On 21/11/13 01:43 PM, Rick White wrote:
> Hello,
>
> For MG-RAST upload it has two problems from Ray outputs.
>
> The space between contig and number with unique sequence number for example.
> >contig-3000000**508 nucleotides
>
> And, it needs coverage information for
> >sequence_number_1_*[cov=2]*
> CTAGCGCACATAGCATTCAGCGTAGCAGTCACTAGTACGTAGTACGTACC
> >sequence_number_2_*[cov=4]*
> ACGTAGCTCACTCCAGTAGCAGGTACGTCGAGAAGACGTCTAGTCATCAT
>
> I was wondering if there was a quick command to add the coverage information
> to the contig file and remove the space.
>
The mode coverage is available in:
RayOutput/
BiologicalAbundances/
_DenovoAssembly/
Contigs.tsv
You would probably need more than a awk command to rewrite the headers though.
>
> Cheers and many thanks
> Rick
> --
> Richard Allen White III M.S.
> PhD Candidate - Suttle Lab
> Department of Microbiology & Immunology
> The University of British Columbia
> Vancouver, BC, Canada
> cell. 604-440-5150 <tel:604-440-5150>
> http://www.ocgy.ubc.ca/~suttle/ <http://www.ocgy.ubc.ca/%7Esuttle/>
>
>
------------------------------------------------------------------------------
Shape the Mobile Experience: Free Subscription
Software experts and developers: Be at the forefront of tech innovation.
Intel(R) Software Adrenaline delivers strategic insight and game-changing
conversations that shape the rapidly evolving mobile landscape. Sign up now.
http://pubads.g.doubleclick.net/gampad/clk?id=63431311&iu=/4140/ostg.clktrk
_______________________________________________
Denovoassembler-users mailing list
[email protected]
https://lists.sourceforge.net/lists/listinfo/denovoassembler-users