Yes, run one chromosome at a time. The in-core image of blat when reading the entire genome and making the ooc index is immense. On the order of 6 to 8 Gb of memory depending upon stepSize.
--Hiram Doug Wolfgram wrote: > I am having the same problem as Helder in a thread from last spring. I > have a Centos 5.2 box with 4GB of ram, but when I try to BLAT a small > sequence: > > CATGCCATCCTGCGTCTGGACCTGGCTGGCZGGGACCTGACTGACTACCTCATGAAGATCC (Z is > the muation target) > > I get the out of memory error. > > needLargeMem: Out of memory - request size 154913755 bytes > > Shouldn't this work on a 4GB memory machine? Is the only solution to > write a loop in the bash script to check one chromosome at a time? > > One other thing. How do I get a 120mer output? I am inputting 60mer > sequences and need to extend them to 120. > > ------------- > Doug Wolfgram > [email protected] > > > > _______________________________________________ > Genome maillist - [email protected] > http://www.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
