Hello, I have a question about the pegas haplotype algorithm and would be grateful if someone could explain.
I used pegas haplotype() on a set of sequences. I then manually aligned and looked at the sequences within each haplotype. For one haplotype I noticed something odd (see image below) Although there was a single bp difference at the highlighted position ,these sequences had all been assigned as one haplotype. I understand that for the 3rd sequence because there are gaps at this highlighted position this can lead it to be pooled with others, but I do not understand how sequence 1 and 2 can be in the same haplotype? I would be grateful for any guidance, GBSP11539-19|Ophlitaspon[1] AATACTGCATTTTTTGACCCTGCAGGGGGAGGAGACCCCATTTTATATCAACATTTATTT 660 GBSP11518-19|Ophlitaspon[2] AATACTGCATTTTTTGACCCTGCGGGGGGAGGAGACCCCATTTTA--------------- 645 GBSP11504-19|Ophlitaspon[3] AATACTGCAT-------------------------------------------------- 580 GBSP11512-19|Ophlitaspon[4] AATACTGCATTTTTTGACCCTGCAGGGGGAGGAGACCCATTTATATCACTTTATTTGTT- 659 ********** Best wishes Hirra University of Manchester Student. [[alternative HTML version deleted]] _______________________________________________ R-sig-phylo mailing list - R-sig-phylo@r-project.org https://stat.ethz.ch/mailman/listinfo/r-sig-phylo Searchable archive at http://www.mail-archive.com/r-sig-phylo@r-project.org/