Yes, run one chromosome at a time.  The in-core image of
blat when reading the entire genome and making the ooc index
is immense.  On the order of 6 to 8 Gb of memory depending
upon stepSize.

--Hiram

Doug Wolfgram wrote:
> I am having the same problem as Helder in a thread from last spring. I  
> have a Centos 5.2 box with 4GB of ram, but when I try to BLAT a small  
> sequence:
> 
>       CATGCCATCCTGCGTCTGGACCTGGCTGGCZGGGACCTGACTGACTACCTCATGAAGATCC   (Z is  
> the muation target)
> 
> I get the out of memory error.
> 
>       needLargeMem: Out of memory - request size 154913755 bytes
> 
> Shouldn't this work on a 4GB memory machine? Is the only solution to  
> write a loop in the bash script to check one chromosome at a time?
> 
> One other thing. How do I get a 120mer output? I am inputting 60mer  
> sequences and need to extend them to 120.
> 
> -------------
> Doug Wolfgram
> [email protected]
> 
> 
> 
> _______________________________________________
> Genome maillist  -  [email protected]
> http://www.soe.ucsc.edu/mailman/listinfo/genome
> 

_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to