Hello again, this is something that I consider important, when I see the log I see this output: galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished -* beginning merge: bwa mem* /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this?
Thanks a lot, Regards On 25 February 2015 at 11:13, Roberto Alonso CIPF <[email protected]> wrote: > Hello, > > I just changed for the CDATA format, but the problem still remains. When I > split by 2, there is no problem, but when I go for 3, it happens the > problem commented before. Here it is the link to the sam/bam file: > https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam > > Best regards > > On 24 February 2015 at 17:49, Peter Cock <[email protected]> > wrote: > >> On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF <[email protected]> >> wrote: >> > Hello again, >> > >> > first of all thanks for your help, it is being very useful. >> > >> > What I have done up to now is to copy this method to the class Sequence >> > >> > def get_split_commands_sequential(is_compressed, input_name, >> output_name, >> > start_sequence, sequence_count): >> > ... >> > return [cmd] >> > get_split_commands_sequential = >> > staticmethod(get_split_commands_sequential) >> > >> > This is something that you suggested. >> >> Good. >> >> > When I run the tool with this configuration: >> > >> > <tool id="bwa_mio" name="map with bwa"> >> > <description>map with bwa</description> >> > <parallelism method="basic" split_size="3" >> > split_mode="number_of_parts"></parallelism> >> > >> > <command> >> > bwa mem >> /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa >> > $input > $output 2>/dev/null</command> >> > <inputs> >> > <param format="fastqsanger" name="input" type="data" label="fastq"/> >> > </inputs> >> > <outputs> >> > <data format="sam" name="output" /> >> > </outputs> >> > >> > <help> >> > bwa >> > </help> >> > >> > </tool> >> >> One minor improvement would be to escape the ">" as ">" in >> your XML, or use the CDATA approach documented here: >> >> https://wiki.galaxyproject.org/Tools/BestPractices >> >> > Everything ends ok, but when I go to check how is the sam, I see that >> in the >> > alingments it is the path of the file, i.e >> > example_split.sam: >> > >> /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 >> > 4 * 0 0 * * 0 0 >> > >> TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT >> > >> ############################################################################ >> > AS:i:0 XS:i:0 >> > >> > you know what may be going on? >> > If i don't split the file, everything goes correctly. >> >> This sounds to me like there may be a problem with SAM merging? >> Could you share the entire example_split.sam file (e.g. as a gist >> on GitHub, or via dropbox)? >> >> Peter >> > > > > -- > Roberto Alonso > Functional Genomics Unit > Bioinformatics and Genomics Department > Prince Felipe Research Center (CIPF) > C./Eduardo Primo Yúfera (Científic), nº 3 > (junto Oceanografico) > 46012 Valencia, Spain > Tel: +34 963289680 Ext. 1021 > Fax: +34 963289574 > E-Mail: [email protected] > -- Roberto Alonso Functional Genomics Unit Bioinformatics and Genomics Department Prince Felipe Research Center (CIPF) C./Eduardo Primo Yúfera (Científic), nº 3 (junto Oceanografico) 46012 Valencia, Spain Tel: +34 963289680 Ext. 1021 Fax: +34 963289574 E-Mail: [email protected]
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
