Dear Prof. Holton, An innovative idea; however all of the 30 kb genome may not be useful for specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity.
A similar fluorescent detection approach for SARS Cov2 -- using the indiscriminate collateral activity of Cas12 nuclease -- has been reported here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf Although not tested on samples from patients. Regards, Sahil Batra PhD candidate, IIT Kanpur On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <[email protected]> wrote: > One problem I see is the sputum, there’s a reason why swabs are made to > get sufficient viral material. > > Since stool samples test PCR positive that might be an easier approach to > get sufficient viral material. As a side note, these are not infectious > anymore, or at least one has not been able to infect tissue cultures from > stool samples. > > It’s worth a thought, I’ll need to read those papers you referenced. > > I believe I read a suitable preprint for viral load, will search for it > tomorrow. > > Jürgen > > > > > __________________________________________ > Jürgen Bosch, Ph.D. > Division of Pediatric Pulmonology and Allergy/Immunology > Case Western Reserve University > 2109 Adelbert Rd, BRB 835 > Cleveland, OH 44106 > Phone: 216.368.7565 > Fax: 216.368.4223 > > CEO & Co-Founder at InterRayBio, LLC > > Johns Hopkins University > Bloomberg School of Public Health > Department of Biochemistry & Molecular Biology > > On Apr 1, 2020, at 00:50, James Holton <[email protected]> wrote: > > In order to do global survelinace of this new virus I figure we're going > to need billions of tests. The biggest barriers I believe are > logistical. Shipping back and forth to a central labs isn't going to > cut it, and neither are test kits that cost $800 each. > > I think I may have a plausible way forward to a low-cost and easily > mass-produced test for the SARS-CoV-2 virus using mostly items people > already have, such as smartphones. The most expensive reagent required > will be labeled oligos, but those scale very well. > > The key observation is that smartphones can detect as few as 1e6 > particles/mL if they do long exposures (180s). This was using > bioluminescence. Reported here: > https://www.nature.com/articles/srep40203.pdf > > The other side of that coin is the expected titer of the virus in > sputum. I don't know of any reports for SARS-CoV-2 itself, but for four > other respiratory viruses, including one coronavirus, it ranges from 1e6 > to 1e8 particles/mL : > https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/ > > This is encouraging! The challenge will be to detect viral genomes in > "the field" without sophisticated lab equipment like a PCR machine, > lasers, 3D printers, etc. The concentration will be 1e-15 M, a > challenge, but then again we can detect single molecules using > fluorescence. The questions are: > 1) can we get the background low enough so that the dark current of the > camera dominates > 2) can we make the signal high enough to overcome the dark current. > > 1) will depend on the availability of mass-produced filter technology. > However, the best filter may simply be time. Provided the fluorophore > lifetime is long enough and the camera synchronization tight enough one > could simply measure the "afterglow" after the camera flash has turned > off. An interesting candidate is europium. Most fluorophores decay in > nanoseconds, but lanthanides can be microseconds to milliseconds. In > fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04. > Those decay over minutes to hours. What I'm not sure about is using > them for FRET. I would appreciate input on experience with this. > > 2) I believe signal could be enhanced by using very luminous tags (such > as quantum dots), and/or by using multiple tags per genome. This virus > has the largest RNA genome known to date at 30 kbases. That means there > is room for up to 2000 15-mer tags, each with its own label. The set-up > cost for doing ~2000 oligo synthesis reactions will be high, but it can > be done at scale. You only need ~2 fmol of each oligo, 10 umol > synthesis is about $1k, so I estimate about $1 per test using 1000 > different oligos. This price point will be important if we want to make > billions of tests to be used all over the world. In some countries $1 > is a lot. > > The detection strategy I am focusing on is FRET. That is, oligos would > be made in pairs, recognizing abutting sections of the viral genome. > Like this: > 5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3' > which would anneal to one of the current CDC test primer sites: > 3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5' > The result in this case would be maximum FRET efficiency only when both > oligos are bound. From what I can tell, the ATTO465 dye is one that is > most sensitive to the blue peak in the iPhone "flash" LED spectrum, and > ATTO550 should give maximum contrast between the green and red channels > of the iPhone camera. That way you would discriminate presence/absence > by color. Red=virus, Green=clear. That is just an example. Other tags > might work better. Maybe quantum dots. > > Additional aparatus would be required, of course, and at least a few > reagents to crack open the capsids (DTT and guanidine). These could be > shipped dry in foil packs. The end user would simply tear it open and > spit into it. If the intersted party is performing the test on > themselves, then there is no biohazard. Heating to 70C (cup of coffee?) > should kill the virus, and these reagents will make it even more dead. > I'm not sure how much purification would be required. The assay volume > in the Nature paper above was 1 mL. I expect signal would be improved > by concentrating the RNA as close to the camera as possible. It may > even be possible to absorb the nucleic acid directly onto the cover > glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and > not much else does. Quiagen EZ1 nucleic acid purificaiton columns are > nothing but silica glass beads after all. > > There are still details to work out, but I am intruiged by the fact that > this seems physically possible and the potential of being very cheap, > rugged, portable and scaled up rapidly. It would be nice to be able to > leverage a device that is in already in the hand of half the people on > the planet. > > Comments? Insights? > > -James Holton > MAD Scientist > > ######################################################################## > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > > > ------------------------------ > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > ######################################################################## To unsubscribe from the CCP4BB list, click the following link: https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
