I might add that when running one chrom at a time with blat you can help the consistency of your results by making the .00c file and then using it with each chrom blat command.
-Galt On Fri, 20 Feb 2009, Hiram Clawson wrote: > Yes, run one chromosome at a time. The in-core image of > blat when reading the entire genome and making the ooc index > is immense. On the order of 6 to 8 Gb of memory depending > upon stepSize. > > --Hiram > > Doug Wolfgram wrote: >> I am having the same problem as Helder in a thread from last spring. I >> have a Centos 5.2 box with 4GB of ram, but when I try to BLAT a small >> sequence: >> >> CATGCCATCCTGCGTCTGGACCTGGCTGGCZGGGACCTGACTGACTACCTCATGAAGATCC (Z is >> the muation target) >> >> I get the out of memory error. >> >> needLargeMem: Out of memory - request size 154913755 bytes >> >> Shouldn't this work on a 4GB memory machine? Is the only solution to >> write a loop in the bash script to check one chromosome at a time? >> >> One other thing. How do I get a 120mer output? I am inputting 60mer >> sequences and need to extend them to 120. >> >> ------------- >> Doug Wolfgram >> [email protected] >> >> >> >> _______________________________________________ >> Genome maillist - [email protected] >> http://www.soe.ucsc.edu/mailman/listinfo/genome >> > > _______________________________________________ > Genome maillist - [email protected] > http://www.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] http://www.soe.ucsc.edu/mailman/listinfo/genome
