this just came up somewhere else for me…. apple mail uses the 
ApplePlainTextBody class to show the ‘>’ as vertical lines… even in supposed 
plain text editing mode.

i found a couple of webmail clients that seem to respect that, as well, but 
using mac browsers… so maybe it’s an overall mac thing.

either way, i THINK he’s talking about the initial ‘>’s at the beginning of 
quoted lines in plain text.












> On Apr 12, 2020, at 8:58 AM, Bruce Van Allen <[email protected]> wrote:
> 
> Hmm. Not seeing the '>.' anywhere.
> 
> 
> On 4/12/20 at 8:01 AM, [email protected] (archaeal) wrote:
> 
>> Hello,
>> I would like to detect the lines starting with >.+ and replace all U with T 
>> in the following line, but not in the line starting with >
>> Example:
>> 
>>> NeiUe166        1551 bp          rna
>> AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU
>>> Unc31652        1491 bp          rna
>> AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG
>>> Unc31653        1469 bp          rna
>> AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG
>> 
>> should look like:
>>> NeiUe166        1551 bp          rna
>> AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT
>>> Unc31652        1491 bp          rna
>> AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG
>>> Unc31653        1469 bp          rna
>> AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG
>> 
>> The search pattern should find the >.. line but make changes only in the 
>> next line
>> Another possibility would be to search just in the "second" line for U and 
>> replace with T
>> 
>> It would be great if someone has an idea.
>> 
>> Thanks a lot
>> archaeal
>> 
>> 
> -- 
> 
>  - Bruce
> 
> _bruce__van_allen__santa_cruz__ca_
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "[email protected]" 
> rather than posting here. Follow @bbedit on Twitter: 
> <https://twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to [email protected].
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/r480Ps-10146i-07F3200541164018A573F13298574B5A%40Forest.local.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "[email protected]" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to [email protected].
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/ACC3D130-6D97-44FB-A9ED-F7F1ABE9B852%405happy.com.

Reply via email to