On Thu, Nov 7, 2013 at 3:18 PM, Peter Cock <p.j.a.c...@googlemail.com> wrote: > On Thu, Nov 7, 2013 at 12:21 PM, Peter Cock <p.j.a.c...@googlemail.com> wrote: >> >> Related to this, would people prefer if the $on_string in the case of >> a single input file was the input file's name (e.g. "My Genes") rather >> than "data 1"? (When there are multiple input files, $on_string needs >> to be kept short). > > That turned out to be quite an easy change (patch below), and > personally I think this makes the $on_string much nicer. > > Peter
Getting back to my motivating example, since fasta_to_tabular.xml does not give the output a label and depends on the default, the small change to $on_string should result in the conversion of a file named "My Genes" as "FASTA-to-Tabular on My Genes", rather than "FASTA-to-Tabular on data 1" as now. Here's another variant to keep the "data 1" text in $on_string, if people are attached to this functionality. That would result in "FASTA-to-Tabular on data 1 (My Genes)". Also, here's an outline patch to explicitly produce my preferred label of "My Genes (as tabular)" etc. (Bjoern is right though - a more long term solution is needed to better address naming, like the tag idea on Trello.) Peter ------------------------------------------------------------------------------------------ $ hg diff lib/galaxy/tools/actions/__init__.py diff -r 77d58fdd1c2e lib/galaxy/tools/actions/__init__.py --- a/lib/galaxy/tools/actions/__init__.py Tue Oct 29 14:21:48 2013 -0400 +++ b/lib/galaxy/tools/actions/__init__.py Thu Nov 07 15:49:15 2013 +0000 @@ -181,6 +181,7 @@ input_names = [] input_ext = 'data' input_dbkey = incoming.get( "dbkey", "?" ) + on_text = '' for name, data in inp_data.items(): if not data: data = NoneDataset( datatypes_registry = trans.app.datatypes_registry ) @@ -194,6 +195,8 @@ else: # HDA if data.hid: input_names.append( 'data %s' % data.hid ) + #Will use this on_text if only one input dataset: + on_text = "data %s (%s)" % (data.id, data.name) input_ext = data.ext if data.dbkey not in [None, '?']: @@ -230,7 +233,10 @@ output_permissions = trans.app.security_agent.history_get_default_permissions( history ) # Build name for output datasets based on tool name and input names if len( input_names ) == 1: - on_text = input_names[0] + #We recorded the dataset name as on_text earlier... + if not on_text: + #Fall back on the shorter 'data %i' style: + on_text = input_names[0] elif len( input_names ) == 2: on_text = '%s and %s' % tuple(input_names[0:2]) elif len( input_names ) == 3: ------------------------------------------------------------------------------------------ $ hg diff tools diff -r 77d58fdd1c2e tools/fasta_tools/fasta_to_tabular.xml --- a/tools/fasta_tools/fasta_to_tabular.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/fasta_tools/fasta_to_tabular.xml Thu Nov 07 15:42:13 2013 +0000 @@ -11,7 +11,7 @@ </param> </inputs> <outputs> - <data name="output" format="tabular"/> + <data name="output" format="tabular" label="$input.display_name (as tabular)"/> </outputs> <tests> <test> diff -r 77d58fdd1c2e tools/fasta_tools/tabular_to_fasta.xml --- a/tools/fasta_tools/tabular_to_fasta.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/fasta_tools/tabular_to_fasta.xml Thu Nov 07 15:42:13 2013 +0000 @@ -7,7 +7,7 @@ <param name="seq_col" type="data_column" data_ref="input" numerical="False" label="Sequence column" /> </inputs> <outputs> - <data name="output" format="fasta"/> + <data name="output" format="fasta" label="$input.display_name (as FASTA)" /> </outputs> <tests> <test> @@ -40,4 +40,4 @@ GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT </help> -</tool> \ No newline at end of file +</tool> diff -r 77d58fdd1c2e tools/fastq/fastq_to_fasta.xml --- a/tools/fastq/fastq_to_fasta.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/fastq/fastq_to_fasta.xml Thu Nov 07 15:42:13 2013 +0000 @@ -5,7 +5,7 @@ <param name="input_file" type="data" format="fastq" label="FASTQ file to convert" /> </inputs> <outputs> - <data name="output_file" format="fasta" /> + <data name="output_file" format="fasta" label="$input_file.name (as FASTA)" /> </outputs> <tests> <!-- basic test --> diff -r 77d58fdd1c2e tools/fastq/fastq_to_tabular.xml --- a/tools/fastq/fastq_to_tabular.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/fastq/fastq_to_tabular.xml Thu Nov 07 15:42:13 2013 +0000 @@ -8,7 +8,7 @@ </param> </inputs> <outputs> - <data name="output_file" format="tabular" /> + <data name="output_file" format="tabular" label="$input_file.name (as tabular)" /> </outputs> <tests> <!-- basic test --> diff -r 77d58fdd1c2e tools/fastq/tabular_to_fastq.xml --- a/tools/fastq/tabular_to_fastq.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/fastq/tabular_to_fastq.xml Thu Nov 07 15:42:13 2013 +0000 @@ -8,7 +8,7 @@ <param name="quality" label="Quality column" type="data_column" data_ref="input_file" /> </inputs> <outputs> - <data name="output_file" format="fastq" /> + <data name="output_file" format="fastq" label="$input_file.name (as FASTQ)" /> </outputs> <tests> <!-- basic test --> diff -r 77d58fdd1c2e tools/filters/axt_to_concat_fasta.xml --- a/tools/filters/axt_to_concat_fasta.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/filters/axt_to_concat_fasta.xml Thu Nov 07 15:42:13 2013 +0000 @@ -14,7 +14,7 @@ <param name="axt_input" value="1.axt" ftype="axt" /> <param name="dbkey_1" value='hg17' /> <param name="dbkey_2" value="panTro1" /> - <output name="out_file1" file="axt_to_concat_fasta.dat" /> + <output name="out_file1" file="axt_to_concat_fasta.dat" label="$axt_input.name (as FASTA)"/> </test> </tests> <help> diff -r 77d58fdd1c2e tools/filters/wig_to_bigwig.xml --- a/tools/filters/wig_to_bigwig.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/filters/wig_to_bigwig.xml Thu Nov 07 15:42:13 2013 +0000 @@ -29,7 +29,7 @@ </conditional> </inputs> <outputs> - <data format="bigwig" name="out_file1" /> + <data format="bigwig" name="out_file1" label="$input1.name (as bigwig)" /> </outputs> <tests> <test> diff -r 77d58fdd1c2e tools/filters/wiggle_to_simple.xml --- a/tools/filters/wiggle_to_simple.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/filters/wiggle_to_simple.xml Thu Nov 07 15:42:13 2013 +0000 @@ -5,7 +5,7 @@ <param format="wig" name="input" type="data" label="Convert"/> </inputs> <outputs> - <data format="interval" name="out_file1" /> + <data format="interval" name="out_file1" label="$input.name (as interval)" /> </outputs> <tests> <test> diff -r 77d58fdd1c2e tools/stats/wiggle_to_simple.xml --- a/tools/stats/wiggle_to_simple.xml Tue Oct 29 14:21:48 2013 -0400 +++ b/tools/stats/wiggle_to_simple.xml Thu Nov 07 15:42:13 2013 +0000 @@ -5,7 +5,7 @@ <param format="wig" name="input" type="data" label="Convert"/> </inputs> <outputs> - <data format="interval" name="out_file1" /> + <data format="interval" name="out_file1" label="$input.name (as interval)" /> </outputs> <tests> <test> ___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/