Hello Sebastien,
Could you suggest a way to do it?
Cheers
Rick
On Thu, Nov 21, 2013 at 1:20 PM, Sébastien Boisvert <
sebastien.boisver...@ulaval.ca> wrote:
> On 21/11/13 01:43 PM, Rick White wrote:
>
>> Hello,
>>
>> For MG-RAST upload it has two problems from Ray outputs.
>>
>> The space between contig and number with unique sequence number for
>> example.
>> >contig-3000000**508 nucleotides
>>
>>
>> And, it needs coverage information for
>> >sequence_number_1_*[cov=2]*
>> CTAGCGCACATAGCATTCAGCGTAGCAGTCACTAGTACGTAGTACGTACC
>> >sequence_number_2_*[cov=4]*
>>
>> ACGTAGCTCACTCCAGTAGCAGGTACGTCGAGAAGACGTCTAGTCATCAT
>>
>> I was wondering if there was a quick command to add the coverage
>> information to the contig file and remove the space.
>>
>>
> The mode coverage is available in:
>
> RayOutput/
> BiologicalAbundances/
> _DenovoAssembly/
> Contigs.tsv
>
>
> You would probably need more than a awk command to rewrite the headers
> though.
>
>
>> Cheers and many thanks
>> Rick
>> --
>> Richard Allen White III M.S.
>> PhD Candidate - Suttle Lab
>> Department of Microbiology & Immunology
>> The University of British Columbia
>> Vancouver, BC, Canada
>> cell. 604-440-5150 <tel:604-440-5150>
>> http://www.ocgy.ubc.ca/~suttle/ <http://www.ocgy.ubc.ca/%7Esuttle/>
>>
>>
>>
>
--
Richard Allen White III M.S.
PhD Candidate - Suttle Lab
Department of Microbiology & Immunology
The University of British Columbia
Vancouver, BC, Canada
cell. 604-440-5150
http://www.ocgy.ubc.ca/~suttle/
------------------------------------------------------------------------------
Shape the Mobile Experience: Free Subscription
Software experts and developers: Be at the forefront of tech innovation.
Intel(R) Software Adrenaline delivers strategic insight and game-changing
conversations that shape the rapidly evolving mobile landscape. Sign up now.
http://pubads.g.doubleclick.net/gampad/clk?id=63431311&iu=/4140/ostg.clktrk
_______________________________________________
Denovoassembler-users mailing list
Denovoassembler-users@lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/denovoassembler-users