This seems to do the trick but you have to run Replace All multiple times for 
it work. The look-behind assertion selection selects only lines which don't 
start with >. Then we find any sequence of zero or more valid characters 
followed by a single U and replace it by T. This replaces the first U in each 
line with T. The lines are 57 characters long so at worst you have to run 
Replace All 57 times.

Find: ^(?<!>)([ACGT]*)U

Replace: \1T

Hope this helps,

[fletcher]


> On Apr 12, 2020, at 8:01 AM, archaeal <[email protected]> wrote:
> 
> Hello,
> I would like to detect the lines starting with >.+ and replace all U with T 
> in the following line, but not in the line starting with >
> Example:
> 
> >NeiUe166        1551 bp          rna
> AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU
> >Unc31652        1491 bp          rna
> AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG
> >Unc31653        1469 bp          rna
> AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG
> 
> should look like:
> >NeiUe166        1551 bp          rna
> AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT
> >Unc31652        1491 bp          rna
> AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG
> >Unc31653        1469 bp          rna
> AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG
> 
> The search pattern should find the >.. line but make changes only in the next 
> line
> Another possibility would be to search just in the "second" line for U and 
> replace with T
> 
> It would be great if someone has an idea.
> 
> Thanks a lot
> archaeal
> 
> 
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "[email protected]" 
> rather than posting here. Follow @bbedit on Twitter: 
> <https://twitter.com/bbedit <https://twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to [email protected] 
> <mailto:[email protected]>.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/19e10d29-be79-4461-90f9-4a20d81ac63f%40googlegroups.com
>  
> <https://groups.google.com/d/msgid/bbedit/19e10d29-be79-4461-90f9-4a20d81ac63f%40googlegroups.com?utm_medium=email&utm_source=footer>.

-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "[email protected]" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to [email protected].
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/6C53273E-8DE5-40FD-8F50-EE430C9BCDC5%40cumuli.com.

Reply via email to