Hi Zhi-Qiang,

Using the table browser and selecting "sequence" for the output will 
provide similar results to the "get DNA" feature," however, the 
advantage of the table browser is that it will allow you to obtain the 
sequences all at once using the custom track you mentioned you already 
made. The main difference you will observe in the table browser results 
stems from the fact that the table browser doesn't have the "Extended 
DNA Case/Color Options" like the "get DNA" feature does. So, with the 
table browser you'll need to intersect the custom track of your genomic 
intervals of interest with a gene prediction track. Using the table 
browser, your output will include the sequence of only the exons of the 
gene track in that region (in upper case) instead of the exons in upper 
case and the rest of the sequence in lower case as you got with the "get 
DNA" feature. Here is an example of differences between results of the 
table browser intersection and get DNA methods:

One of my regions of interest is:

chr22   20100215 20100400

Using the table browser, I intersect my custom track containing the 
chr22   20100215 20100400 region with the UCSC Genes track (the steps 
are described in detail below). For this example region, I will see 
results like this:

>hg19_ct_coords_7288_chr22.2 range=chr22:20100216-20100317 5'pad=0 3'pad=0 
>strand=+ repeatMasking=none
AGCATCTCACAGTGCGGGGTCTGCGGGAACAGGTCCACTGCCACAGCCTT
GACCGGCCGGAAGGGAATGCCCTTCACCCGGTTAGATGGGGCTCTGCAGA
GG

If I paste that same region in the genome browser, click "DNA," click 
"Extended case/color options," set "Letters per line" to 50, set 
"default case" to Lower, and select checkbox for "Toggle case" for UCSC 
Genes, and click submit, I get:

chr22:20100216-20100400
AGCATCTCACAGTGCGGGGTCTGCGGGAACAGGTCCACTGCCACAGCCTT
GACCGGCCGGAAGGGAATGCCCTTCACCCGGTTAGATGGGGCTCTGCAGA
GGctgtggggggaaaaggggggcgctaaggtcagccgataggctaatcag
gggctcctgtgggagctgggggcttggtagcaggc

You can see that the resulting sequences are identical in the areas that 
are part of the exon, but the table browser results lack the additional 
non-exon sequence following the exon. If this result type works for your 
purposes, you can follow these steps:

Load your custom track containing your genomic intervals of interest. Go 
to the table browser and select select "Custom Tracks" for the group 
followed by your track and table. To create the intersection, click the 
"create" button next to "intersection" and select a gene prediction 
track. Select "Base-pair-wise intersection (AND) of <custom track> and 
<gene track>" and click submit (note: this selection right here is why 
with this method you will not see any non-exon sequence in your table 
browser results as you had using the "get DNA" feature). For "output 
format" select "sequence" and click "get output." Make the selections 
you want and click "get sequence."

I hope this information is helpful to you! Please don't hesitate to 
contact the mail list again if you have any further questions.

Katrina Learned
UCSC Genome Bioinformatics Group

Zhi-Qiang Ye wrote, On 11/22/2010 5:10 PM:
> Hi,
>
>      I myself finally found a solution. Go to the page of genome
> browser (not table browser), paste your genomic interval in the field
> of "position or search term", then click "submit" to make the view
> located exactly in your input interval. Click "DNA" between "PCR" and
> "Convert" on the top, then use the "extended case/color options" to
> set the case/color to indicate the exon/intron information.
>
>     The shortage is that we cannot perform this in a batch.
>
>
> 2010/11/19 Zhi-Qiang Ye<[email protected]>:
>> Dear all,
>>
>>       I uploaded the genomic intervals that I am interested in as a
>> custom track, and some
>> genes partially overlap these intervals. These overlaping regions
>> (with gene structures)
>> are what I needed, but I found that I can only obtain the sequences of
>> the whole genes.
>>
>>      Is there any solutions for obtain the sequenes of overlapping
>> reigons, and the gene
>> structures still remain (e.g. exon in upper case)?
>>
>>      Thanks in advance.
>>
>> Regards,
>> ZQ
>>
> _______________________________________________
> Genome maillist  -  [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to