Hi Zhi-Qiang, Using the table browser and selecting "sequence" for the output will provide similar results to the "get DNA" feature," however, the advantage of the table browser is that it will allow you to obtain the sequences all at once using the custom track you mentioned you already made. The main difference you will observe in the table browser results stems from the fact that the table browser doesn't have the "Extended DNA Case/Color Options" like the "get DNA" feature does. So, with the table browser you'll need to intersect the custom track of your genomic intervals of interest with a gene prediction track. Using the table browser, your output will include the sequence of only the exons of the gene track in that region (in upper case) instead of the exons in upper case and the rest of the sequence in lower case as you got with the "get DNA" feature. Here is an example of differences between results of the table browser intersection and get DNA methods:
One of my regions of interest is: chr22 20100215 20100400 Using the table browser, I intersect my custom track containing the chr22 20100215 20100400 region with the UCSC Genes track (the steps are described in detail below). For this example region, I will see results like this: >hg19_ct_coords_7288_chr22.2 range=chr22:20100216-20100317 5'pad=0 3'pad=0 >strand=+ repeatMasking=none AGCATCTCACAGTGCGGGGTCTGCGGGAACAGGTCCACTGCCACAGCCTT GACCGGCCGGAAGGGAATGCCCTTCACCCGGTTAGATGGGGCTCTGCAGA GG If I paste that same region in the genome browser, click "DNA," click "Extended case/color options," set "Letters per line" to 50, set "default case" to Lower, and select checkbox for "Toggle case" for UCSC Genes, and click submit, I get: chr22:20100216-20100400 AGCATCTCACAGTGCGGGGTCTGCGGGAACAGGTCCACTGCCACAGCCTT GACCGGCCGGAAGGGAATGCCCTTCACCCGGTTAGATGGGGCTCTGCAGA GGctgtggggggaaaaggggggcgctaaggtcagccgataggctaatcag gggctcctgtgggagctgggggcttggtagcaggc You can see that the resulting sequences are identical in the areas that are part of the exon, but the table browser results lack the additional non-exon sequence following the exon. If this result type works for your purposes, you can follow these steps: Load your custom track containing your genomic intervals of interest. Go to the table browser and select select "Custom Tracks" for the group followed by your track and table. To create the intersection, click the "create" button next to "intersection" and select a gene prediction track. Select "Base-pair-wise intersection (AND) of <custom track> and <gene track>" and click submit (note: this selection right here is why with this method you will not see any non-exon sequence in your table browser results as you had using the "get DNA" feature). For "output format" select "sequence" and click "get output." Make the selections you want and click "get sequence." I hope this information is helpful to you! Please don't hesitate to contact the mail list again if you have any further questions. Katrina Learned UCSC Genome Bioinformatics Group Zhi-Qiang Ye wrote, On 11/22/2010 5:10 PM: > Hi, > > I myself finally found a solution. Go to the page of genome > browser (not table browser), paste your genomic interval in the field > of "position or search term", then click "submit" to make the view > located exactly in your input interval. Click "DNA" between "PCR" and > "Convert" on the top, then use the "extended case/color options" to > set the case/color to indicate the exon/intron information. > > The shortage is that we cannot perform this in a batch. > > > 2010/11/19 Zhi-Qiang Ye<[email protected]>: >> Dear all, >> >> I uploaded the genomic intervals that I am interested in as a >> custom track, and some >> genes partially overlap these intervals. These overlaping regions >> (with gene structures) >> are what I needed, but I found that I can only obtain the sequences of >> the whole genes. >> >> Is there any solutions for obtain the sequenes of overlapping >> reigons, and the gene >> structures still remain (e.g. exon in upper case)? >> >> Thanks in advance. >> >> Regards, >> ZQ >> > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
