Hello!

                I am fairly new to using Galaxy and have a question about the 
FASTQ Groomer feature.  I have 4 RNA-Seq raw data files that were just recently 
generated from Illumina's NGS instruments.  I am aware that the first step to 
perform in Galaxy is FASTQ Groomer to convert the format to FASTQ Sanger.  I 
presume that I would choose Illumina 1.3+ in the "Input FASTQ quality scores 
type" box.  However, if I look at the raw data reads, I notice that Line 4 
(which encodes the quality values for sequence in Line 2) has values outside of 
the Illumina 1.3+ range (some of them fall into the Sanger format.  I am 
enclosing the Quality Score Comparison figure along with some of the raw 
RNA-Seq data):
Quality Score Comparison
SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
|                         |    |        |                              |        
             |
33                        59   64       73                            104       
            126

S - Sanger       Phred+33,  93 values  (0, 93) (0 to 60 expected in raw reads)
I - Illumina 1.3 Phred+64,  62 values  (0, 62) (0 to 40 expected in raw reads)
X - Solexa       Solexa+64, 67 values (-5, 62) (-5 to 40 expected in raw reads)
Diagram adapted from http://en.wikipedia.org/wiki/FASTQ_format
RNA-Seq raw data

@HWI-ST156_294:7:1:1058:2165:0/1

CACCAACTCACAGCCACTCCGTGAGGCCAGCAAGGCAAGAACATTCATCTC

+

HHHHFGGHHHGFHHFHHEGHC<GGGEB.EE9D?DDEEEE4FFFCBB/.C=D



@HWI-ST156_294:7:1:1184:2191:0/1

CGTAAATCCATGTCTGACTTCTGGATAGCAAACACCAGCACCGCGTGGATG

+

EE;E=ECEEBE@EEEE=GBFGF/GFFC<FA;:@<8AEABB>A#########



@HWI-ST156_294:7:1:1018:2200:0/1

NCTGATTAAGGATAATGAGTTTTTAGTAGAACTAATGATGTTATTCCTTGG

+

###################################################



@HWI-ST156_294:7:1:1225:2217:0/1

GTTTTTGACTACACAAAGCACCCTTCTAAACCAGACCATTCTGGAGAATGA

+

FFCEFFFE?FEBDC?987::,3:<-9145,DA<:C9;+?############


                As a test in FASTQ Groomer, I chose either the Sanger or 
Illumina 1.3+ as the input quality scores type and these are the results I got:

FASTQ Groomer on tn-read1 (using Sanger as input)
6.1 Gb
format: fastqsanger, database:mm9
Info: Groomed 45868679 sanger reads into sanger reads. Based upon quality and 
sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 
'I'(73) Input decimal range: 2 - 40

FASTQ Groomer on tn-read1 (using Illumina1.3+ as input)
6.1 Gb
format: fastqsanger, database:mm9
Info: Groomed 45868679 illumina reads into sanger reads. Based upon quality and 
sequence, the input data is valid for: sanger Input ASCII range: '#'(35) - 
'I'(73) Input decimal range: -29 - 9

Which one is right (I presume the Illumina 1.3+ one, but I can't find any sort 
of explanation)?  I noticed that the "input decimal range" had different values 
(although they spanned the same length) in relation to which input was chosen.  
What would happen downstream in TopHat if Sanger was used instead of Illumina 
1.3+ for these files?  Is there any other reading material/websites/etc... out 
there that might help me better understand the quality score and which to use?  
Any info/help would be greatly appreciated.

Thanks,
David


David K. Crossman, Ph.D.
Systems Biologist/Analyst/Statistician
Heflin Center for Genomic Science
University of Alabama at Birmingham
720 20th Street South
Kaul Room 420
Birmingham, AL 35294-0024
(205) 996-4045
(205) 996-4056 (fax)
David K. Crossman, Ph.D.<mailto:dkcro...@uab.edu>
Heflin Center for Genomic Science<http://www.heflingenetics.uab.edu/>

___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Reply via email to