oops, I meant to say .ooc and not .00c.

-Galt


On Fri, 20 Feb 2009, Galt Barber wrote:

>
> I might add that when running one chrom at a time with
> blat you can help the consistency of your results by
> making the .00c file and then using it with each
> chrom blat command.
>
> -Galt
>
>
> On Fri, 20 Feb 2009, Hiram Clawson wrote:
>
>> Yes, run one chromosome at a time.  The in-core image of
>> blat when reading the entire genome and making the ooc index
>> is immense.  On the order of 6 to 8 Gb of memory depending
>> upon stepSize.
>>
>> --Hiram
>>
>> Doug Wolfgram wrote:
>>> I am having the same problem as Helder in a thread from last spring. I
>>> have a Centos 5.2 box with 4GB of ram, but when I try to BLAT a small
>>> sequence:
>>>
>>>     CATGCCATCCTGCGTCTGGACCTGGCTGGCZGGGACCTGACTGACTACCTCATGAAGATCC   (Z is
>>> the muation target)
>>>
>>> I get the out of memory error.
>>>
>>>     needLargeMem: Out of memory - request size 154913755 bytes
>>>
>>> Shouldn't this work on a 4GB memory machine? Is the only solution to
>>> write a loop in the bash script to check one chromosome at a time?
>>>
>>> One other thing. How do I get a 120mer output? I am inputting 60mer
>>> sequences and need to extend them to 120.
>>>
>>> -------------
>>> Doug Wolfgram
>>> [email protected]
>>>
>>>
>>>
>>> _______________________________________________
>>> Genome maillist  -  [email protected]
>>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>>
>>
>> _______________________________________________
>> Genome maillist  -  [email protected]
>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>
> _______________________________________________
> Genome maillist  -  [email protected]
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>
_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to