I am having the same problem as Helder in a thread from last spring. I
have a Centos 5.2 box with 4GB of ram, but when I try to BLAT a small
sequence:
CATGCCATCCTGCGTCTGGACCTGGCTGGCZGGGACCTGACTGACTACCTCATGAAGATCC (Z is
the muation target)
I get the out of memory error.
needLargeMem: Out of memory - request size 154913755 bytes
Shouldn't this work on a 4GB memory machine? Is the only solution to
write a loop in the bash script to check one chromosome at a time?
One other thing. How do I get a 120mer output? I am inputting 60mer
sequences and need to extend them to 120.
-------------
Doug Wolfgram
[email protected]
_______________________________________________
Genome maillist - [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome
