On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <[email protected]> wrote:
> Hello again,
>
> first of all thanks for your help, it is being very useful.
>
> What I have done up to now is to copy this method to the class Sequence
>
> def get_split_commands_sequential(is_compressed, input_name, output_name,
> start_sequence, sequence_count):
>         ...
>         return [cmd]
>     get_split_commands_sequential =
> staticmethod(get_split_commands_sequential)
>
> This is something that you suggested.

Good.

> When I run the tool with this configuration:
>
> <tool id="bwa_mio" name="map with bwa">
>   <description>map with bwa</description>
>   <parallelism method="basic" split_size="3"
> split_mode="number_of_parts"></parallelism>
>
>   <command>
>       bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa
> $input > $output 2>/dev/null</command>
>   <inputs>
>     <param format="fastqsanger" name="input" type="data" label="fastq"/>
>   </inputs>
>   <outputs>
>       <data format="sam" name="output" />
>   </outputs>
>
>   <help>
>   bwa
>   </help>
>
> </tool>

One minor improvement would be to escape the ">" as "&gt;" in
your XML, or use the CDATA approach documented here:

https://wiki.galaxyproject.org/Tools/BestPractices

> Everything ends ok, but when I go to check how is the sam, I see that in the
> alingments it is the path of the file, i.e
> example_split.sam:
> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446
> 4 * 0 0 * * 0 0
> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT
> ############################################################################
> AS:i:0 XS:i:0
>
> you know what  may be going on?
> If i don't split the file, everything goes correctly.

This sounds to me like there may be a problem with SAM merging?
Could you share the entire example_split.sam file (e.g. as a gist
on GitHub, or via dropbox)?

Peter
___________________________________________________________
Please keep all replies on the list by using "reply all"
in your mail client.  To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
  https://lists.galaxyproject.org/

To search Galaxy mailing lists use the unified search at:
  http://galaxyproject.org/search/mailinglists/

Reply via email to