Hi Katrina,

     Thank you very much for the detailed explanation. Actually, what
I want is the results of 'get DNA' in the genome browser, i.e., the
results should contain exon in upper case while the non-exon in
lower-case.

Regards,
ZQ

2010/11/24 Katrina Learned <[email protected]>:
> Hi Zhi-Qiang,
>
> Using the table browser and selecting "sequence" for the output will provide
> similar results to the "get DNA" feature," however, the advantage of the
> table browser is that it will allow you to obtain the sequences all at once
> using the custom track you mentioned you already made. The main difference
> you will observe in the table browser results stems from the fact that the
> table browser doesn't have the "Extended DNA Case/Color Options" like the
> "get DNA" feature does. So, with the table browser you'll need to intersect
> the custom track of your genomic intervals of interest with a gene
> prediction track. Using the table browser, your output will include the
> sequence of only the exons of the gene track in that region (in upper case)
> instead of the exons in upper case and the rest of the sequence in lower
> case as you got with the "get DNA" feature. Here is an example of
> differences between results of the table browser intersection and get DNA
> methods:
>
> One of my regions of interest is:
>
> chr22   20100215 20100400
>
> Using the table browser, I intersect my custom track containing the chr22
> 20100215 20100400 region with the UCSC Genes track (the steps are described
> in detail below). For this example region, I will see results like this:
>
>> hg19_ct_coords_7288_chr22.2 range=chr22:20100216-20100317 5'pad=0 3'pad=0
>> strand=+ repeatMasking=none
>
> AGCATCTCACAGTGCGGGGTCTGCGGGAACAGGTCCACTGCCACAGCCTT
> GACCGGCCGGAAGGGAATGCCCTTCACCCGGTTAGATGGGGCTCTGCAGA
> GG
>
> If I paste that same region in the genome browser, click "DNA," click
> "Extended case/color options," set "Letters per line" to 50, set "default
> case" to Lower, and select checkbox for "Toggle case" for UCSC Genes, and
> click submit, I get:
>
> chr22:20100216-20100400
> AGCATCTCACAGTGCGGGGTCTGCGGGAACAGGTCCACTGCCACAGCCTT
> GACCGGCCGGAAGGGAATGCCCTTCACCCGGTTAGATGGGGCTCTGCAGA
> GGctgtggggggaaaaggggggcgctaaggtcagccgataggctaatcag
> gggctcctgtgggagctgggggcttggtagcaggc
>
> You can see that the resulting sequences are identical in the areas that are
> part of the exon, but the table browser results lack the additional non-exon
> sequence following the exon. If this result type works for your purposes,
> you can follow these steps:
>
> Load your custom track containing your genomic intervals of interest. Go to
> the table browser and select select "Custom Tracks" for the group followed
> by your track and table. To create the intersection, click the "create"
> button next to "intersection" and select a gene prediction track. Select
> "Base-pair-wise intersection (AND) of <custom track> and <gene track>" and
> click submit (note: this selection right here is why with this method you
> will not see any non-exon sequence in your table browser results as you had
> using the "get DNA" feature). For "output format" select "sequence" and
> click "get output." Make the selections you want and click "get sequence."
>
> I hope this information is helpful to you! Please don't hesitate to contact
> the mail list again if you have any further questions.
>
> Katrina Learned
> UCSC Genome Bioinformatics Group
>

_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to