This seems to do the trick but you have to run Replace All multiple times for it work. The look-behind assertion selection selects only lines which don't start with >. Then we find any sequence of zero or more valid characters followed by a single U and replace it by T. This replaces the first U in each line with T. The lines are 57 characters long so at worst you have to run Replace All 57 times.
Find: ^(?<!>)([ACGT]*)U Replace: \1T Hope this helps, [fletcher] > On Apr 12, 2020, at 8:01 AM, archaeal <[email protected]> wrote: > > Hello, > I would like to detect the lines starting with >.+ and replace all U with T > in the following line, but not in the line starting with > > Example: > > >NeiUe166 1551 bp rna > AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU > >Unc31652 1491 bp rna > AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG > >Unc31653 1469 bp rna > AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG > > should look like: > >NeiUe166 1551 bp rna > AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT > >Unc31652 1491 bp rna > AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG > >Unc31653 1469 bp rna > AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG > > The search pattern should find the >.. line but make changes only in the next > line > Another possibility would be to search just in the "second" line for U and > replace with T > > It would be great if someone has an idea. > > Thanks a lot > archaeal > > > > -- > This is the BBEdit Talk public discussion group. If you have a feature > request or need technical support, please email "[email protected]" > rather than posting here. Follow @bbedit on Twitter: > <https://twitter.com/bbedit <https://twitter.com/bbedit>> > --- > You received this message because you are subscribed to the Google Groups > "BBEdit Talk" group. > To unsubscribe from this group and stop receiving emails from it, send an > email to [email protected] > <mailto:[email protected]>. > To view this discussion on the web visit > https://groups.google.com/d/msgid/bbedit/19e10d29-be79-4461-90f9-4a20d81ac63f%40googlegroups.com > > <https://groups.google.com/d/msgid/bbedit/19e10d29-be79-4461-90f9-4a20d81ac63f%40googlegroups.com?utm_medium=email&utm_source=footer>. -- This is the BBEdit Talk public discussion group. If you have a feature request or need technical support, please email "[email protected]" rather than posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit> --- You received this message because you are subscribed to the Google Groups "BBEdit Talk" group. To unsubscribe from this group and stop receiving emails from it, send an email to [email protected]. To view this discussion on the web visit https://groups.google.com/d/msgid/bbedit/6C53273E-8DE5-40FD-8F50-EE430C9BCDC5%40cumuli.com.
