One problem I see is the sputum, there’s a reason why swabs are made to get sufficient viral material.
Since stool samples test PCR positive that might be an easier approach to get sufficient viral material. As a side note, these are not infectious anymore, or at least one has not been able to infect tissue cultures from stool samples. It’s worth a thought, I’ll need to read those papers you referenced. I believe I read a suitable preprint for viral load, will search for it tomorrow. Jürgen __________________________________________ Jürgen Bosch, Ph.D. Division of Pediatric Pulmonology and Allergy/Immunology Case Western Reserve University 2109 Adelbert Rd <x-apple-data-detectors://1/1>, BRB 835 Cleveland, OH 44106 <x-apple-data-detectors://2/0> Phone: 216.368.7565 Fax: 216.368.4223 CEO & Co-Founder at InterRayBio, LLC Johns Hopkins University Bloomberg School of Public Health Department of Biochemistry & Molecular Biology On Apr 1, 2020, at 00:50, James Holton <jmhol...@lbl.gov> wrote: In order to do global survelinace of this new virus I figure we're going to need billions of tests. The biggest barriers I believe are logistical. Shipping back and forth to a central labs isn't going to cut it, and neither are test kits that cost $800 each. I think I may have a plausible way forward to a low-cost and easily mass-produced test for the SARS-CoV-2 virus using mostly items people already have, such as smartphones. The most expensive reagent required will be labeled oligos, but those scale very well. The key observation is that smartphones can detect as few as 1e6 particles/mL if they do long exposures (180s). This was using bioluminescence. Reported here: https://www.nature.com/articles/srep40203.pdf The other side of that coin is the expected titer of the virus in sputum. I don't know of any reports for SARS-CoV-2 itself, but for four other respiratory viruses, including one coronavirus, it ranges from 1e6 to 1e8 particles/mL : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/ This is encouraging! The challenge will be to detect viral genomes in "the field" without sophisticated lab equipment like a PCR machine, lasers, 3D printers, etc. The concentration will be 1e-15 M, a challenge, but then again we can detect single molecules using fluorescence. The questions are: 1) can we get the background low enough so that the dark current of the camera dominates 2) can we make the signal high enough to overcome the dark current. 1) will depend on the availability of mass-produced filter technology. However, the best filter may simply be time. Provided the fluorophore lifetime is long enough and the camera synchronization tight enough one could simply measure the "afterglow" after the camera flash has turned off. An interesting candidate is europium. Most fluorophores decay in nanoseconds, but lanthanides can be microseconds to milliseconds. In fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04. Those decay over minutes to hours. What I'm not sure about is using them for FRET. I would appreciate input on experience with this. 2) I believe signal could be enhanced by using very luminous tags (such as quantum dots), and/or by using multiple tags per genome. This virus has the largest RNA genome known to date at 30 kbases. That means there is room for up to 2000 15-mer tags, each with its own label. The set-up cost for doing ~2000 oligo synthesis reactions will be high, but it can be done at scale. You only need ~2 fmol of each oligo, 10 umol synthesis is about $1k, so I estimate about $1 per test using 1000 different oligos. This price point will be important if we want to make billions of tests to be used all over the world. In some countries $1 is a lot. The detection strategy I am focusing on is FRET. That is, oligos would be made in pairs, recognizing abutting sections of the viral genome. Like this: 5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3' which would anneal to one of the current CDC test primer sites: 3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5' The result in this case would be maximum FRET efficiency only when both oligos are bound. From what I can tell, the ATTO465 dye is one that is most sensitive to the blue peak in the iPhone "flash" LED spectrum, and ATTO550 should give maximum contrast between the green and red channels of the iPhone camera. That way you would discriminate presence/absence by color. Red=virus, Green=clear. That is just an example. Other tags might work better. Maybe quantum dots. Additional aparatus would be required, of course, and at least a few reagents to crack open the capsids (DTT and guanidine). These could be shipped dry in foil packs. The end user would simply tear it open and spit into it. If the intersted party is performing the test on themselves, then there is no biohazard. Heating to 70C (cup of coffee?) should kill the virus, and these reagents will make it even more dead. I'm not sure how much purification would be required. The assay volume in the Nature paper above was 1 mL. I expect signal would be improved by concentrating the RNA as close to the camera as possible. It may even be possible to absorb the nucleic acid directly onto the cover glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and not much else does. Quiagen EZ1 nucleic acid purificaiton columns are nothing but silica glass beads after all. There are still details to work out, but I am intruiged by the fact that this seems physically possible and the potential of being very cheap, rugged, portable and scaled up rapidly. It would be nice to be able to leverage a device that is in already in the hand of half the people on the planet. Comments? Insights? -James Holton MAD Scientist ######################################################################## To unsubscribe from the CCP4BB list, click the following link: https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 ######################################################################## To unsubscribe from the CCP4BB list, click the following link: https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
