Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Sahil Batra]

Agreed! False-positives would be less likely in this pandemic situation,
although I am not sure about the predominance of - and similarity with -
other common cold-causing coronaviruses.

Regards,
Sahil Batra

On Thu, Apr 2, 2020 at 9:03 AM Nagarajan V  wrote:

> This is only a theoretical distinction, isn’t it, given that it’s CoV2
> that is predominant right now?
>
> V. Nagarajan
>
> On Tue, Mar 31, 2020 at 11:56 PM Sahil Batra  wrote:
>
>> Dear Prof. Holton,
>>
>> An innovative idea; however all of the 30 kb genome may not be useful for
>> specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity.
>>
>> A similar fluorescent detection approach for SARS Cov2 -- using the
>> indiscriminate collateral activity of Cas12 nuclease -- has been reported
>> here:
>> https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf
>> Although not tested on samples from patients.
>>
>> Regards,
>> Sahil Batra
>> PhD candidate, IIT Kanpur
>>
>> On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch  wrote:
>>
>>> One problem I see is the sputum, there’s a reason why swabs are made to
>>> get sufficient viral material.
>>>
>>> Since stool samples test PCR positive that might be an easier approach
>>> to get sufficient viral material. As a side note, these are not infectious
>>> anymore, or at least one has not been able to infect tissue cultures from
>>> stool samples.
>>>
>>> It’s worth a thought, I’ll need to read those papers you referenced.
>>>
>>> I believe I read a suitable preprint for viral load, will search for it
>>> tomorrow.
>>>
>>> Jürgen
>>>
>>>
>>>
>>>
>>> __
>>> Jürgen Bosch, Ph.D.
>>> Division of Pediatric Pulmonology and Allergy/Immunology
>>> Case Western Reserve University
>>> 2109 Adelbert Rd, BRB 835
>>> Cleveland, OH 44106
>>> Phone: 216.368.7565
>>> Fax: 216.368.4223
>>>
>>> CEO & Co-Founder at InterRayBio, LLC
>>>
>>> Johns Hopkins University
>>> Bloomberg School of Public Health
>>> Department of Biochemistry & Molecular Biology
>>>
>>> On Apr 1, 2020, at 00:50, James Holton  wrote:
>>>
>>> In order to do global survelinace of this new virus I figure we're
>>> going
>>> to need billions of tests.  The biggest barriers I believe are
>>> logistical.  Shipping back and forth to a central labs isn't going to
>>> cut it, and neither are test kits that cost $800 each.
>>>
>>> I think I may have a plausible way forward to a low-cost and easily
>>> mass-produced test for the SARS-CoV-2 virus using mostly items people
>>> already have, such as smartphones. The most expensive reagent required
>>> will be labeled oligos, but those scale very well.
>>>
>>> The key observation is that smartphones can detect as few as 1e6
>>> particles/mL if they do long exposures (180s).  This was using
>>> bioluminescence. Reported here:
>>> https://www.nature.com/articles/srep40203.pdf
>>>
>>> The other side of that coin is the expected titer of the virus in
>>> sputum.  I don't know of any reports for SARS-CoV-2 itself, but for four
>>> other respiratory viruses, including one coronavirus, it ranges from 1e6
>>> to 1e8 particles/mL :
>>> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/
>>>
>>> This is encouraging!  The challenge will be to detect viral genomes in
>>> "the field" without sophisticated lab equipment like a PCR machine,
>>> lasers, 3D printers, etc.  The concentration will be 1e-15 M, a
>>> challenge, but then again we can detect single molecules using
>>> fluorescence. The questions are:
>>> 1) can we get the background low enough so that the dark current of the
>>> camera dominates
>>> 2) can we make the signal high enough to overcome the dark current.
>>>
>>> 1) will depend on the availability of mass-produced filter technology.
>>> However, the best filter may simply be time.  Provided the fluorophore
>>> lifetime is long enough and the camera synchronization tight enough one
>>> could simply measure the "afterglow" after the camera flash has turned
>>> off.  An interesting candidate is europium. Most fluorophores decay in
>>> nanoseconds, but lanthanides can be microseconds to milliseconds.  In
>>> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04.
>>> Those decay over minutes to hours.  What I'm not sure about is using
>>> them for FRET. I would appreciate input on experience with this.
>>>
>>> 2) I believe signal could be enhanced by using very luminous tags (such
>>> as quantum dots), and/or by using multiple tags per genome. This virus
>>> has the largest RNA genome known to date at 30 kbases. That means there
>>> is room for up to 2000 15-mer tags, each with its own label. The set-up
>>> cost for doing ~2000 oligo synthesis reactions will be high, but it can
>>> be done at scale.  You only need ~2 fmol of each oligo, 10 umol
>>> synthesis is about $1k, so I estimate about $1 per test using 1000
>>> different oligos. This price point will be important if we want to make
>>> billions of tests to be used all over the world.  In 

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Nagarajan V]

This is only a theoretical distinction, isn’t it, given that it’s CoV2 that
is predominant right now?

V. Nagarajan

On Tue, Mar 31, 2020 at 11:56 PM Sahil Batra  wrote:

> Dear Prof. Holton,
>
> An innovative idea; however all of the 30 kb genome may not be useful for
> specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity.
>
> A similar fluorescent detection approach for SARS Cov2 -- using the
> indiscriminate collateral activity of Cas12 nuclease -- has been reported
> here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf
> Although not tested on samples from patients.
>
> Regards,
> Sahil Batra
> PhD candidate, IIT Kanpur
>
> On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch  wrote:
>
>> One problem I see is the sputum, there’s a reason why swabs are made to
>> get sufficient viral material.
>>
>> Since stool samples test PCR positive that might be an easier approach to
>> get sufficient viral material. As a side note, these are not infectious
>> anymore, or at least one has not been able to infect tissue cultures from
>> stool samples.
>>
>> It’s worth a thought, I’ll need to read those papers you referenced.
>>
>> I believe I read a suitable preprint for viral load, will search for it
>> tomorrow.
>>
>> Jürgen
>>
>>
>>
>>
>> __
>> Jürgen Bosch, Ph.D.
>> Division of Pediatric Pulmonology and Allergy/Immunology
>> Case Western Reserve University
>> 2109 Adelbert Rd, BRB 835
>> Cleveland, OH 44106
>> Phone: 216.368.7565
>> Fax: 216.368.4223
>>
>> CEO & Co-Founder at InterRayBio, LLC
>>
>> Johns Hopkins University
>> Bloomberg School of Public Health
>> Department of Biochemistry & Molecular Biology
>>
>> On Apr 1, 2020, at 00:50, James Holton  wrote:
>>
>> In order to do global survelinace of this new virus I figure we're
>> going
>> to need billions of tests.  The biggest barriers I believe are
>> logistical.  Shipping back and forth to a central labs isn't going to
>> cut it, and neither are test kits that cost $800 each.
>>
>> I think I may have a plausible way forward to a low-cost and easily
>> mass-produced test for the SARS-CoV-2 virus using mostly items people
>> already have, such as smartphones. The most expensive reagent required
>> will be labeled oligos, but those scale very well.
>>
>> The key observation is that smartphones can detect as few as 1e6
>> particles/mL if they do long exposures (180s).  This was using
>> bioluminescence. Reported here:
>> https://www.nature.com/articles/srep40203.pdf
>>
>> The other side of that coin is the expected titer of the virus in
>> sputum.  I don't know of any reports for SARS-CoV-2 itself, but for four
>> other respiratory viruses, including one coronavirus, it ranges from 1e6
>> to 1e8 particles/mL :
>> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/
>>
>> This is encouraging!  The challenge will be to detect viral genomes in
>> "the field" without sophisticated lab equipment like a PCR machine,
>> lasers, 3D printers, etc.  The concentration will be 1e-15 M, a
>> challenge, but then again we can detect single molecules using
>> fluorescence. The questions are:
>> 1) can we get the background low enough so that the dark current of the
>> camera dominates
>> 2) can we make the signal high enough to overcome the dark current.
>>
>> 1) will depend on the availability of mass-produced filter technology.
>> However, the best filter may simply be time.  Provided the fluorophore
>> lifetime is long enough and the camera synchronization tight enough one
>> could simply measure the "afterglow" after the camera flash has turned
>> off.  An interesting candidate is europium. Most fluorophores decay in
>> nanoseconds, but lanthanides can be microseconds to milliseconds.  In
>> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04.
>> Those decay over minutes to hours.  What I'm not sure about is using
>> them for FRET. I would appreciate input on experience with this.
>>
>> 2) I believe signal could be enhanced by using very luminous tags (such
>> as quantum dots), and/or by using multiple tags per genome. This virus
>> has the largest RNA genome known to date at 30 kbases. That means there
>> is room for up to 2000 15-mer tags, each with its own label. The set-up
>> cost for doing ~2000 oligo synthesis reactions will be high, but it can
>> be done at scale.  You only need ~2 fmol of each oligo, 10 umol
>> synthesis is about $1k, so I estimate about $1 per test using 1000
>> different oligos. This price point will be important if we want to make
>> billions of tests to be used all over the world.  In some countries $1
>> is a lot.
>>
>> The detection strategy I am focusing on is FRET.  That is, oligos would
>> be made in pairs, recognizing abutting sections of the viral genome.
>> Like this:
>> 5'  atttcgctgatc-ATTO465 ATTO550-cattatcagacaagt  3'
>> which would anneal to one of the current CDC test primer sites:
>> 3' taaagcgactaggtaatagtctgttca 5'

Re: [ccp4bb] New phasing approach

[Rosenbaum, Gerold]

The x-ray interferometer is not a joke. In about 1974, Gerd Materlik built one 
for his thesis and inserted it in front of my beamline at the DESY synchrotron. 
The beam splitters and "mirrors" were all carved out of a single block of 
perfect single crystal silicon. He inserted a wedge of plastic in one arm 
acting as a phase shifter and produced dark and white bands in a film. I was 
really, really impressed.

As for the three-beam experiments by Edgar Weckert and K. Hümmer, carried on by 
Bob Sweet, as impressive it is to get precise phase measurements for a 
reflection, there is a practical downsided: the radiation dose for measuring 
one reflection to a few % is as high as the dose for a whole data set from 
which we conventionally extract the phases of all reflection though only at 
about 30% but still good enough to solve the structure.

I have the inkling that Bernhard's phase retrieval would suffer the same death: 
only the ultra-parallel fraction of the x-ray beam passes through the 
interferometer cutting down tremendously the intensity of reflections from 
macromolecular crystals which tend to be far from parallel.

Gerd

On 01.04.2020, 16:02, "CCP4 bulletin board on behalf of Tim Gruene" 
 wrote:

Dear Bernhard,

your paper is actually not so much of a joke. Are you aware of K. Huemmer's 
and E. Weckert's three-beam experiments? See e.g. 

https://link.springer.com/chapter/10.1007/978-1-4615-5879-8_24

Best regards,
Tim

On Wednesday, April 1, 2020 4:00:19 AM CEST Bernhard Rupp wrote:
> Hi Fellows,
> 
> 
> 
> just in time for a little reading during quarantine-induced boredom here
> preprint pages
> 
> (embargoed until 04.01) from my recent Phys. Rev. paper with a different
> take on phasing
> 
> https://tinyurl.com/Phys-Rev-2020
> 
> 
> 
> Enjoy, BR
> 
> --
> 
> Bernhard Rupp
> 
>   http://www.hofkristallamt.org/
> 
>   b...@hofkristallamt.org
> 
> +1 925 209 7429
> 
> --
> 
> Department of Genetic Epidemiology
> 
> Medical University Innsbruck
> 
> Schöpfstr. 41
> 
> A 6020 Innsbruck
> 
>   bernhard.r...@i-med.ac.at
> 
> +43 676 571 0536
> 
> --
> 
> Many plausible ideas vanish
> 
> at the presence of thought
> 
> --
> 
> 
> 
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

-- 
--
Tim Gruene
Head of the Centre for X-ray Structure Analysis
Faculty of Chemistry
University of Vienna

Phone: +43-1-4277-70202

GPG Key ID = A46BEE1A



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1





To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] COVID-19 protease inhibitors - 2nd call for designs - Thurs midnight

[Nicholas Larsen]

Hi Frank, I thought we were working quickly, but we only just got all of
your structures uploaded in our Proasis system today and can only now begin
analysis and design ideas.  I don't know if we will have much of anything
by your deadline.  Will there be additional design rounds?  Thanks again
for making all this data available and it really is inspirational what your
team is doing to confront collaboratively this global crisis.
Best,
Nick

On Wed, Apr 1, 2020 at 10:16 AM Frank von Delft 
wrote:

> All - last week's call for compound designs to the CoV-2 main protease (
> https://covid.postera.ai/covid)
> elicited an astonishing response...  (I confess I was quite taken aback.)
>
> I just realised I should let this BB know the second call for designs is
> now open.  *Deadline is tomorrow 23:59 PST (April 2nd).  *(Apologies for
> those that weren't following on twitter.)
>
> Two things:
>
>- we're asking for designs especially focusing on covalent inhibitors (read
>more here
>
> 
>)
>- the most convincing designs will be fast-tracked by spending more
>money to cut several weeks off the testing (read more here
>
> 
>)
>
> Happy designing!
> Frank
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>

-- 
[This e-mail message may contain privileged, confidential and/or 
proprietary information of H3 Biomedicine. If you believe that it has been 
sent to you in error, please contact the sender immediately and delete the 
message including any attachments, without copying, using, or distributing 
any of the information contained therein. This e-mail message should not be 
interpreted to include a digital or electronic signature that can be used 
to authenticate an agreement, contract or other legal document, nor to 
reflect an intention to be bound to any legally-binding agreement or 
contract.]



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] New phasing approach

[Tim Gruene]

Dear Bernhard,

your paper is actually not so much of a joke. Are you aware of K. Huemmer's 
and E. Weckert's three-beam experiments? See e.g. 

https://link.springer.com/chapter/10.1007/978-1-4615-5879-8_24

Best regards,
Tim

On Wednesday, April 1, 2020 4:00:19 AM CEST Bernhard Rupp wrote:
> Hi Fellows,
> 
> 
> 
> just in time for a little reading during quarantine-induced boredom here
> preprint pages
> 
> (embargoed until 04.01) from my recent Phys. Rev. paper with a different
> take on phasing
> 
> https://tinyurl.com/Phys-Rev-2020
> 
> 
> 
> Enjoy, BR
> 
> --
> 
> Bernhard Rupp
> 
>   http://www.hofkristallamt.org/
> 
>   b...@hofkristallamt.org
> 
> +1 925 209 7429
> 
> --
> 
> Department of Genetic Epidemiology
> 
> Medical University Innsbruck
> 
> Schöpfstr. 41
> 
> A 6020 Innsbruck
> 
>   bernhard.r...@i-med.ac.at
> 
> +43 676 571 0536
> 
> --
> 
> Many plausible ideas vanish
> 
> at the presence of thought
> 
> --
> 
> 
> 
> 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

-- 
--
Tim Gruene
Head of the Centre for X-ray Structure Analysis
Faculty of Chemistry
University of Vienna

Phone: +43-1-4277-70202

GPG Key ID = A46BEE1A



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1


signature.asc
Description: This is a digitally signed message part.

Re: [ccp4bb] COVID-19 protease inhibitors - 2nd call for designs - Thurs midnight

[Tim Gruene]

Dear Jurgen,

https://lmgtfy.com/?q=ccp4+twitter

do you need more?

Best,
Tim

On Wednesday, April 1, 2020 5:19:13 PM CEST Jurgen Bosch wrote:
> #theBB is too slow :-), Honestly, we probably should have an official CCP4BB
> Twitter account monitored by a few administrators to post relevant things
> more publicly - just a thought.
> 
> Thanks for the update and good to know it’s moving forward fast.
> I had to renew my license for a software I use for shape complementarity
> searches, so I have not been able yet to contribute, but I reached out to
> my MedChem friends and made them aware of it. Even if they can’t synthesize
> stuff right now because we are mostly shut down, they can use their brains
> to make suggestions.
> 
> Jürgen
> 
> > On Apr 1, 2020, at 10:15 AM, Frank von Delft 
> > wrote:
> > 
> > All - last week's call for compound designs to the CoV-2 main protease
> > (https://covid.postera.ai/covid )
> > elicited an astonishing response...  (I confess I was quite taken aback.)
> > 
> > I just realised I should let this BB know the second call for designs is
> > now open.  Deadline is tomorrow 23:59 PST (April 2nd).  (Apologies for
> > those that weren't following on twitter.)
> > 
> > Two things:
> > we're asking for designs especially focusing on covalent inhibitors (read
> > more here
> >  > ack-of-designs/567>) the most convincing designs will be fast-tracked by
> > spending more money to cut several weeks off the testing (read more here
> >  > ack-of-designs/567>) Happy designing!
> > 
> > Frank
> > 
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> > 
> 
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

-- 
--
Tim Gruene
Head of the Centre for X-ray Structure Analysis
Faculty of Chemistry
University of Vienna

Phone: +43-1-4277-70202

GPG Key ID = A46BEE1A



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1


signature.asc
Description: This is a digitally signed message part.

Re: [ccp4bb] [EXTERNAL] Re: [ccp4bb] New phasing approach

[Edward Berry]

Bear in mind that position of the interferometer mirror or whatever 
would have to be constant to within a fraction of an Angstrom- breathe 
on the frame and it will warm ever so slightly- the expansion will
change the 
phase of the reference beam by a few thousand wavelengths. A real 
engineering challenge!




>>> "Daniel M. Himmel, Ph. D."  04/01/20 11:17
AM >>>
That's fascinating!  Can such an interferometer actually be constructed
for an
X-ray beam line or is this still in the realm of the theoretical
possible?


Daniel
 ___
 Daniel M. Himmel, Ph. D.
 E-mail:  danielmhim...@gmail.com







On Tue, Mar 31, 2020 at 10:01 PM Bernhard Rupp
 wrote:

Hi Fellows,
 
just in time for a little reading during quarantine-induced boredom here
preprint pages 
(embargoed until 04.01) from my recent Phys. Rev. paper with a different
take on phasing
https://tinyurl.com/Phys-Rev-2020
 
Enjoy, BR
--
Bernhard Rupp
http://www.hofkristallamt.org/
b...@hofkristallamt.org
+1 925 209 7429
--
Department of Genetic Epidemiology
Medical University Innsbruck
Schöpfstr. 41
A 6020 Innsbruck
bernhard.r...@i-med.ac.at
+43 676 571 0536
--
Many plausible ideas vanish 
at the presence of thought
--
 


 
  To unsubscribe from the CCP4BB list, click the following link:
 https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 

 
  To unsubscribe from the CCP4BB list, click the following link:
 https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
 




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Paired refinement proves data quality goes beyond the spatial limits of the detector

[Phoebe A. Rice]

This advance brings deep new meaning to crystallographic data having both a 
real and an imaginary component!

On 3/31/20, 11:36 PM, "CCP4 bulletin board on behalf of Petr Kolenko" 
 wrote:

Dear colleagues,
We, the developers of a program for paired refinement, have found a 
remarkable feature that should be shared with the community. The fact that data 
beyond the arbitrary cutoff may cause an improvement of electron density and 
make your models better is generally accepted. We found now that the data 
beyond the dimensions of the detector are still useful, should be used in 
refinement, deposited in your structure factor file and if possible, made 
publicly available in data repositories as well! This leads us to a general 
recommendation, please deposit your raw data including regions beyond the 
detector edge or better the corner.  Share the maximum available and be FAIR.
Stay safe, best regards,
Petr



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1





To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] COVID-19 protease inhibitors - 2nd call for designs - Thurs midnight

[Jurgen Bosch]

#theBB is too slow :-), Honestly, we probably should have an official CCP4BB 
Twitter account monitored by a few administrators to post relevant things more 
publicly - just a thought.

Thanks for the update and good to know it’s moving forward fast.
I had to renew my license for a software I use for shape complementarity 
searches, so I have not been able yet to contribute, but I reached out to my 
MedChem friends and made them aware of it. Even if they can’t synthesize stuff 
right now because we are mostly shut down, they can use their brains to make 
suggestions.

Jürgen  

> On Apr 1, 2020, at 10:15 AM, Frank von Delft  
> wrote:
> 
> All - last week's call for compound designs to the CoV-2 main protease 
> (https://covid.postera.ai/covid )
> elicited an astonishing response...  (I confess I was quite taken aback.)
> 
> I just realised I should let this BB know the second call for designs is now 
> open.  Deadline is tomorrow 23:59 PST (April 2nd).  (Apologies for those that 
> weren't following on twitter.)
> 
> Two things:  
> we're asking for designs especially focusing on covalent inhibitors (read 
> more here 
> )
> the most convincing designs will be fast-tracked by spending more money to 
> cut several weeks off the testing (read more here 
> )
> Happy designing!  
> 
> Frank
> 
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1 
> 



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] New phasing approach

[Daniel M. Himmel, Ph. D.]

That's fascinating!  Can such an interferometer actually be constructed for
an
X-ray beam line or is this still in the realm of the theoretical possible?

Daniel

___

Daniel M. Himmel, Ph. D.

E-mail:  danielmhim...@gmail.com


On Tue, Mar 31, 2020 at 10:01 PM Bernhard Rupp 
wrote:

> Hi Fellows,
>
>
>
> just in time for a little reading during quarantine-induced boredom here
> preprint pages
>
> (embargoed until 04.01) from my recent Phys. Rev. paper with a different
> take on phasing
>
> https://tinyurl.com/Phys-Rev-2020
>
>
>
> Enjoy, BR
>
> --
>
> Bernhard Rupp
>
> http://www.hofkristallamt.org/
>
> b...@hofkristallamt.org
>
> +1 925 209 7429
>
> --
>
> Department of Genetic Epidemiology
>
> Medical University Innsbruck
>
> Schöpfstr. 41
>
> A 6020 Innsbruck
>
> *bernhard.r...@i-med.ac.at *
>
> +43 676 571 0536
>
> --
>
> Many plausible ideas vanish
>
> at the presence of thought
>
> --
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Paired refinement proves data quality goes beyond the spatial limits of the detector

[James Holton]

NMR spectroscopists are ~50 years ahead of us on this.  They call it 
"zero filling".  Fortunately, these extra data compress very well.


-James Holton
MAD Scientist

On 3/31/2020 9:36 PM, Petr Kolenko wrote:

Dear colleagues,
We, the developers of a program for paired refinement, have found a remarkable 
feature that should be shared with the community. The fact that data beyond the 
arbitrary cutoff may cause an improvement of electron density and make your 
models better is generally accepted. We found now that the data beyond the 
dimensions of the detector are still useful, should be used in refinement, 
deposited in your structure factor file and if possible, made publicly 
available in data repositories as well! This leads us to a general 
recommendation, please deposit your raw data including regions beyond the 
detector edge or better the corner.  Share the maximum available and be FAIR.
Stay safe, best regards,
Petr



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

[ccp4bb] COVID-19 protease inhibitors - 2nd call for designs - Thurs midnight

[Frank von Delft]

All - last week's call for compound designs to the CoV-2 main protease 
(https://covid.postera.ai/covid)

elicited an astonishing response...  (I confess I was quite taken aback.)

I just realised I should let this BB know the second call for designs is 
now open. *Deadline is tomorrow 23:59 PST (April 2nd). *(Apologies for 
those that weren't following on twitter.)*


*Two things:

 * we're asking for designs especially focusing on covalent inhibitors
   (read more here
   
)
 * the most convincing designs will be fast-tracked by spending more
   money to cut several weeks off the testing (read more here
   
)

Happy designing!

Frank



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Change map handedness

[Andre LB Ambrosio]

Thank you all very much for the responses! Yes, what I wanted to do was to
flip the volume of the map along the z-axis. Eleanor's solution worked
perfectly.
Best wishes and stay safe.


Em qua., 1 de abr. de 2020 às 10:56, Ian Tickle 
escreveu:

>
> A file does not have a handedness, it's just a list of numbers.  So the
> pedantic answer is that since it doesn't have a handedness you need do
> nothing to change it!
>
> I assume that what you mean is that you want to change the handedness of
> the _visual interpretation_ of the file.  That's a different story
> altogether since it involves your own visual perception!
>
> Eleanor's trick with the phases will do it if you then view the map in the
> same way as you were doing before.
>
> Or you could keep the file the same and view a mirror image of the map.
> Eugene has already suggested using a mirror which reverses either the X or
> Y axis depending on where you place the mirror.
>
> The obvious and interesting alternative is to reverse the Z axis.  In the
> days when we plotted maps on a stack of transparent sheets it was easy: you
> just reversed the order of the sheets!  In fact you had to do exactly that
> since the plastic molecular model was viewed in a half-silvered mirror
> placed in front of the map ("Richard's box", a.k.a. "Fred's Folly":
> https://en.wikipedia.org/wiki/Frederic_M._Richards ).
>
> Now a computer screen being a 2-D object obviously doesn't have a Z axis
> so you can't reverse it!  However we get the _impression_ of depth in our
> brain by using stereo or depth cueing, so you would need to reverse one of
> those (maybe a switch on the glasses controller?).
>
> Depth cueing is obtained by having objects that are supposed to be nearer
> to you brighter than ones that are supposed to be further away.  So all
> need to do is convince your brain that the opposite is true!
>
> Note that all the solutions that reverse the image of the map will also
> reverse the image of the structure which may not be what you want.  In that
> case Eleanor's solution which results in only reversing the image of the
> map is probably the right one.
>
> Oh and happy April 1st to all!
>
> Cheers
>
> -- Ian
>
>
> On Wed, 1 Apr 2020 at 13:56, Andre LB Ambrosio  wrote:
>
>> Dear all,
>> is it possible to generate a mirror image of an existing .ccp4 map file?
>> Many thanks in advance.
>>
>> --
>> Andre LB Ambrosio
>>
>> --
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>>
>

-- 
Andre LB Ambrosio



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

[ccp4bb] New PDBe-KB COVID-19 Macromolecular Structure Data Portal

[John Berrisford]

An unprecedented number of scientific efforts are taking place worldwide
in order to help combat the new coronavirus epidemic (COVID-19). One of
the biggest challenges in this fast-moving situation is to share data
and findings in a coordinated way, in order to understand the disease
and to develop treatments and vaccines.

To support research efforts to understand more about the 2019-nCoV virus
and the structures of its proteins, we have created dedicated PDBe-KB
pages to highlight important structural features of released PDB
entries. These pages highlight the ligand binding sites and residues
involved in protein-protein interactions, to help researchers easily
identify common features from all the available structure data.

Over the coming weeks we will further expand the functionality of these
pages, in order to make more relevant structural biology data available
for researchers. We would also appreciate your feedback so that we can
learn what is most useful for users and how we can implement more functionality.

To view the PDBe-KB COVID-19 Data Portal, please visit PDBe.org/covid19

In addition to these pages, EMBL-EBI has set up the COVID-19 Portal
(https://www.ebi.ac.uk/covid-19), which will bring together all relevant
datasets submitted to EMBL-EBI and other major centres for biomedical
data. The aim is to facilitate data sharing and analysis, and to
accelerate coronavirus research.

Kinds regards

John


John Berrisford
PDBe
+44 1223 492529
European Bioinformatics Institute (EMBL-EBI) European Molecular Biology
Laboratory Wellcome Trust Genome Campus Hinxton Cambridge CB10 1SD UK
https://www.pdbe.org



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Change map handedness

[Ian Tickle]

A file does not have a handedness, it's just a list of numbers.  So the
pedantic answer is that since it doesn't have a handedness you need do
nothing to change it!

I assume that what you mean is that you want to change the handedness of
the _visual interpretation_ of the file.  That's a different story
altogether since it involves your own visual perception!

Eleanor's trick with the phases will do it if you then view the map in the
same way as you were doing before.

Or you could keep the file the same and view a mirror image of the map.
Eugene has already suggested using a mirror which reverses either the X or
Y axis depending on where you place the mirror.

The obvious and interesting alternative is to reverse the Z axis.  In the
days when we plotted maps on a stack of transparent sheets it was easy: you
just reversed the order of the sheets!  In fact you had to do exactly that
since the plastic molecular model was viewed in a half-silvered mirror
placed in front of the map ("Richard's box", a.k.a. "Fred's Folly":
https://en.wikipedia.org/wiki/Frederic_M._Richards ).

Now a computer screen being a 2-D object obviously doesn't have a Z axis so
you can't reverse it!  However we get the _impression_ of depth in our
brain by using stereo or depth cueing, so you would need to reverse one of
those (maybe a switch on the glasses controller?).

Depth cueing is obtained by having objects that are supposed to be nearer
to you brighter than ones that are supposed to be further away.  So all
need to do is convince your brain that the opposite is true!

Note that all the solutions that reverse the image of the map will also
reverse the image of the structure which may not be what you want.  In that
case Eleanor's solution which results in only reversing the image of the
map is probably the right one.

Oh and happy April 1st to all!

Cheers

-- Ian


On Wed, 1 Apr 2020 at 13:56, Andre LB Ambrosio  wrote:

> Dear all,
> is it possible to generate a mirror image of an existing .ccp4 map file?
> Many thanks in advance.
>
> --
> Andre LB Ambrosio
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Change map handedness

[Fischmann, Thierry]

Also if you have Chimera installed:
http://plato.cgl.ucsf.edu/pipermail/chimera-users/2011-December/006999.html

Thierry

From: CCP4 bulletin board  On Behalf Of Eleanor Dodson
Sent: Wednesday, April 1, 2020 9:00 AM
To: CCP4BB@JISCMAIL.AC.UK
Subject: Re: [ccp4bb] Change map handedness

EXTERNAL EMAIL – Use caution with any links or file attachments.
Easiest to multiply phases by -1. and recalculate mapl. Sftools  can do that to 
your mtz

On Wed, 1 Apr 2020 at 13:56, Andre LB Ambrosio 
mailto:an...@ifsc.usp.br>> wrote:
Dear all,
is it possible to generate a mirror image of an existing .ccp4 map file?
Many thanks in advance.


--
Andre LB Ambrosio



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
Notice:  This e-mail message, together with any attachments, contains
information of Merck & Co., Inc. (2000 Galloping Hill Road, Kenilworth,
New Jersey, USA 07033), and/or its affiliates Direct contact information
for affiliates is available at 
http://www.merck.com/contact/contacts.html) that may be confidential,
proprietary copyrighted and/or legally privileged. It is intended solely
for the use of the individual or entity named on this message. If you are
not the intended recipient, and have received this message in error,
please notify us immediately by reply e-mail and then delete it from 
your system.




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] CCP4i2 Text size

[Stuart McNicholas]

Dear Sam,
   Please try:

Edit->preferences

The default tab on the preferences widget should be "Task interface". This
has font size options, after picking a bigger number, click Apply.

This may not fix all problems, but should  make things better.

Best wishes,
Stuart


On Wed, 1 Apr 2020 at 14:08, Horrell, Sam (DLSLtd,RAL,LSCI) <
sam.horr...@diamond.ac.uk> wrote:

> Hello CCP4bb,
>
>
>
> I’m having a minor problem with CCP4i2 and my 4k screen. Mainly that the
> text is tiny and I can’t find a way to increase it without increasing the
> size of the text for all other apps. Is there a setting I’m not finding or
> is this a known problem?
>
>
>
> Cheers,
>
>
>
> Sam
>
>
>
> --
>
> This e-mail and any attachments may contain confidential, copyright and or
> privileged material, and are for the use of the intended addressee only. If
> you are not the intended addressee or an authorised recipient of the
> addressee please notify us of receipt by returning the e-mail and do not
> use, copy, retain, distribute or disclose the information in or attached to
> the e-mail.
> Any opinions expressed within this e-mail are those of the individual and
> not necessarily of Diamond Light Source Ltd.
> Diamond Light Source Ltd. cannot guarantee that this e-mail or any
> attachments are free from viruses and we cannot accept liability for any
> damage which you may sustain as a result of software viruses which may be
> transmitted in or with the message.
> Diamond Light Source Limited (company no. 4375679). Registered in England
> and Wales with its registered office at Diamond House, Harwell Science and
> Innovation Campus, Didcot, Oxfordshire, OX11 0DE, United Kingdom
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Change map handedness

[Eugene Osipov]

Dear Andre,
the easierst way is to place mirror next to the screen. You should be able
to see the mirror image of an existing map file

ср, 1 апр. 2020 г. в 14:56, Andre LB Ambrosio :

> Dear all,
> is it possible to generate a mirror image of an existing .ccp4 map file?
> Many thanks in advance.
>
> --
> Andre LB Ambrosio
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
Evgenii Osipov
Laboratory for Biocrystallography,
Department of Pharmaceutical Sciences,
KU Leuven O



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Change map handedness

[Eleanor Dodson]

Easiest to multiply phases by -1. and recalculate mapl. Sftools  can do
that to your mtz

On Wed, 1 Apr 2020 at 13:56, Andre LB Ambrosio  wrote:

> Dear all,
> is it possible to generate a mirror image of an existing .ccp4 map file?
> Many thanks in advance.
>
>
> --
> Andre LB Ambrosio
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

[ccp4bb] Change map handedness

[Andre LB Ambrosio]

Dear all,
is it possible to generate a mirror image of an existing .ccp4 map file?
Many thanks in advance.

-- 
Andre LB Ambrosio



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] 13th CCP4/APS Crystallographic School in the US

[Xu, Qingping]

Dear colleagues,



Due to the on-going pandemic, the 2020 CCP4/APS workshop (originally scheduled 
for June 15-22, 2020) is postponed. We will try to schedule the workshop at a 
later date. If no suitable date is found, the event will be cancelled. Further 
notice will be announced in the CCP4 bulletin board.  In the meantime, the 
registration site remains open. We are sorry for the inconvenience.





The CCP4/APS school organizers


From: Xu, Qingping 
Sent: Monday, January 6, 2020 12:04 PM
To: CCP4BB@JISCMAIL.AC.UK; pheni...@phenix-online.org; 
pymol-us...@lists.sourceforge.net
Subject: 13th CCP4/APS Crystallographic School in the US


Dear Colleagues,

We are pleased to announce the 13th annual CCP4/APS crystallographic school 
“From data collection to structure refinement and beyond” will be held on June 
15-22, 2020 at the Advanced Photon Source (APS), Argonne National Laboratory 
(ANL), near Chicago, Illinois, USA. All details can be found at the school 
website: http://www.ccp4.ac.uk/schools/APS-2020/index.php.

Dates: June 15 through 22, 2020

Location: Advanced Photon Source, Argonne National Laboratory, Argonne (Near 
Chicago), Illinois, USA

The school comprises two parts: data collection workshop and crystallographic 
computing workshop. Data collection workshop includes beamline training, data 
collection on GM/CA@APS beamlines 23ID-D and 23ID-B equipped with Pilatus3 6M 
and Eiger 16M detectors respectively, and data processing. For data collection, 
only the participants' crystals will be used. Crystallographic computation 
workshop will feature many modern crystallographic software packages taught by 
authors and other experts. The daily schedule will be organized in three 
sections – lectures, tutorials, and hands-on (interactive trouble-shooting of 
the technical difficulties the participants face in their projects). We have 
had considerable success resolving these problems in past years, attested by 
resulting publications (see 
http://www.ccp4.ac.uk/schools/APS-school/publications.php). A sample program, 
contact info and other details can be found at the School website.

Applicants: Graduate students, postdoctoral researchers and early-career 
faculty, along with commercial/industrial researchers are encouraged to apply. 
Only about 20 applicants will be selected for participation. Participants of 
the workshop are strongly encouraged to bring their own problem data sets or 
crystals so the problems can be addressed during data collection and/or 
computation workshops.

Application: Application deadline is April 1st, 2020. To apply, visit 
https://www.ccp4.ac.uk/schools/APS-2020/application.php.

Fees: The registration for application is free but there is $500 participation 
fee for the selected academic students and $950 for industrial researchers. A 
valid credit card is required for registration, however, it will be charged 
only for students selected to participate. The students will be responsible for 
their transportation and lodging. The workshop organizers can assist in making 
lodging reservations at the Argonne Guest House. The workshop will cover all 
other expenses (including meals).


We hope to see you at the school.


Charles, Garib and Qingping



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

[ccp4bb] Coot 0.9 Released

[Paul Emsley]

 Coot 0.9 is released.

  This release has been a long-term effort (4 years according to my 
notes). It is powerful but not as
  clean and stable as I would have liked, but I don't want to delay any 
longer. Many of the additions
  and updates have been focused on the problems posed by cryo-EM 
reconstructions - still quite


  useful for crystallography though


   I will be building some binaries shortly.


   I you (also) read the Coot mailing list you will get this twice :-(


Paul.



  o REQUIREMENT:  C+11 required for compilation

  o REQUIREMENT:  Boost required for compilation

  o FEATURE: Automatic addition of alpha helix, nucleic acid stacking 
and pairing restraints and

 metal coordination bond restraints

  o FEATURE: Standard molecular representation now has "atoms" (not 
just bonds).

 Waters are balls, not crosses

  o FEATURE: interactive representation of Ramachandran and rotamer 
probabilities during refinement

 Add set_show_intermediate_atoms_rota_markup()
 Add set_show_intermediate_atoms_rama_markup()

  o FEATURE: Curlew (the Extensions Wrangler) now has a menu item and 
has been redesigned


  o FEATURE: Added function "Go To Middle of Cryo-EM Reconstruction 
Molecule"


  o FEATURE: Sharpen/blur map feature added

  o CHANGE:  Improved Real Space Refinement - now refinement is 
on-going instead of activated by

 dropping (releasing) the atom

  o CHANGE:  Multi-threaded code for real-space refinement, jiggle-fit, 
rotamer probabilities,

 atom overlaps, restraints generation, density contouring

  o CHANGE:  Improved Jiggle Fit

  o CHANGE:  All option menus replaced by comboboxes

  o CHANGE:  The non-bonded contact model is now Lennard-Jones

  o CHANGE:  Lidia chemical diagram rendering improvements

  o CHANGE:  "Hit" atom radius increased for atom picking

  o CHANGE:  Chiral atom restraints tightened, torsion restraints use a 
canonical cosine form


  o CHANGE:  Rotamer fitting deletes clashing waters

  o CHANGE:  Origin marker is now white

  o CHANGE (API): Add access to CaBLAM markup

  o CHANGE (API): Create multiple maps based on atom selection masking

  o CHANGE (API): Add access to shift-field B-factor refinement 
(algorithm from Kevin Cowtan)


  o BUG-FIX: Improved XML parsing of molecules from Wikipedia

  o BUG-FIX: Align & Mutate output fixed



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Sahil Batra]

Dear Prof. Holton,

An innovative idea; however all of the 30 kb genome may not be useful for
specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity.

A similar fluorescent detection approach for SARS Cov2 -- using the
indiscriminate collateral activity of Cas12 nuclease -- has been reported
here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf
Although not tested on samples from patients.

Regards,
Sahil Batra
PhD candidate, IIT Kanpur

On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch  wrote:

> One problem I see is the sputum, there’s a reason why swabs are made to
> get sufficient viral material.
>
> Since stool samples test PCR positive that might be an easier approach to
> get sufficient viral material. As a side note, these are not infectious
> anymore, or at least one has not been able to infect tissue cultures from
> stool samples.
>
> It’s worth a thought, I’ll need to read those papers you referenced.
>
> I believe I read a suitable preprint for viral load, will search for it
> tomorrow.
>
> Jürgen
>
>
>
>
> __
> Jürgen Bosch, Ph.D.
> Division of Pediatric Pulmonology and Allergy/Immunology
> Case Western Reserve University
> 2109 Adelbert Rd, BRB 835
> Cleveland, OH 44106
> Phone: 216.368.7565
> Fax: 216.368.4223
>
> CEO & Co-Founder at InterRayBio, LLC
>
> Johns Hopkins University
> Bloomberg School of Public Health
> Department of Biochemistry & Molecular Biology
>
> On Apr 1, 2020, at 00:50, James Holton  wrote:
>
> In order to do global survelinace of this new virus I figure we're going
> to need billions of tests.  The biggest barriers I believe are
> logistical.  Shipping back and forth to a central labs isn't going to
> cut it, and neither are test kits that cost $800 each.
>
> I think I may have a plausible way forward to a low-cost and easily
> mass-produced test for the SARS-CoV-2 virus using mostly items people
> already have, such as smartphones. The most expensive reagent required
> will be labeled oligos, but those scale very well.
>
> The key observation is that smartphones can detect as few as 1e6
> particles/mL if they do long exposures (180s).  This was using
> bioluminescence. Reported here:
> https://www.nature.com/articles/srep40203.pdf
>
> The other side of that coin is the expected titer of the virus in
> sputum.  I don't know of any reports for SARS-CoV-2 itself, but for four
> other respiratory viruses, including one coronavirus, it ranges from 1e6
> to 1e8 particles/mL :
> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/
>
> This is encouraging!  The challenge will be to detect viral genomes in
> "the field" without sophisticated lab equipment like a PCR machine,
> lasers, 3D printers, etc.  The concentration will be 1e-15 M, a
> challenge, but then again we can detect single molecules using
> fluorescence. The questions are:
> 1) can we get the background low enough so that the dark current of the
> camera dominates
> 2) can we make the signal high enough to overcome the dark current.
>
> 1) will depend on the availability of mass-produced filter technology.
> However, the best filter may simply be time.  Provided the fluorophore
> lifetime is long enough and the camera synchronization tight enough one
> could simply measure the "afterglow" after the camera flash has turned
> off.  An interesting candidate is europium. Most fluorophores decay in
> nanoseconds, but lanthanides can be microseconds to milliseconds.  In
> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04.
> Those decay over minutes to hours.  What I'm not sure about is using
> them for FRET. I would appreciate input on experience with this.
>
> 2) I believe signal could be enhanced by using very luminous tags (such
> as quantum dots), and/or by using multiple tags per genome. This virus
> has the largest RNA genome known to date at 30 kbases. That means there
> is room for up to 2000 15-mer tags, each with its own label. The set-up
> cost for doing ~2000 oligo synthesis reactions will be high, but it can
> be done at scale.  You only need ~2 fmol of each oligo, 10 umol
> synthesis is about $1k, so I estimate about $1 per test using 1000
> different oligos. This price point will be important if we want to make
> billions of tests to be used all over the world.  In some countries $1
> is a lot.
>
> The detection strategy I am focusing on is FRET.  That is, oligos would
> be made in pairs, recognizing abutting sections of the viral genome.
> Like this:
> 5'  atttcgctgatc-ATTO465 ATTO550-cattatcagacaagt  3'
> which would anneal to one of the current CDC test primer sites:
> 3' taaagcgactaggtaatagtctgttca 5'
> The result in this case would be maximum FRET efficiency only when both
> oligos are bound.  From what I can tell, the ATTO465 dye is one that is
> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and
> ATTO550 should give maximum contrast between the green and red 

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Jurgen Bosch]

One problem I see is the sputum, there’s a reason why swabs are made to get
sufficient viral material.

Since stool samples test PCR positive that might be an easier approach to
get sufficient viral material. As a side note, these are not infectious
anymore, or at least one has not been able to infect tissue cultures from
stool samples.

It’s worth a thought, I’ll need to read those papers you referenced.

I believe I read a suitable preprint for viral load, will search for it
tomorrow.

Jürgen




__
Jürgen Bosch, Ph.D.
Division of Pediatric Pulmonology and Allergy/Immunology
Case Western Reserve University
2109 Adelbert Rd , BRB 835
Cleveland, OH 44106 
Phone: 216.368.7565
Fax: 216.368.4223

CEO & Co-Founder at InterRayBio, LLC

Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology

On Apr 1, 2020, at 00:50, James Holton  wrote:

In order to do global survelinace of this new virus I figure we're going
to need billions of tests.  The biggest barriers I believe are
logistical.  Shipping back and forth to a central labs isn't going to
cut it, and neither are test kits that cost $800 each.

I think I may have a plausible way forward to a low-cost and easily
mass-produced test for the SARS-CoV-2 virus using mostly items people
already have, such as smartphones. The most expensive reagent required
will be labeled oligos, but those scale very well.

The key observation is that smartphones can detect as few as 1e6
particles/mL if they do long exposures (180s).  This was using
bioluminescence. Reported here:
https://www.nature.com/articles/srep40203.pdf

The other side of that coin is the expected titer of the virus in
sputum.  I don't know of any reports for SARS-CoV-2 itself, but for four
other respiratory viruses, including one coronavirus, it ranges from 1e6
to 1e8 particles/mL :
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/

This is encouraging!  The challenge will be to detect viral genomes in
"the field" without sophisticated lab equipment like a PCR machine,
lasers, 3D printers, etc.  The concentration will be 1e-15 M, a
challenge, but then again we can detect single molecules using
fluorescence. The questions are:
1) can we get the background low enough so that the dark current of the
camera dominates
2) can we make the signal high enough to overcome the dark current.

1) will depend on the availability of mass-produced filter technology.
However, the best filter may simply be time.  Provided the fluorophore
lifetime is long enough and the camera synchronization tight enough one
could simply measure the "afterglow" after the camera flash has turned
off.  An interesting candidate is europium. Most fluorophores decay in
nanoseconds, but lanthanides can be microseconds to milliseconds.  In
fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04.
Those decay over minutes to hours.  What I'm not sure about is using
them for FRET. I would appreciate input on experience with this.

2) I believe signal could be enhanced by using very luminous tags (such
as quantum dots), and/or by using multiple tags per genome. This virus
has the largest RNA genome known to date at 30 kbases. That means there
is room for up to 2000 15-mer tags, each with its own label. The set-up
cost for doing ~2000 oligo synthesis reactions will be high, but it can
be done at scale.  You only need ~2 fmol of each oligo, 10 umol
synthesis is about $1k, so I estimate about $1 per test using 1000
different oligos. This price point will be important if we want to make
billions of tests to be used all over the world.  In some countries $1
is a lot.

The detection strategy I am focusing on is FRET.  That is, oligos would
be made in pairs, recognizing abutting sections of the viral genome.
Like this:
5'  atttcgctgatc-ATTO465 ATTO550-cattatcagacaagt  3'
which would anneal to one of the current CDC test primer sites:
3' taaagcgactaggtaatagtctgttca 5'
The result in this case would be maximum FRET efficiency only when both
oligos are bound.  From what I can tell, the ATTO465 dye is one that is
most sensitive to the blue peak in the iPhone "flash" LED spectrum, and
ATTO550 should give maximum contrast between the green and red channels
of the iPhone camera. That way you would discriminate presence/absence
by color.  Red=virus, Green=clear. That is just an example. Other tags
might work better.  Maybe quantum dots.

Additional aparatus would be required, of course, and at least a few
reagents to crack open the capsids (DTT and guanidine).  These could be
shipped dry in foil packs.  The end user would simply tear it open and
spit into it.  If the intersted party is performing the test on
themselves, then there is no biohazard.  Heating to 70C (cup of coffee?)
should kill the virus, and these reagents will make it even more dead.
I'm not sure how much purification would be required.  The assay volume
in the Nature