Dear Madam,
Now I am able to understand that the DNA sequences in UCSC are
always given from the 5' end to 3' end irrespective of strand.
But I have tried to correlate between 4 cases. I have
extracted the sequences from location 1 to 20 (the first 20bp
fragment) of chromosome 1 from either stands and also done the
same from loaction 247249700 to 247249719 (the last 20bp
fragment) of chromosome 1 from either stands. I found the
sequences in none of the two cases same or even complementary.
So far I understood, the subsequence of the first 20bp in the + strand
should be complementary to the last 20bp subsequence in the - starnd. And
also this is true for the other two cases. Please clarify if I am
understanding wrong. Output of each of the 4 cases are shown below:
>hg18_dna range=chr1:1-20 5'pad=0 3'pad=0 strand=+ repeatMasking=lower
taaccctaaccctaacccta
>hg18_dna range=chr1:1-20 5'pad=0 3'pad=0 strand=- repeatMasking=lower
tagggttagggttagggtta
>hg18_dna range=chr1:247249700-247249719 5'pad=0 3'pad=0 strand=+
repeatMasking=lower
NNNNNNNNNNNNNNNNNNNN
>hg18_dna range=chr1:247249700-247249719 5'pad=0 3'pad=0 strand=-
repeatMasking=lower
NNNNNNNNNNNNNNNNNNNN
Thanking you,
Tapas Bhadra.
Senior Research Fellow,
Indian Statistical Institute,
Kolkata,
India
> Hi Tapas,
>
> While the coordinates you specify the Get DNA utility or on the
> downloads page are always in reference to the positive strand, the DNA
> sequence is always given from the 5' end to 3' end. The correct figure
> out of the ones you gave in your email is:
>
> + strand: 1 2 3 ... x
> - strand: x ... 3 2 1
>
> I hope this information is helpful. Please feel free to contact the
> mail list again if you require further assistance.
>
> Best,
> Mary
> ------------------
> Mary Goldman
> UCSC Bioinformatics Group
>
> On 6/25/10 2:55 AM, Tapas Bhadra wrote:
>> I think there is a problem in my understanding on the numbering used
>> for base pairs in a chromosome. Can you please clarify my query? In
>> short,
>> the query is "Whether the negative strand of a chromosome is numbered in
>> ascending order just like the positive strand, or in the descending
>> order?"
>>
>> To be descriptive, the bases in the positive strand is numbered as
>> [1-2-3-...-maximum_chromosome_length]. Is the complementary negative
>> strand also numbered in databases like this or as
>> [maximum_chromosome_length- ... -3-2-1]?
>>
>> I have retrieved a sequence from the base 1 to 100 in positive
>> strand of chr 1 and also the same from negative strand and I have seen
>> that they are completely different.
>>
>> Because either the numbering is:
>> + strand: 1 2 3 ... x
>> - strand: 1 2 3 ... x
>>
>> or is:
>> + strand: 1 2 3 ... x
>> - strand: x ... 3 2 1
>>
>> Which one is correct? what are you using?
>>
>>
>>> Hi Tapas,
>>>
>>> My apologies - the browser is looking for default values to enter into
>>> the position text box. The link below should work for hg18,
>>> chr6:1000-1500:
>>>
>>> http://genome.ucsc.edu/cgi-bin/hgc?g=getDna&i=mixed&c=chr6&l=999&r=1500&db=hg18
>>>
>>> Best,
>>> Mary
>>> ---------------------
>>> Mary Goldman
>>> UCSC Bioinformatics Group
>>>
>>> On 6/24/10 4:57 PM, Tapas Bhadra wrote:
>>>
>>>> Sir,
>>>> Thanks for your reply. But when I am trying to go into the site
>>>> it
>>>> shows that "hashMustFindVal: 'c' not found " in that page.
>>>>
>>>> Pleaes reply at your earliest convenience.
>>>>
>>>> Thanking you,
>>>> Tapas Bhadra,
>>>> Senior Research Fellow,
>>>> Indian Statistical Institute,
>>>> Kolkata,
>>>> India
>>>>
>>>>
>>>>
>>>>
>>>>> Hi Tapas,
>>>>>
>>>>> Whether you obtain the DNA sequence through our downloads page or the
>>>>> "DNA" button in the blue bar when you are viewing an assembly, it
>>>>> always
>>>>> defaults to the positive strand. The easiest way to get DNA for a
>>>>> short
>>>>> sequence, such as the one you mentioned in your email, is to use the
>>>>> "get DNA" feature (http://genome.ucsc.edu/cgi-bin/hgc?g=getDna).
>>>>> Simply
>>>>> type in the coordinates and click the "get DNA" button. Note that you
>>>>> can also get DNA from the negative strand by clicking the "reverse
>>>>> complement" check box.
>>>>>
>>>>> I hope this answers this question and both of your questions that
>>>>> were
>>>>> emailed to our team yesterday. Please feel free to contact the mail
>>>>> list
>>>>> again if you require further assistance.
>>>>>
>>>>> Best,
>>>>> Mary
>>>>> ------------------
>>>>> Mary Goldman
>>>>> UCSC Bioinformatics Group
>>>>>
>>>>> On 6/24/10 4:33 AM, Tapas Bhadra wrote:
>>>>>
>>>>>
>>>>>> Dear Sir,
>>>>>> I am a research fellow at the Indian Statistical Institute,
>>>>>> Kolkata,
>>>>>> India.
>>>>>>
>>>>>> I have downloaded the sequences of all the chromosomes. Can you
>>>>>> please
>>>>>> inform me that if I need sequences from 1000bp to 1500bp of chr 6
>>>>>> from
>>>>>> +ve
>>>>>> strand and also from 1000bp to 1500bp of chr 6 from -ve strand, then
>>>>>> how
>>>>>> will I obtain those information. Will they be same?
>>>>>>
>>>>>> Is your database strand specific? If yes then which strand it
>>>>>> annotates
>>>>>> for the sequence and for this strand specific database how will we
>>>>>> obtain
>>>>>> sequential information from the reverse strand?
>>>>>>
>>>>>> Pleaes reply at your earliest convenience.
>>>>>>
>>>>>> Thanking you,
>>>>>> Tapas Bhadra,
>>>>>> Senior Research Fellow,
>>>>>> Indian Statistical
>>>>>> Institute,
>>>>>> Kolkata,
>>>>>> India
>>>>>> This mail is scanned by Ironport
>>>>>>
>>>>>>
>>>>>> _______________________________________________
>>>>>> Genome maillist - [email protected]
>>>>>> https://lists.soe.ucsc.edu/mailman/listinfo/genome
>>>>>>
>>>>>>
>>>>>>
>>>>> This mail is scanned by Ironport
>>>>>
>>>>>
>>>>>
>>>>>
>>>> This mail is scanned by Ironport
>>>>
>>>>
>>>>
>>> This mail is scanned by Ironport
>>>
>>>
>>>
>> This mail is scanned by Ironport
>>
>>
> This mail is scanned by Ironport
>
>
This mail is scanned by Ironport
_______________________________________________
Genome maillist - [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome
