this just came up somewhere else for me…. apple mail uses the ApplePlainTextBody class to show the ‘>’ as vertical lines… even in supposed plain text editing mode.
i found a couple of webmail clients that seem to respect that, as well, but using mac browsers… so maybe it’s an overall mac thing. either way, i THINK he’s talking about the initial ‘>’s at the beginning of quoted lines in plain text. > On Apr 12, 2020, at 8:58 AM, Bruce Van Allen <[email protected]> wrote: > > Hmm. Not seeing the '>.' anywhere. > > > On 4/12/20 at 8:01 AM, [email protected] (archaeal) wrote: > >> Hello, >> I would like to detect the lines starting with >.+ and replace all U with T >> in the following line, but not in the line starting with > >> Example: >> >>> NeiUe166 1551 bp rna >> AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU >>> Unc31652 1491 bp rna >> AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG >>> Unc31653 1469 bp rna >> AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG >> >> should look like: >>> NeiUe166 1551 bp rna >> AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT >>> Unc31652 1491 bp rna >> AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG >>> Unc31653 1469 bp rna >> AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG >> >> The search pattern should find the >.. line but make changes only in the >> next line >> Another possibility would be to search just in the "second" line for U and >> replace with T >> >> It would be great if someone has an idea. >> >> Thanks a lot >> archaeal >> >> > -- > > - Bruce > > _bruce__van_allen__santa_cruz__ca_ > > -- > This is the BBEdit Talk public discussion group. If you have a feature > request or need technical support, please email "[email protected]" > rather than posting here. Follow @bbedit on Twitter: > <https://twitter.com/bbedit> > --- > You received this message because you are subscribed to the Google Groups > "BBEdit Talk" group. > To unsubscribe from this group and stop receiving emails from it, send an > email to [email protected]. > To view this discussion on the web visit > https://groups.google.com/d/msgid/bbedit/r480Ps-10146i-07F3200541164018A573F13298574B5A%40Forest.local. bruce linde 5 happiness webmaster (four more than the competition!) http://www.5happy.com/ http://clockhappy.com/ 510.530.1331 office 510.206.9730 mobile (shift key available upon request) -- This is the BBEdit Talk public discussion group. If you have a feature request or need technical support, please email "[email protected]" rather than posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit> --- You received this message because you are subscribed to the Google Groups "BBEdit Talk" group. To unsubscribe from this group and stop receiving emails from it, send an email to [email protected]. To view this discussion on the web visit https://groups.google.com/d/msgid/bbedit/ACC3D130-6D97-44FB-A9ED-F7F1ABE9B852%405happy.com.
