I might add that when running one chrom at a time with
blat you can help the consistency of your results by
making the .00c file and then using it with each
chrom blat command.

-Galt


On Fri, 20 Feb 2009, Hiram Clawson wrote:

> Yes, run one chromosome at a time.  The in-core image of
> blat when reading the entire genome and making the ooc index
> is immense.  On the order of 6 to 8 Gb of memory depending
> upon stepSize.
>
> --Hiram
>
> Doug Wolfgram wrote:
>> I am having the same problem as Helder in a thread from last spring. I
>> have a Centos 5.2 box with 4GB of ram, but when I try to BLAT a small
>> sequence:
>>
>>      CATGCCATCCTGCGTCTGGACCTGGCTGGCZGGGACCTGACTGACTACCTCATGAAGATCC   (Z is
>> the muation target)
>>
>> I get the out of memory error.
>>
>>      needLargeMem: Out of memory - request size 154913755 bytes
>>
>> Shouldn't this work on a 4GB memory machine? Is the only solution to
>> write a loop in the bash script to check one chromosome at a time?
>>
>> One other thing. How do I get a 120mer output? I am inputting 60mer
>> sequences and need to extend them to 120.
>>
>> -------------
>> Doug Wolfgram
>> [email protected]
>>
>>
>>
>> _______________________________________________
>> Genome maillist  -  [email protected]
>> http://www.soe.ucsc.edu/mailman/listinfo/genome
>>
>
> _______________________________________________
> Genome maillist  -  [email protected]
> http://www.soe.ucsc.edu/mailman/listinfo/genome
>
_______________________________________________
Genome maillist  -  [email protected]
http://www.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to