Hello Maxim,

Using the tools in EMBOSS can help with these type of text manipulations if you find the basic Text Manipulations tools do not do exactly what you want. For #1, use EMBOSS->biosed to perform substitutions. For #2, use EMBOSS->fuzznuc. A workflow for #2, using your data, is here as an example:


http://main.g2.bx.psu.edu/u/jen-bx-galaxy-edu/h/wf-advanced-text-manipulations-in-galaxy

No stupid questions! Very glad we could help you to get going. Apologies for the late reply.

Best,
Jen
Galaxy team

On 11/29/10 6:25 AM, Maxim Ivanov wrote:
Hello,

Sorry for possibly stupid question. Could you advise me whether there are any 
ways in Galaxy to perform specific manipulations on DNA sequences like:

"Substitute all Gs to Cs (except for CG dinucleotides)":
Input:      chr1    9078238    9078358    Bait1    
ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT
Output:   chr1    9078238    9078358    Bait1    
ACGACACACTCCACCTACCGTCACCTCTCCGCCTCCCGCT

or like:

"Count the number of CG dinucleotides"
Input:      chr1    9078238    9078358    Bait1    
ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT
Output:   chr1    9078238    9078358    Bait1    
ACGAGAGACTGGACCTAGCGTGACCTCTGCGGCTGCCGGT    4

using built-in tools (e.g. specific expressions in the "Compute" tool), or this 
task cannot be done without programming skills?

Thank you in advance!

With respect,
Maxim Ivanov
Dept. of Physiology and Pharmacology
Karolinska Institutet
Stockholm, Sweden
_______________________________________________
galaxy-user mailing list
galaxy-user@lists.bx.psu.edu
http://lists.bx.psu.edu/listinfo/galaxy-user

--
Jennifer Jackson
http://usegalaxy.org
_______________________________________________
galaxy-user mailing list
galaxy-user@lists.bx.psu.edu
http://lists.bx.psu.edu/listinfo/galaxy-user

Reply via email to