ntg.nl
>
Re: [NTG-context] XML to ConTeXt: converting date attribute from ISO date
On 3/11/2020 4:54 PM, Axel Kielhorn wrote: Hello Hans and mailing list! Thank you so much. With this example and the help I received earlier from Massi, I’ve been able to write my first finalizer today. It is amazing how powerful luatex is. indeed (and luametatex is supposed to be even bit more powerful) My project needs some cleanup and documentation but I hope to put it on GitHub soon. After that I will try to put a minimal version into the wiki. that would be nice. thanks Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] XML to ConTeXt: converting date attribute from ISO date
Hello Hans and mailing list! Thank you so much. With this example and the help I received earlier from Massi, I’ve been able to write my first finalizer today. It is amazing how powerful luatex is. My project needs some cleanup and documentation but I hope to put it on GitHub soon. After that I will try to put a minimal version into the wiki. Greetings Axel ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] XML to ConTeXt: converting date attribute from ISO date
> Am 11.03.2020 um 15:19 schrieb Hans Hagen :
>
> On 3/11/2020 3:12 PM, Axel Kielhorn wrote:
>>> Am 11.03.2020 um 15:01 schrieb Hans Hagen :
>>>
>>> On 3/11/2020 2:14 PM, Axel Kielhorn wrote:
Had to change it to:
\startluacode
function xml.finalizers.tex.MyDate(e,what,how)
local ee = e[1].at[what]
local t = (string.split(ee,"-"))
context.date(
{ y = t[1], m = t[2], d = t[3] },
{ how }
)
end
\stopluacode
>>> You mean the () around the split? weird. Anyway, there's also a time
>>> splitter (dedicated to Alan who needed one):
>> No, sorry that’s an artifact from testing.
>> I had to assign:
>> local ee = e[1].at[what]
>> and
>> string.split(ee,"-")
>> in two steps while the original had
>> local t = string.split(e[1].at[what],"-")
> still strange because it's one value, if it were multiple you could do
This is strange.
Now it works.
Earlier I had context.date complaining that it got a table and not a string.
That’s why I took the t = assignment apart into pieces.
Now I copied the code from the original reply and it works.
Sorry for the noise.
Axel
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] XML to ConTeXt: converting date attribute from ISO date
On 3/11/2020 2:14 PM, Axel Kielhorn wrote:
Am 15.08.2018 um 14:04 schrieb Hans Hagen :
On 8/15/2018 12:27 PM, Mike O'Connor wrote:
G’Day,
Having a first go at converting TEI XML to ConTeXt.
Steep learning curve, but easier (for me) than XSLT, and first results were
amazing. Using http://www.pragma-ade.com/general/manuals/xml-mkiv.pdf as a
guide.
Currently stuck on converting an ISO format date (eg. 1908-01-10) into
something more readable (eg. 10 January 1908) in the output. I presume I
should create a function (?luacode) that can take any ISO value and output the
readable form. The following works but seems to me inefficient.
Grateful for any pointers.
Mike
Here is my MWE:
\startbuffer[demo]
10.I.08
19 Mar '08
\stopbuffer
\startxmlsetups xml:initialize
\xmlsetsetup{#1}{date}{xml:date}
\stopxmlsetups
\xmlregistersetup{xml:initialize}
\startxmlsetups xml:date
\xmldoifelse {#1}{.[@type='divDate']} {
\def\docdate{\ctxlua{
local tyear = string.sub('\xmlatt{#1}{when-iso}',1,4)
local tmonth = string.sub('\xmlatt{#1}{when-iso}',6,7)
local tday = string.sub('\xmlatt{#1}{when-iso}',9,10)
context.date{d = tday, m = tmonth, y = tyear}
}}
\docdate[day,month,year] = Document Date \par
} {
\def\docdate{\ctxlua{
local tyear = string.sub('\xmlatt{#1}{when-iso}',1,4)
local tmonth = string.sub('\xmlatt{#1}{when-iso}',6,7)
local tday = string.sub('\xmlatt{#1}{when-iso}',9,10)
context.date{d = tday, m = tmonth, y = tyear}
}}
\docdate[day,month,year] = Event Date\par
}
\stopxmlsetups
\starttext
\xmlprocessbuffer{main}{demo}{}
\stoptext
Can be wikified ...
\startluacode
function xml.finalizers.tex.MyDate(e,what,how)
local t = string.split(e[1].at[what],"-")
context.date(
{ y = t[1], m = t[2], d = t[3] },
{ how }
)
end
\stopluacode
\startxmlsetups xml:date
\xmldoifelse {#1}{.[@type='divDate']} {
\xmlfilter{#1}{./MyDate("when-iso","day,month,year")}\
Document Date \par
} {
\xmlfilter{#1}{./MyDate("when-iso","day,month,year")}\
Event Date\par
}
\stopxmlsetups
I couldn’t get this to work.
Had to change it to:
\startluacode
function xml.finalizers.tex.MyDate(e,what,how)
local ee = e[1].at[what]
local t = (string.split(ee,"-"))
context.date(
{ y = t[1], m = t[2], d = t[3] },
{ how }
)
end
\stopluacode
You mean the () around the split? weird. Anyway, there's also a time
splitter (dedicated to Alan who needed one):
print(os.time(utilities.parsers.totime("2019-03-05 12:12:12")))
print(os.time(utilities.parsers.totime("2019/03/05 12:12:12")))
print(os.time(utilities.parsers.totime("05-03-2019 12:12:12")))
print(os.time(utilities.parsers.totime("05/03/2019 12:12:12")))
inspect(utilities.parsers.totime("2019-03-05 12:12:12"))
inspect(utilities.parsers.totime("2019/03/05 12:12:12"))
inspect(utilities.parsers.totime("05-03-2019 12:12:12"))
inspect(utilities.parsers.totime("05/03/2019 12:12:12"))
-
Hans Hagen | PRAGMA ADE
Ridderstraat 27 | 8061 GH Hasselt | The Netherlands
tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl
-
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] XML to ConTeXt: converting date attribute from ISO date
> Am 15.08.2018 um 14:04 schrieb Hans Hagen :
>
> On 8/15/2018 12:27 PM, Mike O'Connor wrote:
>> G’Day,
>> Having a first go at converting TEI XML to ConTeXt.
>> Steep learning curve, but easier (for me) than XSLT, and first results were
>> amazing. Using http://www.pragma-ade.com/general/manuals/xml-mkiv.pdf as a
>> guide.
>> Currently stuck on converting an ISO format date (eg. 1908-01-10) into
>> something more readable (eg. 10 January 1908) in the output. I presume I
>> should create a function (?luacode) that can take any ISO value and output
>> the readable form. The following works but seems to me inefficient.
>> Grateful for any pointers.
>> Mike
>> Here is my MWE:
>> \startbuffer[demo]
>>
>>
>>
>>
>>
>> 10.I.08
>>
>>
>> 19 Mar '08
>>
>>
>>
>>
>>
>> \stopbuffer
>> \startxmlsetups xml:initialize
>> \xmlsetsetup{#1}{date}{xml:date}
>> \stopxmlsetups
>> \xmlregistersetup{xml:initialize}
>> \startxmlsetups xml:date
>> \xmldoifelse {#1}{.[@type='divDate']} {
>> \def\docdate{\ctxlua{
>> local tyear = string.sub('\xmlatt{#1}{when-iso}',1,4)
>> local tmonth = string.sub('\xmlatt{#1}{when-iso}',6,7)
>> local tday = string.sub('\xmlatt{#1}{when-iso}',9,10)
>> context.date{d = tday, m = tmonth, y = tyear}
>> }}
>> \docdate[day,month,year] = Document Date \par
>> } {
>> \def\docdate{\ctxlua{
>> local tyear = string.sub('\xmlatt{#1}{when-iso}',1,4)
>> local tmonth = string.sub('\xmlatt{#1}{when-iso}',6,7)
>> local tday = string.sub('\xmlatt{#1}{when-iso}',9,10)
>> context.date{d = tday, m = tmonth, y = tyear}
>> }}
>> \docdate[day,month,year] = Event Date\par
>> }
>> \stopxmlsetups
>> \starttext
>> \xmlprocessbuffer{main}{demo}{}
>> \stoptext
> Can be wikified ...
>
> \startluacode
>function xml.finalizers.tex.MyDate(e,what,how)
>local t = string.split(e[1].at[what],"-")
>context.date(
> { y = t[1], m = t[2], d = t[3] },
>{ how }
>)
>end
> \stopluacode
>
> \startxmlsetups xml:date
>
> \xmldoifelse {#1}{.[@type='divDate']} {
>\xmlfilter{#1}{./MyDate("when-iso","day,month,year")}\
> Document Date \par
>} {
>\xmlfilter{#1}{./MyDate("when-iso","day,month,year")}\
>Event Date\par
>
> }
> \stopxmlsetups
I couldn’t get this to work.
Had to change it to:
\startluacode
function xml.finalizers.tex.MyDate(e,what,how)
local ee = e[1].at[what]
local t = (string.split(ee,"-"))
context.date(
{ y = t[1], m = t[2], d = t[3] },
{ how }
)
end
\stopluacode
mtx-context | ConTeXt Process Management 1.03
mtx-context |
mtx-context | main context file: /Volumes/Macintosh
HD/usr/local/texlive/context-109/tex/texmf-context/tex/context/base/mkiv/context.mkiv
mtx-context | current version: 2020.01.30 14:13
mtx-context | main context file: /Volumes/Macintosh
HD/usr/local/texlive/context-109/tex/texmf-context/tex/context/base/mkiv/context.mkxl
mtx-context | current version: 2020.01.30 14:13
Greetings Axel
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Up-to-date documentation / tutorials. Where?
Is there not a simple place to get all the up-to-date documentation? If you install ConTeXt from http://www.pragma-ade.nl/install.htm in the installation tree you'll find docs under tex/texmf-context/doc/context/documents/ There you'll always find the docs at their last revision. Massi ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Up-to-date documentation / tutorials. Where?
On Sat, 29 Feb 2020 12:10:13 +0100 Gerben Wierda wrote: > Hello community, > > I have been (unsuccessfully) hunting for up-to-date tutorials/documentation > on ConTeXt/LuaTeX/METAPOST. What I find is sites that for instance end in > 2011. documentation that is from 2013, or on Pragme-ADE a show-man.pdf PDF > with an overview of documentation that doesn’t open any underlying document. > > Is there not a simple place to get all the up-to-date documentation? Take a look into the documentation folder [1] of your ConTeXt installation. A few of the documents mentions ConTeXt related extension to MetaPost but the basics haven't changed and the old tutorials work. [1] $TEXMF/tex/texmf-context/doc/context/documents/general/manuals List of all documents in the directory above: about.pdf bidi.pdf charts-mkiv.pdf cld-mkiv.pdf colors-mkiv.pdf columnsets.pdf details.pdf ecmascript-mkiv.pdf epub-mkiv-demo.epub epub-mkiv-demo.pdf epub-mkiv.pdf evenmore.pdf followingup.pdf fonts-mkiv.pdf graphics.pdf hybrid.pdf interaction.pdf languages-mkiv.pdf libraries-mkiv.pdf lowlevel-boxes.pdf lowlevel-conditionals.pdf lowlevel-expansion.pdf lowlevel-registers.pdf lua-mkiv.pdf luametafun.pdf luametatex.pdf luatex.pdf ma-cb-en.pdf math-mkiv.pdf metafun-p.pdf metafun-s.pdf mk.pdf mkiv-publications.pdf mmlexamp.pdf mmlprime.pdf mreadme.pdf musings.pdf nodes.pdf notnow.pdf onandon.pdf pagecolumns.pdf rules-mkiv.pdf spacing-mkiv.pdf spreadsheets-mkiv.pdf sql-mkiv.pdf steps-mkiv.pdf still.pdf svg-lmtx.pdf swiglib-mkiv.pdf templates-mkiv.pdf texit.pdf tiptrick.pdf tools-mkiv.pdf units-mkiv.pdf workflows-mkiv.pdf xml-mkiv.pdf xtables-mkiv.pdf Wolfgang ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
[NTG-context] Up-to-date documentation / tutorials. Where?
Hello community, I have been (unsuccessfully) hunting for up-to-date tutorials/documentation on ConTeXt/LuaTeX/METAPOST. What I find is sites that for instance end in 2011. documentation that is from 2013, or on Pragme-ADE a show-man.pdf PDF with an overview of documentation that doesn’t open any underlying document. Is there not a simple place to get all the up-to-date documentation? G ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Up-to-date documentation / tutorials. Where?
Hi, > Is there not a simple place to get all the up-to-date documentation? maybe not what you are looking for, but I think the list at https://tex.stackexchange.com/questions/448812/the-definitive-guide-to-context-mkiv-documentation is very helpful. ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] mtxrun
> Hi Luca, > > > 1) always writing the full path of the correct executable, > > I don't know which operating system you're using. On linux instead of > writing > the full path I'm using the command "alias" in my ".bashrc" file. So, > Adityas > proposal on mtxrun (Date: Wed, 12 Feb 2020 00:24:21 -0500 (EST)) becomes: > > alias context='~/context-lmtx/tex/texmf-linux-64/bin/mtxrun --autogenerate > --script > context' > with 'context-lmtx' being the directory, where I installed context. > With this you invoke your context file with "context your-file.tex" > I cancelled all context stuff in my PATH variable. Don't forget to 'source > ~/.bashrc' > afterwards. > > Hi Rudolf, thank you for your suggestion. I'm on linux but I'd prefer not to use this method, because I use context both from the command line and from my editor (emacs with auctex) and I have scripts that change my environment to be able to switch between different context versions (lmtx, texlive, ...). In any case, I'll think about this solution and it could be useful to other people, too. LD ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] mtxrun
On Fri, Feb 14, 2020 at 08:59:57PM +0100, Luca Donetti wrote: > > > So I run explicitly the second one: > > > ~/context-lmtx/bin/mtxrun --generate > > > but I got the same error. > > > > This is the wrong binary. As Hans said (and also what I wrote in my > > message) is that you have to run the one in > > ~/context-lmtx/tex/texmf-linux-64/bin/ Hi Luca, > 1) always writing the full path of the correct executable, I don't know which operating system you're using. On linux instead of writing the full path I'm using the command "alias" in my ".bashrc" file. So, Adityas proposal on mtxrun (Date: Wed, 12 Feb 2020 00:24:21 -0500 (EST)) becomes: alias context='~/context-lmtx/tex/texmf-linux-64/bin/mtxrun --autogenerate --script context' with 'context-lmtx' being the directory, where I installed context. With this you invoke your context file with "context your-file.tex" I cancelled all context stuff in my PATH variable. Don't forget to 'source ~/.bashrc' afterwards. > 2) avoid putting [lmtx path]/bin in PATH, Yes, this could be a solution too, in my opinion. > 3) putting [lmtx path]/bin _after_ [lmtx path]/tex/texmf-linux-64/bin in > the PATH > > I'm asking here because option 1 is correct but not very handy, while 2) > and 3) are different from what the installer says and they seemed to give > other problems when I tried them. I hope this helps you! At least in the case you're using linux. Best wishes, Rudolf ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
[NTG-context] [Fwd: Re: upload]
Actually, I've just seen that the file that seemed to be causing the issue: error loading file: util-tab.lua contains the following: 400 Bad Request Bad Request Your browser sent a request that this server could not understand. Apache Server at 87.195.107.53 Port 80 /home/rbm49/lmtx/tex/texmf-context/tex/context/base/mkiv/util-tab.lua byte 289/289 (END) I installed, and reinstalled, the update using lmtx "install.sh". Was "util-tab.lua" not in the archive by any chance? Best, Richard -- Richard Mahoney | Indica et Buddhica Littledene Bay Road Oxford NZ T: +6433121699 M: +64210640216 r.maho...@indica-et-buddhica.org https://indica-et-buddhica.org/ Forwarded Message From: Richard Mahoney | Indica et Buddhica < r.maho...@indica-et-buddhica.org> To: ntg-context@ntg.nl Subject: Re: [NTG-context] upload Date: Wed, 12 Feb 2020 10:09:42 +1300 Mailer: Evolution 3.32.5 Organization: Indica et Buddhica With the latest just uploaded I'm running into the following on Linux, after trying all these: mtxrun --script cache --erase --make mtxrun --generate context --make I've also tried manually deleting the cache but the result is the same. Does anyone know what might be wrong? I'm attaching the log. Best, Richard -- Richard Mahoney | Indica et Buddhica Littledene Bay Road Oxford NZ T: +6433121699 M: +64210640216 r.maho...@indica-et-buddhica.org https://indica-et-buddhica.org/ -Original Message- From: Hans Hagen Reply-To: mailing list for ConTeXt users To: mailing list for ConTeXt users , Floris van Manen Subject: Re: [NTG-context] upload Date: Tue, 11 Feb 2020 20:07:39 +0100 Mailer: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:68.0) Gecko/20100101 Thunderbird/68.4.2 On 2/11/2020 5:18 PM, Floris van Manen wrote: > On 11-02-2020 17:00, Hans Hagen wrote: > > - support for ecmascript for those who think thayt javascript is > > better > > than lua (of course only to find out at some point that it's not > > true in > > the perspective of context but it migh tmake a transition easier). > > For > > the impatient: > > > > http://www.pragma-ade.com/general/manuals/ecmascript-mkiv.pdf > > to (further) promote the usage of lua, it might help if the examples > given in the pdf documentation will also include the (better) lua > version... sure but actually it can be that users have (or find) javascript code someplace that can help them do something without conversion (and introducing errors) ... of course assuming proper ecmascript the interface in lmtx provides a way to pipe into tex (with catcode support) as well as access to files in the tex ecosystem (controlled) so it just provides the few interfaces needed on top of a basic engine conforming the 'standard' Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - __ _ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net __ _ mtx-context | warning: no format found, forcing remake (commandline driven) resolvers | resolving | configuration files already identified resolvers | resolving | loading configuration file 'selfautoparent:/texmf/web2c/texmfcnf.lua' resolvers | resolving | resolvers | resolving | locating list of 'home:texmf' (runtime) (tree:///home:texmf) resolvers | methods | resolving, method 'locators', how 'uri', handler 'tree', argument 'tree:///home:texmf' resolvers | trees | locator 'home:texmf' not found resolvers | resolving | locating list of 'selfautoparent:texmf-project' (cached) resolvers | methods | resolving, method 'locators', how 'uri', handler 'file', argument 'selfautoparent:texmf-project' resolvers | files | file locator 'selfautoparent:texmf-project' found as '/home/rbm49/lmtx/tex/texmf-project' resolvers | resolving | locating list of 'selfautoparent:texmf-fonts' (cached) resolvers | methods | resolving, method 'locators', how 'uri', handler 'file', argument 'selfautoparent:texmf-fonts' resolvers | files | file locator 'selfautoparent:texmf-fonts' found as '/home/rbm49/lmtx/tex/texmf-fonts' resolvers | resolving | locating list of 'selfautoparent:texmf-local' (cached
Re: [NTG-context] upload
With the latest just uploaded I'm running into the following on Linux, after trying all these: mtxrun --script cache --erase --make mtxrun --generate context --make I've also tried manually deleting the cache but the result is the same. Does anyone know what might be wrong? I'm attaching the log. Best, Richard -- Richard Mahoney | Indica et Buddhica Littledene Bay Road Oxford NZ T: +6433121699 M: +64210640216 r.maho...@indica-et-buddhica.org https://indica-et-buddhica.org/ -Original Message- From: Hans Hagen Reply-To: mailing list for ConTeXt users To: mailing list for ConTeXt users , Floris van Manen Subject: Re: [NTG-context] upload Date: Tue, 11 Feb 2020 20:07:39 +0100 Mailer: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:68.0) Gecko/20100101 Thunderbird/68.4.2 On 2/11/2020 5:18 PM, Floris van Manen wrote: > > On 11-02-2020 17:00, Hans Hagen wrote: > > - support for ecmascript for those who think thayt javascript is > > better > > than lua (of course only to find out at some point that it's not > > true in > > the perspective of context but it migh tmake a transition easier). > > For > > the impatient: > > > > http://www.pragma-ade.com/general/manuals/ecmascript-mkiv.pdf > > to (further) promote the usage of lua, it might help if the examples > given in the pdf documentation will also include the (better) lua > version... sure but actually it can be that users have (or find) javascript code someplace that can help them do something without conversion (and introducing errors) ... of course assuming proper ecmascript the interface in lmtx provides a way to pipe into tex (with catcode support) as well as access to files in the tex ecosystem (controlled) so it just provides the few interfaces needed on top of a basic engine conforming the 'standard' Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - __ _ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net __ _ mtx-context | warning: no format found, forcing remake (commandline driven) resolvers | resolving | configuration files already identified resolvers | resolving | loading configuration file 'selfautoparent:/texmf/web2c/texmfcnf.lua' resolvers | resolving | resolvers | resolving | locating list of 'home:texmf' (runtime) (tree:///home:texmf) resolvers | methods | resolving, method 'locators', how 'uri', handler 'tree', argument 'tree:///home:texmf' resolvers | trees | locator 'home:texmf' not found resolvers | resolving | locating list of 'selfautoparent:texmf-project' (cached) resolvers | methods | resolving, method 'locators', how 'uri', handler 'file', argument 'selfautoparent:texmf-project' resolvers | files | file locator 'selfautoparent:texmf-project' found as '/home/rbm49/lmtx/tex/texmf-project' resolvers | resolving | locating list of 'selfautoparent:texmf-fonts' (cached) resolvers | methods | resolving, method 'locators', how 'uri', handler 'file', argument 'selfautoparent:texmf-fonts' resolvers | files | file locator 'selfautoparent:texmf-fonts' found as '/home/rbm49/lmtx/tex/texmf-fonts' resolvers | resolving | locating list of 'selfautoparent:texmf-local' (cached) resolvers | methods | resolving, method 'locators', how 'uri', handler 'file', argument 'selfautoparent:texmf-local' resolvers | files | file locator 'selfautoparent:texmf-local' found as '/home/rbm49/lmtx/tex/texmf-local' resolvers | resolving | locating list of 'selfautoparent:texmf-modules' (cached) resolvers | methods | resolving, method 'locators', how 'uri', handler 'file', argument 'selfautoparent:texmf-modules' resolvers | files | file locator 'selfautoparent:texmf-modules' found as '/home/rbm49/lmtx/tex/texmf-modules' resolvers | resolving | locating list of 'selfautoparent:texmf-context' (cached) resolvers | methods | resolving, method 'locators', how 'uri', handler 'file', argument 'selfautoparent:texmf-context' resolvers | files | file locator 'selfautoparent:texmf-context' found as '/home/rbm49/lmtx/tex/texmf-context' resolvers | resolving | locating list of 'selfautoparent:texmf-linux-64' (cached) reso
Re: [NTG-context] Coding for new Unicode characters
Just to say that I seem to have resolved this (& properly I hope).
I read these two pages:
https://www.contextgarden.net/Faking_characters
https://source.contextgarden.net/tex/context/base/mkiv/enco-ini.mkiv?search=textcedilla
and have included the following with my setups:
% Additional Characters
\definecharacter llowmacron {\buildtextmacron l}
\definecharacter Llowmacron {\buildtextmacron L}
\definecharacter nlowmacron {\buildtextmacron n}
\definecharacter Nlowmacron {\buildtextmacron N}
\definecharacter rlowmacron {\buildtextmacron r}
\definecharacter Rlowmacron {\buildtextmacron R}
\define\lLM{\llowmacron}
\define\LLM{\Llowmacron}
\define\nLM{\nlowmacron}
\define\NLM{\Nlowmacron}
\define\rLM{\rlowmacron}
\define\RLM{\Rlowmacron}
This seems to do it, although if there is a better way please feel
free to say.
Best, Richard
--
Richard Mahoney | Indica et Buddhica
Littledene Bay Road Oxford NZ
T: +6433121699 M: +64210640216
r.maho...@indica-et-buddhica.org
https://indica-et-buddhica.org/
-Original Message-
From: Richard Mahoney | Indica et Buddhica <
r.maho...@indica-et-buddhica.org>
Reply-To: mailing list for ConTeXt users
To: mailing list for ConTeXt users
Subject: [NTG-context] Coding for new Unicode characters
Date: Sun, 29 Dec 2019 12:52:18 +1300
Mailer: Evolution 3.32.4
Organization: Indica et Buddhica
I am using Latin Modern Roman to typeset some proceedings and need the
following characters in regular, italic, and small caps:
Character: ṉ U+1E49
Name: LATIN SMALL LETTER N WITH LINE BELOW
Character: Ṉ U+1E48
Name: LATIN CAPITAL LETTER N WITH LINE BELOW
Character: ḻ U+1E3B
Name: LATIN SMALL LETTER L WITH LINE BELOW
Character: Ḻ U+1E3A
Name: LATIN CAPITAL LETTER L WITH LINE BELOW
Character: ṟ U+1E5F
Name: LATIN SMALL LETTER R WITH LINE BELOW
Character: Ṟ U+1E5E
Name: LATIN CAPITAL LETTER R WITH LINE BELOW
These characters are available in Computer Modern Unicode (although
not, it seems, in small caps). Still, I would prefer to still with LM.
I'm wondering if there is a way in Context to set up these characters
on the fly, say with something along the lines of "newunicodechar"?
\newunicodechar{}{}
\newunicodechar{ā}{\accent"0304 a}
newunicodechar -- Definitions of the meaning of Unicode characters
https://ctan.org/pkg/newunicodechar?lang=en
Best, Richard
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] lmtx
Thank you Hans. I've just generated a monograph I'm setting with your new linux-64 zip. Everything seems just fine, great. Best, Richard -- Richard Mahoney | Indica et Buddhica Littledene Bay Road Oxford NZ T: +6433121699 M: +64210640216 r.maho...@indica-et-buddhica.org https://indica-et-buddhica.org/ -Original Message- From: Hans Hagen Reply-To: mailing list for ConTeXt users To: mailing list for ConTeXt users Subject: [NTG-context] lmtx Date: Thu, 12 Dec 2019 01:37:00 +0100 Mailer: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:68.0) Gecko/20100101 Thunderbird/68.3.0 Hi, The last few days there have been reports about garbled files in the lmtx installation so I did some test oinon a linux machine and indeed there was some issue (I'm not sure what causes it). Anyway, I made new zips so maybe one needs to reinstall (using the installer zip). It installs okay on wsl so probably also on other linuxes. This version (luametatex 2.03.3) has (again) a little smaller mem footprint as I still want it all to perforem ok on relative small devices or vm's and as side effect a bit smaller format file, not that that matters much (compared to general mem usage). There is not much to gain anyway, in terms of memory usage and performance so it's more an occasional challenge than a neccessity I guess. Anyway, hopefully nothing got broken. Peter Rolf and I are updating some of the pdf validation related stuff (additional formats), so that can be in flux. Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - __ _ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net __ _ ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] problem with a new installation of LMTX
Hello Hans, Yes, the Linux install fails as well. I have just tried another. The output of context --make is attached. During the install the ascii *.lua files in the following directory -- initially from context-linux-64.zip-- are overwritten by what look like binaries: /path/to/lmtx/bin: total used in directory 3444 available 236814588 drwx-- 2 rbm49 rbm494096 Mar 2 2019 . drwx-- 4 rbm49 rbm494096 Dec 9 06:59 .. -rw--- 1 rbm49 rbm49 16432 Dec 9 06:59 mtx-install.lua -rwx-- 1 rbm49 rbm49 2786296 Dec 9 06:59 mtxrun -rw--- 1 rbm49 rbm49 696620 Dec 9 06:59 mtxrun.lua And at the end of the install the following two files also seem to be binaries (see "no valid format" message in attached log): /path/to/lmtx/tex/texmf/web2c: total used in directory 28 available 236977668 drwx-- 2 rbm49 rbm49 4096 Dec 9 06:58 . drwx-- 6 rbm49 rbm49 4096 Dec 9 06:58 .. -rw--- 1 rbm49 rbm49 7500 Dec 9 06:58 texmf.cnf -rw--- 1 rbm49 rbm49 8214 Dec 9 06:58 texmfcnf.lua Best, Richard -- Richard Mahoney | Indica et Buddhica Littledene Bay Road Oxford NZ T: +6433121699 M: +64210640216 r.maho...@indica-et-buddhica.org https://indica-et-buddhica.org/ -Original Message- From: Hans Hagen To: Richard Mahoney | Indica et Buddhica < r.maho...@indica-et-buddhica.org> Subject: Re: [NTG-context] problem with a new installation of LMTX Date: Sun, 8 Dec 2019 12:30:32 +0100 Mailer: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:68.0) Gecko/20100101 Thunderbird/68.3.0 On 12/8/2019 8:36 AM, Richard Mahoney | Indica et Buddhica wrote: > Hello Otared, > > "... get overwritten and are modified for some unknown reasons: in > particular the two lua files become complete garbage…" > > I found the same today under Gentoo Linux, and the same for the lua > files under (can't check which as I've deleted the install): > > ~/lmtx/tex/texmf-linux-64/bin so linux install fails too? Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - [rbm49@ieb-01000-hp-8570w:1:lmtx] % /home/rbm49/lmtx/tex/texmf-linux-64/bin/context --make mtxrun | forcing cache reload resolvers | resolving | configuration files already identified resolvers | resolving | skipping configuration file 'home:texmf/web2c/texmfcnf.lua' (no valid format) resolvers | resolving | skipping configuration file 'selfautoparent:/texmf/web2c/texmfcnf.lua' (no valid format) resolvers | resolving | no texmf paths are defined (using TEXMF) resolvers | resolving | mtxrun | the resolver databases are not present or outdated resolvers | resolving | using suffix based filetype 'lua' resolvers | resolving | remembering file 'mtx-context.lua' using hash 'lua::mtx-context.lua' resolvers | resolving | using suffix based filetype 'lua' resolvers | resolving | remembering file 'mtx-contexts.lua' using hash 'lua::mtx-contexts.lua' resolvers | resolving | remembered file 'mtx-context.lua' resolvers | resolving | using suffix based filetype 'lua' resolvers | resolving | remembering file 'mtx-t-mtx-context.lua' using hash 'lua::mtx-t-mtx-context.lua' resolvers | resolving | using suffix based filetype 'lua' resolvers | resolving | remembering file 'mtx-t-mtx-contexts.lua' using hash 'lua::mtx-t-mtx-contexts.lua' resolvers | resolving | remembered file 'mtx-t-mtx-context.lua' resolvers | resolving | remembered file 'mtx-context.lua' mtxrun | unknown script 'mtx-context.lua' or 'mtx-mtx-context.lua' Title: subscripion control ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] problem with a new installation of LMTX
Hello Otared,
"... get overwritten and are modified for some unknown reasons: in
particular the two lua files become complete garbage…"
I found the same today under Gentoo Linux, and the same for the lua
files under (can't check which as I've deleted the install):
~/lmtx/tex/texmf-linux-64/bin
Best, Richard
--
Richard Mahoney | Indica et Buddhica
Littledene Bay Road Oxford NZ
T: +6433121699 M: +64210640216
r.maho...@indica-et-buddhica.org
https://indica-et-buddhica.org/
-Original Message-
From: Otared Kavian
Reply-To: mailing list for ConTeXt users
To: mailing list for ConTeXt users
Subject: Re: [NTG-context] problem with a new installation of LMTX
Date: Sun, 8 Dec 2019 08:08:11 +0100
Mailer: Apple Mail (2.3445.104.11)
Hi Dalyoung,
I installed MacOS 10.15 Catalina on a partition of my Mac and tried to
install LuaMetaTeX there. I did not succeed …
Indeed I had to disable completely the Gatekeeper from the Terminal by
issuing the command
sudo spctl --master-disable
(which, one can re-enable again by saying sudo spctl --master-enable).
But the problem is that after issuing the command
sh install.sh
the three files mtx-install.lua, mtxrun.lua, mtxrun, which are in
/context-osx-64/bin/
get overwritten and are modified for some unknown reasons: in
particular the two lua files become complete garbage… while in MacOS
10.14 these files are unchanged.
So in fact the installation process cannot continue in MacOS 10.15,
and even though the directories in
/context-osx-64/tex/
are created, the binaries and the formats are not there. I guess other
people on the list may have installed LuaMetaTeX under MacOS 10.15 and
they can help us understand what is going on.
Later in the day I'll try to understand how to bypass the security
assessments (and the overwrite of the above three files) of MacOS
10.15, and let you know if I find a solution.
Sorry for not being helpful at this point…
Best regards: Otared K.
> On 8 Dec 2019, at 00:20, Jeong Dal wrote:
>
> Dear Hans, Otared,
>
> Thank you for your concern.
>
> The version of luametatex is 20191206.
> I followed what Otared said, but texmf-cache is not created after
> mtxrun.
>
> "context —make" is running, but no format.
>
> I checked folders after the installation.
> Folders, texmf-cache, texmf-fonts, texmf-local, texmf-modules,
> texmf-project are empty.
> texmf folder contains {fonts,metapost, tex,web2c}
> texmf-context folder contains {colors,context,doc}
> However, I couldn’t find base files, script files, etc.
> Is it normal? Is it related with Catalina?
>
> Have a nice weekend.
>
> Best regards,
>
> Dalyoung
>
> For reference, here are log of "mtxrun —generate”
> %%
> MacBook ConTeXtLMTX % mtxrun --generate
> resolvers | resolving | variable 'SELFAUTOLOC' set to
> '/Users/graph/ConTeXtLMTX/tex/texmf-osx-64/bin'
> resolvers | resolving | variable 'SELFAUTODIR' set to
> '/Users/graph/ConTeXtLMTX/tex/texmf-osx-64'
> resolvers | resolving | variable 'SELFAUTOPARENT' set to
> '/Users/graph/ConTeXtLMTX/tex'
> resolvers | resolving | variable 'TEXMFCNF' set to ''
> resolvers | resolving | variable 'TEXMF' set to ''
> resolvers | resolving | variable 'TEXOS' set to 'texmf-osx-64'
> resolvers | resolving |
> resolvers | resolving | using configuration specification
> 'home:texmf/web2c;selfautoparent:/texmf-
> local/web2c;selfautoparent:/texmf-
> context/web2c;selfautoparent:/texmf-
> dist/web2c;selfautoparent:/texmf/web2c'
> resolvers | resolving |
> resolvers | resolving | looking for regular 'texmfcnf.lua' on
> given path '/Users/graph/texmf/web2c' from specification
> 'home:texmf/web2c'
> resolvers | resolving | looking for regular 'texmfcnf.lua' on
> given path '/Users/graph/ConTeXtLMTX/tex/texmf-local/web2c' from
> specification 'selfautoparent:/texmf-local/web2c'
> resolvers | resolving | looking for regular 'texmfcnf.lua' on
> given path '/Users/graph/ConTeXtLMTX/tex/texmf-context/web2c' from
> specification 'selfautoparent:/texmf-context/web2c'
> resolvers | resolving | looking for regular 'texmfcnf.lua' on
> given path '/Users/graph/ConTeXtLMTX/tex/texmf-dist/web2c' from
> specification 'selfautoparent:/texmf-dist/web2c'
> resolvers | resolving | looking for regular 'texmfcnf.lua' on
> given path '/Users/graph/ConTeXtLMTX/tex/texmf/web2c' from
> specification 'selfautoparent:/texmf/web2c'
> resolvers | resolving | found regular configuration file
> '/Users/graph/ConTeXtLMTX/tex/texmf/web2c/texmfcnf.lua'
> resolvers | resolving |
> resolvers | resolving | skipping configuration file
> 'selfautoparent:/texmf/web2c/texmfcnf.lua' (no valid format)
> reso
[NTG-context] Impacts Project
Hi list! Thank you for helping to answer so many questions and remove so many roadblocks with my project. The result is a photobook written in Markdown, piped through pandoc to generate ConTeXt code, then stylized using a series of .tex files. The coolest ConTeX part, IMO, is the orange dot in the timeline. Using MetaPost, the date for the timeline is read directly from the document, then plotted relative to the \overlaywidth. Changing the date in the Markdown document winds up repositioning the timeline dot automagically. https://impacts.to/ The book is going to be released under a CC BY 4.0 license, including all the source code necessary to generate the book. Meanwhile, if anyone is interested in nabbing a copy of the PDF, let me know (preferably via the web form). Again, my sincerest gratitude, this project would have been a much more time-consuming and arduous journey without your generous help. ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] ConTeXt as a service
Am 2019-11-23 um 16:50 schrieb Mojca Miklavec : > > On Sat, 23 Nov 2019 at 16:40, Henning Hraban Ramm wrote: >>> Am 2019-11-23 um 15:14 schrieb Mojca Miklavec: >>> On Sat, 23 Nov 2019 at 13:02, Henning Hraban Ramm wrote: >>>>> Am 2019-11-23 um 08:12 schrieb Mojca Miklavec: >>>>>> >>>>>> Then you can use one of the online JS editors like CKeditor.\ >>>>> >>>>> Only if you spend an enormous amount of effort making sure that the >>>>> code is properly cleaned up rather than containing a gazillion random >>>>> html style tags which you can never reconstruct back into some >>>>> structured form. >>>> >>>> Don’t exaggerate. Or maybe your company didn’t think about which tags are >>>> really necessary. >>>> A proper configuration that doesn’t allow nonsense, even if users paste >>>> text from Word documents, is not such a big effort. >>> >>> I'm not exaggerating, I would gladly be convinced/proved that I'm >>> wrong. How much effort (expressed in hours or days) do you think is >>> needed to implement the following? >> >> Oh, IMO that wishlist is very demanding. I’d say it’s more or less >> impossible with any HTML editor. > > So where do we stand with "you are exaggerating, it's really simple", > then? How many hours to configure it? ;) I was thinking about text (articles, literature), you were thinking about complex material. The first is simple, the latter is, well, at least complex. > (ConTeXt has no problems doing all that, and asciidoc as potential > input format supports all the required features as well; But that’s structured input; I thought we were talking about HTML editors. HTML is only well structured (in a general sense, not XML) if you write it this way manually or if you severely limit the user of an editor. > if a nice > translation layer is defined, one can get both awesome html out of the > box as well as high quality PDF. I'm just saying that I find MCE > somewhat useless. Whether or not that's exaggerating ... still waiting > to be proven wrong.) MCE is a known example, but probably not the best for every purpose. Also a matter of taste... >> The JS editors I know of allow for custom menus, and it should be easy to >> setup special divs for these warning sections. >> I don’t know any good table or formula editors/plugins, though. I’m not up >> to date, but I guess with a graphical/“WYSIWYG” tool you’ll never get >> perfectly structured input and will never be able to address finer details >> of typography, esp. WRT math. > > Well ... both Word and Open/LibreOffice do a pretty decent job w.r.t > math nowadays, MathJax is awesome, and I've also seen some awesome > javascript apps allowing you to edit equations. So it's not > impossible. Just not that straightforward … Since I seldom need formulae, I got no experience with those. Last time I had to use Word’s formula editor it was horrible, but that was in 2005 or so, and Microsoft did their homework since. I guess it’s still easier to write TeX code than clicking formulae together. > I'm not saying that I really need a WYSIWYG editor. Anyone who's > supposed to enter correct complex formulas should be able to learn > some basic markup language (I guess). I agree. Best, Hraban ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] ConTeXt as a service
On Sat, 23 Nov 2019 at 16:40, Henning Hraban Ramm wrote: > > Am 2019-11-23 um 15:14 schrieb Mojca Miklavec: > > On Sat, 23 Nov 2019 at 13:02, Henning Hraban Ramm wrote: > >>> Am 2019-11-23 um 08:12 schrieb Mojca Miklavec: > >>>> > >>>> Then you can use one of the online JS editors like CKeditor.\ > >>> > >>> Only if you spend an enormous amount of effort making sure that the > >>> code is properly cleaned up rather than containing a gazillion random > >>> html style tags which you can never reconstruct back into some > >>> structured form. > >>> > >>> (And yes, my impression is that Massi spent a huge amount of effort in > >>> configuring the editor and cleaning up the mess. My company didn't and > >>> ended up with sometimes literally every word in a sentence using a > >>> different font size or style. They gave up on html + cke pretty soon, > >>> but couldn't be convinced that this was a bad idea upfront.) > >> > >> Don’t exaggerate. Or maybe your company didn’t think about which tags are > >> really necessary. > >> A proper configuration that doesn’t allow nonsense, even if users paste > >> text from Word documents, is not such a big effort. > > > > I'm not exaggerating, I would gladly be convinced/proved that I'm > > wrong. How much effort (expressed in hours or days) do you think is > > needed to implement the following? > > Oh, IMO that wishlist is very demanding. I’d say it’s more or less impossible > with any HTML editor. So where do we stand with "you are exaggerating, it's really simple", then? How many hours to configure it? ;) (ConTeXt has no problems doing all that, and asciidoc as potential input format supports all the required features as well; if a nice translation layer is defined, one can get both awesome html out of the box as well as high quality PDF. I'm just saying that I find MCE somewhat useless. Whether or not that's exaggerating ... still waiting to be proven wrong.) > The JS editors I know of allow for custom menus, and it should be easy to > setup special divs for these warning sections. > I don’t know any good table or formula editors/plugins, though. I’m not up to > date, but I guess with a graphical/“WYSIWYG” tool you’ll never get perfectly > structured input and will never be able to address finer details of > typography, esp. WRT math. Well ... both Word and Open/LibreOffice do a pretty decent job w.r.t math nowadays, MathJax is awesome, and I've also seen some awesome javascript apps allowing you to edit equations. So it's not impossible. Just not that straightforward ... I'm not saying that I really need a WYSIWYG editor. Anyone who's supposed to enter correct complex formulas should be able to learn some basic markup language (I guess). Mojca ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] ConTeXt as a service
put. But I’m always planning a lot. Sorry for pratting, got nostalgic. The JS editors I know of allow for custom menus, and it should be easy to setup special divs for these warning sections. I don’t know any good table or formula editors/plugins, though. I’m not up to date, but I guess with a graphical/“WYSIWYG” tool you’ll never get perfectly structured input and will never be able to address finer details of typography, esp. WRT math. (Remember what Hans told us about Pragma’s ASCIImath workflow.) Also, what Massi said. He has more extensive and more current experience than me. Best, Hraban ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] LuaTeX incompatible with Lua
On 11/21/2019 8:17 AM, Henri Menke wrote:
Dear list,
The following Lua script behaves differently when executed in Lua vs.
LuaTeX.
print(os.execute("date"))
It seems that the definition of os_execute in loslibext.c was copied
over from Lua 5.1 and not adapted to newer versions.
$ lua5.1 test.lua
0
$ lua5.2 test.lua
true exit 0
$ lua5.3 test.lua
true exit 0
$ texlua test.lua
0
$ luajit test.lua
0
$ texluajit test.lua
0
As you can see from the example, this comes with the additional
complication that LuaJIT has Lua 5.1 behaviour and should also retain
that.
Indeed, the old interface was kept (also for compatibility reasons as
lua is used for scripts in texlive etc).
If one used lua as well as luatex as lua engine for the same script one
can write a wrapper if needed (I have been thinking of that on context
but again it would also mean adapting older scripts laying around.)
Hans
-
Hans Hagen | PRAGMA ADE
Ridderstraat 27 | 8061 GH Hasselt | The Netherlands
tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl
-
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] LuaTeX incompatible with Lua
Below I include a suggestion on how to do this sort of version agnostic.
Cheers, Henri
Live example on Wandbox:
https://wandbox.org/permlink/jEn9kNnPB0t5rwjP
---
#include
#include
#include
#include
#include
static int (*lua_os_execute)(lua_State *L) = NULL;
static int os_execute(lua_State *L) {
// Do whatever
printf("Hello Hans!\n");
// Safeguard
assert(lua_os_execute != NULL);
// Return wrapped
return lua_os_execute(L);
}
LUAMOD_API int luaopen_oslibext(lua_State *L) {
lua_getglobal(L, "os");
// Get the address of the original function
if (lua_os_execute == NULL) {
lua_getfield(L, -1, "execute");
lua_os_execute = lua_tocfunction(L, -1);
lua_pop(L, 1);
}
// Push the new function to overwrite the old one
lua_pushcfunction(L, os_execute);
lua_setfield(L, -2, "execute");
return 1;
}
int main(void) {
lua_State *L = luaL_newstate();
luaL_openlibs(L);
luaopen_oslibext(L);
if (luaL_dostring(L, "os.execute([[date]])") != 0) {
fprintf(stderr, "%s", lua_tostring(L, -1));
lua_pop(L, 1);
}
lua_close(L);
}
On 11/21/19 8:17 PM, Henri Menke wrote:
Dear list,
The following Lua script behaves differently when executed in Lua vs.
LuaTeX.
print(os.execute("date"))
It seems that the definition of os_execute in loslibext.c was copied
over from Lua 5.1 and not adapted to newer versions.
$ lua5.1 test.lua
0
$ lua5.2 test.lua
true exit0
$ lua5.3 test.lua
true exit0
$ texlua test.lua
0
$ luajit test.lua
0
$ texluajit test.lua
0
As you can see from the example, this comes with the additional
complication that LuaJIT has Lua 5.1 behaviour and should also retain
that.
Cheers, Henri
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
[NTG-context] LuaTeX incompatible with Lua
Dear list,
The following Lua script behaves differently when executed in Lua vs.
LuaTeX.
print(os.execute("date"))
It seems that the definition of os_execute in loslibext.c was copied
over from Lua 5.1 and not adapted to newer versions.
$ lua5.1 test.lua
0
$ lua5.2 test.lua
trueexit0
$ lua5.3 test.lua
trueexit0
$ texlua test.lua
0
$ luajit test.lua
0
$ texluajit test.lua
0
As you can see from the example, this comes with the additional
complication that LuaJIT has Lua 5.1 behaviour and should also retain
that.
Cheers, Henri
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
[NTG-context] Problem with the bottom line of a header
Hello,
I can not adjust the bottom line of my header even after playing with
location= and boffset.=
Thank you.
Fabrice
\definelayout
[first]
[topspace=1cm,
backspace=3cm,
cutspace=3cm,
leftmargin=.75cm,
leftmargindistance=.5cm,
rightmargin=1.25cm,
rightmargindistance=1cm,
header=1cm,
headerdistance=1cm,
footer=1cm,
footerdistance=1cm,
width=middle,
height=middle,
location=middle]
\setuplayout
[topspace=1cm,
backspace=3cm,
cutspace=3cm,
leftmargin=.75cm,
leftmargindistance=.5cm,
rightmargin=1.25cm,
rightmargindistance=1cm,
header=\zeropoint,
headerdistance=1cm,
footer=1cm,
footerdistance=1cm,
width=middle,
height=middle,
location=middle]
\definelayout
[last]
[first]
\setupbackgrounds
[header]
[text]
[frame=off,
topframe=off,
bottomframe=on,
framecolor=,
rulethickness=1pt]
\defineframed
[headerframed]
[frame=off,
height=fit,
width=fit]
\startuseMPgraphic{framewithshadow}
path p;
p:=origin--(1.05*OverlayWidth,0)--(1.05*OverlayWidth,1.05*OverlayHeight)--
(0,1.05*OverlayHeight)--cycle;
fill p shifted (3,-3);
fill p withcolor 0.8white;
draw p;
setbounds currentpicture to p;
\stopuseMPgraphic
\defineoverlay[framewithshadow][\useMPgraphic{framewithshadow}]
\definecolor[ColorA][0.8(white)]
\startsetups [headertext]
\setupheadertexts
[{\startframed [headerframed]
[foregroundstyle=bold,background=framewithshadow]
\getvariable{headertext}{title}
n\high{o}\,\getvariable{headertext}{number}
\stopframed}]
\setupheadertexts
[{\startframed [headerframed]
[align=flushleft,foregroundstyle=]
Lycée LA SALLE, Lille\\
\getvariable{headertext}{location}
\stopframed}]
[{\startframed [headerframed]
[align=flushright,foregroundstyle=]
\date[d=\getvariable{headertext}{day},m=\getvariable{headertext}{month},
y=\getvariable{headertext}{year}] [D,month,{ },year]
\stopframed}]
\stopsetups
\setvariable{headertext}{set}{\directsetup{headertext}}
\setvariables
[headertext]
[title={Corrigé du devoir maison},
number={1},
day={22},
month={10},
year={2019},
location={Secondes GTE-GTF},
time={}]
\starttext
\input knuth
\stoptext
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] LTMX crashes on OpenBSD 6.5 amd64
Hi Luigi, Unfortunately I cannot check with an up-to-date mkiv, since I didn't succeed in installing standalone mkiv binaries. But those file compile fine under TexLive 2018 context binaries packaged for OpenBSD 6.5. I will check tomorrow, whether my /home/ has got mount options that may lead to crashing, for example regarding w^x settings. Regards, Damien Thiriet ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] mtxrun --generate: "warning: no lua configuration files found"
On Thu, Oct 17, 2019 at 05:21:27PM +0200, Hans Hagen wrote:
> On 10/17/2019 5:02 PM, Rudolf Bahr wrote:
> >
> > Hi All,
> >
> > after a new First-setup from "https://www.contextgarden.net/First-setup;
> > I added new fonts to "~/context/tex/texmf-local/fonts", then run: "mtxrun
> > --generate"
> > and got
> >
> > "resolvers | resolving | warning: no lua configuration files found"
> >
> >
> > Please, what is to be done in this case?
> >
> > status_of_update.lua: ["date"]="2019-10-17 13:16:50",
> does
>
> mtxrun --generate
>
> something useful?
>
> Hans
I append the output of mtxrun --generate here.
I hope it's doing something useful.
The next step: mtxrun --script fonts --reload
writes one line:
"mtxrun | unknown script 'fonts.lua' or 'mtx-fonts.lua'"
Rudolf
sam@nanu:~/context$ mtxrun --generate
resolvers | resolving | variable 'SELFAUTOLOC' set to
'/home/sam/context/bin'
resolvers | resolving | variable 'SELFAUTODIR' set to '/home/sam/context'
resolvers | resolving | variable 'SELFAUTOPARENT' set to '/home/sam'
resolvers | resolving | variable 'TEXMFCNF' set to ''
resolvers | resolving | variable 'TEXMF' set to
'/home/sam/context/tex/texmf'
resolvers | resolving | variable 'TEXOS' set to 'context'
resolvers | resolving |
resolvers | resolving | using configuration specification
'home:texmf/web2c;{selfautoloc:,selfautoloc:/share/texmf-local/web2c,selfautoloc:/share/texmf-dist/web2c,selfautoloc:/share/texmf/web2c,selfautoloc:/texmf-local/web2c,selfautoloc:/texmf-dist/web2c,selfautoloc:/texmf/web2c,selfautodir:,selfautodir:/share/texmf-local/web2c,selfautodir:/share/texmf-dist/web2c,selfautodir:/share/texmf/web2c,selfautodir:/texmf-local/web2c,selfautodir:/texmf-dist/web2c,selfautodir:/texmf/web2c,$SELFAUTOGRANDPARENT/texmf-local/web2c,selfautoparent:,selfautoparent:/share/texmf-local/web2c,selfautoparent:/share/texmf-dist/web2c,selfautoparent:/share/texmf/web2c,selfautoparent:/texmf-local/web2c,selfautoparent:/texmf-dist/web2c,selfautoparent:/texmf/web2c}'
resolvers | resolving |
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/texmf/web2c' from specification 'home:texmf/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on weird path
'/home/sam/context/bin' from specification 'selfautoloc:'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/bin/share/texmf-local/web2c' from specification
'selfautoloc:/share/texmf-local/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/bin/share/texmf-dist/web2c' from specification
'selfautoloc:/share/texmf-dist/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/bin/share/texmf/web2c' from specification
'selfautoloc:/share/texmf/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/bin/texmf-local/web2c' from specification
'selfautoloc:/texmf-local/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/bin/texmf-dist/web2c' from specification
'selfautoloc:/texmf-dist/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/bin/texmf/web2c' from specification
'selfautoloc:/texmf/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on weird path
'/home/sam/context' from specification 'selfautodir:'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/share/texmf-local/web2c' from specification
'selfautodir:/share/texmf-local/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/share/texmf-dist/web2c' from specification
'selfautodir:/share/texmf-dist/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/share/texmf/web2c' from specification
'selfautodir:/share/texmf/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/texmf-local/web2c' from specification
'selfautodir:/texmf-local/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/texmf-dist/web2c' from specification
'selfautodir:/texmf-dist/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'/home/sam/context/texmf/web2c' from specification 'selfautodir:/texmf/web2c'
resolvers | resolving | looking for regular 'texmfcnf.lua' on given path
'$SELFAUTOGRANDPARENT/texmf-local/web2c' from specification
'$SELFAUTOGRANDPARENT/texmf-local/web2c'
resolvers | resolving | look
Re: [NTG-context] mtxrun --generate: "warning: no lua configuration files found"
On 10/17/2019 5:02 PM, Rudolf Bahr wrote: Hi All, after a new First-setup from "https://www.contextgarden.net/First-setup; I added new fonts to "~/context/tex/texmf-local/fonts", then run: "mtxrun --generate" and got "resolvers | resolving | warning: no lua configuration files found" Please, what is to be done in this case? status_of_update.lua: ["date"]="2019-10-17 13:16:50", does mtxrun --generate something useful? Hans - Hans Hagen | PRAGMA ADE Ridderstraat 27 | 8061 GH Hasselt | The Netherlands tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl - ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
[NTG-context] mtxrun --generate: "warning: no lua configuration files found"
Hi All, after a new First-setup from "https://www.contextgarden.net/First-setup; I added new fonts to "~/context/tex/texmf-local/fonts", then run: "mtxrun --generate" and got "resolvers | resolving | warning: no lua configuration files found" Please, what is to be done in this case? status_of_update.lua: ["date"]="2019-10-17 13:16:50", Best wishes, Rudolf ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] passing variables/data between context and lua
Rudolf Bahr schrieb am 06.10.2019 um 07:11:
Hello Wolfgang,
what exactly does the command
"\setvariable{martin}{set}{\directsetup{martin}}"?
Let's start with a simple example where I set a values with the
\setvariables command.
\setvariables
[metadata]
[author=Rudolf Bahr,
date=\currentdate]
\starttext
\getvariable{metadata}{author}\par
\getvariable{metadata}{date}
\stoptext
The main point of the command is that you can choose whatever name you
want for the keys to store the values.
Instead a using a list of values to store in a key-value-method you can
also pass values to single keys with the \setvariable command, e.g.
\setvariable{metatdata}{author}{Rudolf Bahr}.
While it is true that you're free to choose the name for the keys there
are two keys with a special meaning, these two keys are "reset" and
"set". The value of the "reset" key is used before the values in
\setvariables are stored while "set" is used after the values are stored.
I don't understand it. Has it something to do with "Command/datasetvariable"?
No, this is a different mechanism to save values between different
ConTeXt runs which allows one to access values before they are set.
Especially what does "\directsetup"?
When you access the content of a setups-environment you can use the
\setups command (with a trailing s) to pass a list of setups or the
\setup command, both commands allow you to use braces or brackets as
delimiters for the argument. The \directsetup skips the check for the
argument form and allows only braces as delimiter.
\startsetups[example-1]
\startparagraph
First example!
\stopparagraph
\stopsetups
\startsetups[example-2]
\startparagraph
Second example!
\stopparagraph
\stopsetups
\starttext
\setups[example-1,example-2]
\blank
\setups{example-1,example-2}
\blank
\setup[example-1]
\setup[example-2]
\blank
\setup{example-1}
\setup{example-2}
\blank
\directsetup{example-1}
\directsetup{example-2}
\stoptext
Wolfgang
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Biblatex \crossref equivalent in bibliographies
On Wed, 4 Sep 2019, Damien Thiriet wrote:
With biblatex I was using crossref to shorten my .bib files, as can be
seen in this MWE
@periodical{DebatMem2002,
title = {Le Débat},
number = {122},
langid = {french},
date = {2002}
}
@article{ChartiersurRicoeur2002,
author = {Roger Chartier},
title = {Le passé au présent},
crossref = {DebatMem2002},
pages = {4--11}
}
Which keys should I use to achieve the same under ConTeXt? I found xcrossref
and percentcrossref keys "Bibliographies. The ConTeXt way" but could'nt figure
out
how to use them. Here is my ConTeXt MWE
as a starting point
There is the following code related to crossref in
publ-imp-definitions.mkiv
\startxmlsetups btx:format:crossref
\cite[\btxfield{crossref}]
\stopxmlsetups
but this doesn't seem to be trigger and doesn't feel like the correct way
to handle crossrefs.
Aditya___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] \date is calculated wrong
On Wed, 2019-09-11 at 08:42 +0200, Hans Hagen wrote:
> On 9/11/2019 4:15 AM, Martin Althoff wrote:
> > Hi all,
> >
> > the \date is output wrong. Whatever value is given for d= I get the 11th.
> > That is todays
> > date. Not sure what would happen tomorrow
> >
> > Thanks for any fix suggestions.
> >
> > \starttext
> > \date[d=16,m=9,y=2019][weekday, day,{. }, month, year]
> > \stoptext
> also in the latest beta?
>
> Hans
>
All fixed after updating to current version: 2019.09.10 20:03
Sorry for the noise,
Thanks, Martin
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] \date is calculated wrong
On 9/11/2019 4:15 AM, Martin Althoff wrote:
Hi all,
the \date is output wrong. Whatever value is given for d= I get the 11th. That
is todays
date. Not sure what would happen tomorrow
Thanks for any fix suggestions.
\starttext
\date[d=16,m=9,y=2019][weekday, day,{. }, month, year]
\stoptext
also in the latest beta?
Hans
-
Hans Hagen | PRAGMA ADE
Ridderstraat 27 | 8061 GH Hasselt | The Netherlands
tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl
-
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
[NTG-context] \date is calculated wrong
Hi all,
the \date is output wrong. Whatever value is given for d= I get the 11th. That
is todays
date. Not sure what would happen tomorrow
Thanks for any fix suggestions.
\starttext
\date[d=16,m=9,y=2019][weekday, day,{. }, month, year]
\stoptext
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Problem of displaying a date with a macro
On 9/9/2019 3:24 PM, Fabrice Couvreur wrote:
Hello,
I just updated my version of ConTeXt and the bug is still present.
Can you confirm ?
Thank you.
Fabrice
Le mer. 28 août 2019 à 16:34, Aditya Mahajan <mailto:adit...@umich.edu>> a écrit :
On Wed, 28 Aug 2019, Fabrice Couvreur wrote:
> Hello,
> The date display is incorrect : I get day 28 instead of day 2.
> Thank you
> Fabrice
>
> \defineframed
> [headerframed]
> [frame=off,
> height=fit,
> width=fit]
>
> \definecolor[ColorA][0.8(white)]
>
>
> \startsetups [headertext]
>
> \setupheadertexts
> [{\startframed [headerframed]
> [foregroundstyle=bold,background=framewithshadow]
> \getvariable{headertext}{title}
> n\high{o}\,\getvariable{headertext}{number}
> \stopframed}]
>
> \setupheadertexts
> [{\startframed [headerframed]
> [align=flushleft,foregroundstyle=]
> Lycée LA SALLE, Lille\\
> \getvariable{headertext}{location}
> \stopframed}]
>
> [{\startframed [headerframed]
> [align=flushright,foregroundstyle=]
>
>
\date[d=\getvariable{headertext}{day},m=\getvariable{headertext}{month},y=\getvariable{headertext}{year}]
> \stopframed}]
>
> \stopsetups
>
> \setvariable{headertext}{set}{\directsetup{headertext}}
>
> \startuseMPgraphic{framewithshadow}
> path p;
>
p:=origin--(OverlayWidth,0)--(OverlayWidth,OverlayHeight)--(0,OverlayHeight)--cycle;
> fill p shifted (2,-2);
> fill p withcolor 0.8white;
> draw p;
> setbounds currentpicture to p;
> \stopuseMPgraphic
>
> \defineoverlay[framewithshadow][\useMPgraphic{framewithshadow}]
>
> \starttext
> \setvariables
> [headertext]
> [title={Devoir maison},
> number={6},
> day={02},
> month={09},
> year={2019},
> location={Seconde B},
> time={}]
> \input knuth
> \stoptext
There was a bug with the \date macro which I had reported a few days
ago.
This appears to be related to that. Should be fixed in the next beta.
I have a chicken-egg issue to solve (probebly in the end have to drop
something for consistency deep down)
can you use for now:
\date[d=21,m=2,y=2219] [month,{ },D,{, },year]
\date[d=22,m=12,y=2119][month,{ },D,{, },year]
--
-
Hans Hagen | PRAGMA ADE
Ridderstraat 27 | 8061 GH Hasselt | The Netherlands
tel: 038 477 53 69 | www.pragma-ade.nl | www.pragma-pod.nl
-
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
Re: [NTG-context] Problem of displaying a date with a macro
Hi, On my installation of lmtx (version 2019.08.20 17:34), as well as mkiv (version 2019.08.24 22:42 MKIV) the following gives: \starttext \date[d=25,m=10,y=1999] \stoptext October 09, 1999. So the month and the year are correct, but not the day. Best regards: OK > On 9 Sep 2019, at 16:27, Pablo Rodriguez wrote: > > On 9/9/19 3:24 PM, Fabrice Couvreur wrote: >> Hello, >> I just updated my version of ConTeXt and the bug is still present. >> Can you confirm ? > > Hi Fabrice, > > I confirm that latest beta (from 2019.09.09 13:44), doesn’t change the > date in the following sample: > >\starttext >\date[d=25] >\stoptext > > I hope it helps, > > Pablo > -- > http://www.ousia.tk > ___ > If your question is of interest to others as well, please add an entry to the > Wiki! > > maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context > webpage : http://www.pragma-ade.nl / http://context.aanhet.net > archive : https://bitbucket.org/phg/context-mirror/commits/ > wiki : http://contextgarden.net > ___ ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Problem of displaying a date with a macro
On 9/9/19 3:24 PM, Fabrice Couvreur wrote: > Hello, > I just updated my version of ConTeXt and the bug is still present. > Can you confirm ? Hi Fabrice, I confirm that latest beta (from 2019.09.09 13:44), doesn’t change the date in the following sample: \starttext \date[d=25] \stoptext I hope it helps, Pablo -- http://www.ousia.tk ___ If your question is of interest to others as well, please add an entry to the Wiki! maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context webpage : http://www.pragma-ade.nl / http://context.aanhet.net archive : https://bitbucket.org/phg/context-mirror/commits/ wiki : http://contextgarden.net ___
Re: [NTG-context] Problem of displaying a date with a macro
Hello,
I just updated my version of ConTeXt and the bug is still present.
Can you confirm ?
Thank you.
Fabrice
Le mer. 28 août 2019 à 16:34, Aditya Mahajan a écrit :
> On Wed, 28 Aug 2019, Fabrice Couvreur wrote:
>
> > Hello,
> > The date display is incorrect : I get day 28 instead of day 2.
> > Thank you
> > Fabrice
> >
> > \defineframed
> >[headerframed]
> >[frame=off,
> > height=fit,
> > width=fit]
> >
> > \definecolor[ColorA][0.8(white)]
> >
> >
> > \startsetups [headertext]
> >
> >\setupheadertexts
> > [{\startframed [headerframed]
> > [foregroundstyle=bold,background=framewithshadow]
> > \getvariable{headertext}{title}
> > n\high{o}\,\getvariable{headertext}{number}
> > \stopframed}]
> >
> >\setupheadertexts
> > [{\startframed [headerframed]
> > [align=flushleft,foregroundstyle=]
> > Lycée LA SALLE, Lille\\
> > \getvariable{headertext}{location}
> > \stopframed}]
> >
> > [{\startframed [headerframed]
> > [align=flushright,foregroundstyle=]
> >
> >
> \date[d=\getvariable{headertext}{day},m=\getvariable{headertext}{month},y=\getvariable{headertext}{year}]
> > \stopframed}]
> >
> > \stopsetups
> >
> > \setvariable{headertext}{set}{\directsetup{headertext}}
> >
> > \startuseMPgraphic{framewithshadow}
> > path p;
> >
> p:=origin--(OverlayWidth,0)--(OverlayWidth,OverlayHeight)--(0,OverlayHeight)--cycle;
> > fill p shifted (2,-2);
> > fill p withcolor 0.8white;
> > draw p;
> > setbounds currentpicture to p;
> > \stopuseMPgraphic
> >
> > \defineoverlay[framewithshadow][\useMPgraphic{framewithshadow}]
> >
> > \starttext
> > \setvariables
> > [headertext]
> > [title={Devoir maison},
> >number={6},
> >day={02},
> >month={09},
> >year={2019},
> >location={Seconde B},
> >time={}]
> > \input knuth
> > \stoptext
>
> There was a bug with the \date macro which I had reported a few days ago.
> This appears to be related to that. Should be fixed in the next beta.
>
>
> Aditya___
> If your question is of interest to others as well, please add an entry to
> the Wiki!
>
> maillist : ntg-context@ntg.nl /
> http://www.ntg.nl/mailman/listinfo/ntg-context
> webpage : http://www.pragma-ade.nl / http://context.aanhet.net
> archive : https://bitbucket.org/phg/context-mirror/commits/
> wiki : http://contextgarden.net
>
> ___
>
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl / http://context.aanhet.net
archive : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___
