Hi Zhi-Qiang, Unfortunately, we don't have a way for you to get the 'get DNA' results in a batch. I have passed on the idea of adding a batch request feature to 'get DNA' or something similar to the "Extended DNA Case/Color Options" to the table browser sequence output to our management.
Please don't hesitate to contact the mail list again if you have any further questions. Katrina Learned UCSC Genome Bioinformatics Group Zhi-Qiang Ye wrote, On 11/23/2010 5:57 PM: > Hi Katrina, > > Thank you very much for the detailed explanation. Actually, what > I want is the results of 'get DNA' in the genome browser, i.e., the > results should contain exon in upper case while the non-exon in > lower-case. > > Regards, > ZQ > > 2010/11/24 Katrina Learned<[email protected]>: >> Hi Zhi-Qiang, >> >> Using the table browser and selecting "sequence" for the output will provide >> similar results to the "get DNA" feature," however, the advantage of the >> table browser is that it will allow you to obtain the sequences all at once >> using the custom track you mentioned you already made. The main difference >> you will observe in the table browser results stems from the fact that the >> table browser doesn't have the "Extended DNA Case/Color Options" like the >> "get DNA" feature does. So, with the table browser you'll need to intersect >> the custom track of your genomic intervals of interest with a gene >> prediction track. Using the table browser, your output will include the >> sequence of only the exons of the gene track in that region (in upper case) >> instead of the exons in upper case and the rest of the sequence in lower >> case as you got with the "get DNA" feature. Here is an example of >> differences between results of the table browser intersection and get DNA >> methods: >> >> One of my regions of interest is: >> >> chr22 20100215 20100400 >> >> Using the table browser, I intersect my custom track containing the chr22 >> 20100215 20100400 region with the UCSC Genes track (the steps are described >> in detail below). For this example region, I will see results like this: >> >>> hg19_ct_coords_7288_chr22.2 range=chr22:20100216-20100317 5'pad=0 3'pad=0 >>> strand=+ repeatMasking=none >> AGCATCTCACAGTGCGGGGTCTGCGGGAACAGGTCCACTGCCACAGCCTT >> GACCGGCCGGAAGGGAATGCCCTTCACCCGGTTAGATGGGGCTCTGCAGA >> GG >> >> If I paste that same region in the genome browser, click "DNA," click >> "Extended case/color options," set "Letters per line" to 50, set "default >> case" to Lower, and select checkbox for "Toggle case" for UCSC Genes, and >> click submit, I get: >> >> chr22:20100216-20100400 >> AGCATCTCACAGTGCGGGGTCTGCGGGAACAGGTCCACTGCCACAGCCTT >> GACCGGCCGGAAGGGAATGCCCTTCACCCGGTTAGATGGGGCTCTGCAGA >> GGctgtggggggaaaaggggggcgctaaggtcagccgataggctaatcag >> gggctcctgtgggagctgggggcttggtagcaggc >> >> You can see that the resulting sequences are identical in the areas that are >> part of the exon, but the table browser results lack the additional non-exon >> sequence following the exon. If this result type works for your purposes, >> you can follow these steps: >> >> Load your custom track containing your genomic intervals of interest. Go to >> the table browser and select select "Custom Tracks" for the group followed >> by your track and table. To create the intersection, click the "create" >> button next to "intersection" and select a gene prediction track. Select >> "Base-pair-wise intersection (AND) of<custom track> and<gene track>" and >> click submit (note: this selection right here is why with this method you >> will not see any non-exon sequence in your table browser results as you had >> using the "get DNA" feature). For "output format" select "sequence" and >> click "get output." Make the selections you want and click "get sequence." >> >> I hope this information is helpful to you! Please don't hesitate to contact >> the mail list again if you have any further questions. >> >> Katrina Learned >> UCSC Genome Bioinformatics Group >> _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
