Hi Roberto, I'm happy you solved your issue, thanks for sharing the solution! I'd suggest you open a pull request with the fixes at https://github.com/galaxyproject/galaxy .
Cheers, Nicola Il 25.02.2015 15:07 Roberto Alonso CIPF ha scritto: > Hello again :), > I have found the problem, the code that merge the files is this: > galaxy/datatypes/tabular.py:484: cmd = 'egrep -v "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file ) > This concatenates the file name into the sam file. Just adding "h" it is enough, so it will be like this: > > galaxy/datatypes/tabular.py:484: cmd = 'egrep -Hv "^@" %s >> %s' % ( ' '.join(split_files[1:]), output_file ) > Thanks all for your help, best regards > > On 25 February 2015 at 12:31, Roberto Alonso CIPF wrote: > >> Ok, I think I understand the line: >> beginning merge: bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null >> it refers to the original command, so everything is fine with this line. The other problem still remains >> Regards, sorry for the confusion >> >> On 25 February 2015 at 11:40, Roberto Alonso CIPF wrote: >> >>> Hello again, >>> this is something that I consider important, when I see the log I see this output: >>> >>> galaxy.jobs.runners.tasks DEBUG 2015-02-25 11:33:30,989 execution finished - BEGINNING MERGE: BWA MEM /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa /home/ralonso/galaxy-dist/database/files/000/dataset_8.dat > /home/ralonso/galaxy-dist/database/files/000/dataset_94.dat 2> /dev/null >>> I think the merge should be done with samtools. I don't know how is this programmed in Galaxy, but I didn't indicate anywhere the path to samtools, is it maybe the problem related with this? >>> Thanks a lot, >>> Regards >>> >>> On 25 February 2015 at 11:13, Roberto Alonso CIPF wrote: >>> >>>> Hello, >>>> I just changed for the CDATA format, but the problem still remains. When I split by 2, there is no problem, but when I go for 3, it happens the problem commented before. Here it is the link to the sam/bam file: >>>> https://dl.dropboxusercontent.com/u/1669701/ejemplo_split.bam [3] >>>> Best regards >>>> >>>> On 24 February 2015 at 17:49, Peter Cock wrote: >>>> >>>>> On Tue, Feb 24, 2015 at 4:43 PM, Roberto Alonso CIPF wrote: >>>>> > Hello again, >>>>> > >>>>> > first of all thanks for your help, it is being very useful. >>>>> > >>>>> > What I have done up to now is to copy this method to the class Sequence >>>>> > >>>>> > def get_split_commands_sequential(is_compressed, input_name, output_name, >>>>> > start_sequence, sequence_count): >>>>>> ... >>>>>> return [cmd] >>>>> > get_split_commands_sequential = >>>>> > staticmethod(get_split_commands_sequential) >>>>> > >>>>> > This is something that you suggested. >>>>> >>>>> Good. >>>>> >>>>> > When I run the tool with this configuration: >>>>> > >>>>> > >>>>> > map with bwa >>>>> > > split_mode="number_of_parts"> >>>>> > >>>>> > >>>>> > bwa mem /home/ralonso/BiB/Galaxy/data/Cclementina_v1.0_scaffolds.fa >>>>> > $input > $output 2>/dev/null >>>>> > >>>>> > >>>>> > >>>>> > >>>>> > >>>>> > >>>>> > >>>>> > >>>>> > bwa >>>>> > >>>>> > >>>>> > >>>>> >>>>> One minor improvement would be to escape the ">" as ">" in >>>>> your XML, or use the CDATA approach documented here: >>>>> >>>>> https://wiki.galaxyproject.org/Tools/BestPractices [2] >>>>> >>>>> > Everything ends ok, but when I go to check how is the sam, I see that in the >>>>> > alingments it is the path of the file, i.e >>>>> > example_split.sam: >>>>> > /home/ralonso/galaxy-dist/database/job_working_directory/000/90/task_2/dataset_91.dat:SRR098409.1113446 >>>>> > 4 * 0 0 * * 0 0 >>>>> > TCTGGGTGAGGGAGTGGGGAGTGGGTTTTTGAGGGTGTGTGAGGATGTGTAAGTGGATGGAAGTAGATTGAATGTT >>>>> > ############################################################################ >>>>> > AS:i:0 XS:i:0 >>>>> > >>>>> > you know what may be going on? >>>>> > If i don't split the file, everything goes correctly. >>>>> >>>>> This sounds to me like there may be a problem with SAM merging? >>>>> Could you share the entire example_split.sam file (e.g. as a gist >>>>> on GitHub, or via dropbox)? >>>>> >>>>> Peter >>>> >>>> -- >>>> >>>> Roberto Alonso >>>> Functional Genomics Unit >>>> Bioinformatics and Genomics Department >>>> Prince Felipe Research Center (CIPF) >>>> C./Eduardo Primo Yúfera (Científic), nº 3 >>>> (junto Oceanografico) >>>> 46012 Valencia, Spain >>>> Tel: +34 963289680 Ext. 1021 >>>> Fax: +34 963289574 >>>> E-Mail: [email protected] [5] >>> >>> -- >>> >>> Roberto Alonso >>> Functional Genomics Unit >>> Bioinformatics and Genomics Department >>> Prince Felipe Research Center (CIPF) >>> C./Eduardo Primo Yúfera (Científic), nº 3 >>> (junto Oceanografico) >>> 46012 Valencia, Spain >>> Tel: +34 963289680 Ext. 1021 >>> Fax: +34 963289574 >>> E-Mail: [email protected] [7] >> >> -- >> >> Roberto Alonso >> Functional Genomics Unit >> Bioinformatics and Genomics Department >> Prince Felipe Research Center (CIPF) >> C./Eduardo Primo Yúfera (Científic), nº 3 >> (junto Oceanografico) >> 46012 Valencia, Spain >> Tel: +34 963289680 Ext. 1021 >> Fax: +34 963289574 >> E-Mail: [email protected] [9] > > -- > > Roberto Alonso > Functional Genomics Unit > Bioinformatics and Genomics Department > Prince Felipe Research Center (CIPF) > C./Eduardo Primo Yúfera (Científic), nº 3 > (junto Oceanografico) > 46012 Valencia, Spain > Tel: +34 963289680 Ext. 1021 > Fax: +34 963289574 > E-Mail: [email protected] [11] Connetti gratis il mondo con la nuova indoona: hai la chat, le chiamate, le video chiamate e persino le chiamate di gruppo. E chiami gratis anche i numeri fissi e mobili nel mondo! Scarica subito l’app Vai su https://www.indoona.com/
___________________________________________________________ Please keep all replies on the list by using "reply all" in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: https://lists.galaxyproject.org/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
