Re: [ccp4bb] Coming July 29: Improved Carbohydrate Data at the PDB -- N-glycans are now separate chains if more than one residue

[radu]

Hi Tristan,

I fully subscribe to your idea! I was quite surprised to see our model revised
with different glycan chain IDs upon PDB annotation. I imagine there must have
been some "administrative" reasoning behind this decision, but it's just a
nightmare for subsequent visualisation. And, to me at least, this change makes
no sense. Protein chains with covalently attached glycans are one biochemical,
structural and functional unit.

Best wishes,

Radu

> This suggestion violates a basic principle of data base theory.  A
> single data item cannot encode two pieces of information.
>
> I'm sorry if I was unclear, but I don't believe I was suggesting anything of
> the sort. Hopefully this example should make it more clear - I'm just
> suggesting a slight variation on the existing system, no more:
>
> If we start with model containing 3 protein chains A-C, with chain A
> containing amino acid residues 1-200, and 3 N-linked glycans with residues
> numbered, say, 1000-1005, 1020-1026 and 1040-1043 (a fairly common approach
> I've seen taken to the problem in the past, and one I've taken myself), then
> if I understand correctly after remediation we'll have a model with protein
> chains A-C and glycan chains D-F. The problem is, unless and until all the
> available visualisation software updates to automatically associate chains D-F
> to chain A based on linkage, the user just has to remember that chains D-F are
> actually the chain A glycans. This is a simple case, but things quickly become
> far more messy when you have multiple glycosylated species each with multiple
> glycans per chain. If, instead, the new chain assignments were something like
> "A, B, C, Ag1, Ag2, Ag3", then we have something that is far more immediately
> accessible to the user.
>
> 
> From: Dale Tronrud 
> Sent: 04 December 2020 17:01
> To: Tristan Croll ; CCP4BB@JISCMAIL.AC.UK
> 
> Subject: Re: [ccp4bb] Coming July 29: Improved Carbohydrate Data at the PDB --
> N-glycans are now separate chains if more than one residue
>
>
> This suggestion violates a basic principle of data base theory.  A
> single data item cannot encode two pieces of information.  The whole
> structure of CIF falls apart if this is done.
>
> Does the new PDB convention contain a CIF record of the link that
> bridges between the protein chain and the, now separated, glycan chain?
>   If not, I think this is the principle failing of their new scheme.
>
> Dale Tronrud
>
> On 12/4/2020 12:06 AM, Tristan Croll wrote:
>> To go one step further: in large, heavily glycosylated multi-chain complexes
>> the assignment of a random new chain ID to each glycan will lead to
>> headaches for people building visualisations using existing viewers, because
>> it loses the easy name-based association of glycan to parent protein chain.
>> A suggestion: why not take full advantage of the mmCIF capability for
>> multi-character chain IDs, and name them by appending characters to the
>> parent chain ID? Using chain A as an example, perhaps the glycans could
>> become Ag1, Ag2, etc.?
>>
>>> On 4 Dec 2020, at 07:48, Luca Jovine  wrote:
>>>
>>> CC: pdb-l
>>>
>>> Dear Zhijie and Robbie,
>>>
>>> I agree with both of you that the new carbohydrate chain assignment
>>> convention that has been recently adopted by PDB introduces confusion, not
>>> just for PDB-REDO but also - and especially - for end users.
>>>
>>> Could we kindly ask PDB to improve consistency by either assigning a
>>> separate chain to all covalently attached carbohydrates (regardless of
>>> whether one or more residues have been traced), or reverting to the old
>>> system (where N-/O-glycans inherited the same chain ID of the protein to
>>> which they are attached)? The current hybrid solution hardly seems
>>> optimal...
>>>
>>> Best regards,
>>>
>>> Luca
>>>
>>>> On 3 Dec 2020, at 20:17, Robbie Joosten 
>>>> wrote:
>>>>
>>>> Dear Zhijie,
>>>>
>>>> In generally I like the treatment of carbohydrates now as branched
>>>> polymers. I didn't realise there was an exception. It makes sense for
>>>> unlinked carbohydrate ligands, but not for N- or O-glycosylation sites as
>>>> these might change during model building or, in my case, carbohydrate
>>>> rebuilding in PDB-REDO powered by Coot. Thanks for pointing this out.
>>>>
>>>> Cheers,
>>>> Robbie
>>>>
>>>>> -Original Message-
>>>>> From: CCP4 bulletin

Re: [ccp4bb] Highest resolution of X-ray / neutron / electron crystallography, cryo EM

[radu]

Hi Tobias,For what is worth, we report 1.22 A for single particle cryo-EM ;-)) But very likely there is more in that dataset, we should know soon.Best wishes,RaduOn 9 Jun 2020 3:11 pm, Tobias Beck  wrote:Dear all,Thanks a lot! (I should have used the PDB query myself for neutrons, sry, my bad)As there was a request to share the bioRxiv links, here they are:https://www.biorxiv.org/content/10.1101/2020.05.21.106740v1https://www.biorxiv.org/content/10.1101/2020.05.22.110189v1along with the comment in Nature (which also has both links to the papers in the references section):https://www.nature.com/articles/d41586-020-01658-1So: X-ray at 0.48 ANeutron at 0.93 A (hybrid with X-ray) or 1.05 ACryo EM 1.25 Aelectron diffraction 0.6 A Thanks to all of you! Best, Tobias. On Tue, Jun 9, 2020 at 3:46 PM Tobias Beck  wrote:Dear all,Thanks for the link to the latest BioRxiv papers! So for cryo EM it is 1.2 now. Any numbers for neutron?Best, Tobias. Tobias Beck  schrieb am Di. 9. Juni 2020 um 15:35:Dear all,I was asked by a student what the highest resolution is, for each of the four methods listed above. Maybe someone has researched the current numbers previously and would like to share them? For X-ray, I found 0.48 A in the PDB. For EM method details, the PDB gives me 0.6 A, but it is actually for electron diffraction. I found a structure with 1.8 A for Cryo EM.I am aware that resolution is only one parameter and that high resolution may not correspond to high data quality. However, maybe someone knows the record holders, either for biomacromolecules or small molecules or for both. Thanks!Best, Tobias. 




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1




To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] E. coli BirA biotin ligase expression/purification

[radu]

Dear Gloria,

I think that the most economical biotinylation manner is in vivo, by
co-expression of a tagged protein with BirA. One can PCR amplify the BirA cDNA
from E. coli and clone it into plasmids for any expression system and
sub-cellular localization needed. Ready to use BirA expression plasmids are
also available on Addgene. Some extra biotin has to be added to culture medium
in my experience. Examples from our lab (HEK cells) are in PMID: 27418511 and
28817804.

Best wishes,

Radu


> Dear friends in crystallography,
> I know this seems unrelated, but it really isn't ... please forgive me. We
are trying to use the Avitag/BirA system to specifically biotinylate target
proteins in an economical manner.  Are any of you purifying the BirA enzyme
in your lab for biotinylation and if so can you help me figure out the right
plasmid/purification protocol?   Please let me know.  Thank you. Gloria
>  To
unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1


-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305
www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] challenges in structural biology

[radu]

Hi Paul,

Fair point, apologies if anyone was offended by my comments! I simply thought
that such matters are meaningful for this forum. I am just as guilty as
everyone, and it is important to put our work into the broader perspective
from time to time.

Best wishes,

Radu


> Hi Radu and all
>
> Could i humbly suggest some careful reflection before this ends up polarising
> the amazing structural biology community. Since the year dot everyone has been
> contributing to integrated approaches and I fear that the tone of this debate
> will create much negativity around the community which seems pointless at
> least to me..
>
> Maybe a commentary published somewhere would be a better way to debate what
> are important issues and not through the  CCP4 forum?
>
> best wishes
>
> Paul
>
>
>
>
>> On 17 Jul 2019, at 10:21, r...@mrc-lmb.cam.ac.uk wrote:
>>
>> Hi Susan,
>>
>> We are not naive if we care about using the limited resources of this
>> planet
>> responsibly. This has nothing to do with whoever's favourite method. I have
>> nothing against crystallography, it is a beautiful art and has been a
>> success
>> historically. I have solved plenty of crystal structures myself and will
>> probably have to keep doing it for a little while. But it is naive to
>> ignore
>> that the time to move on has arrived, and that we have to use resources to
>> develop better technologies which address the real biological questions
>> instead of keeping dinosaurs on life support.
>>
>> How many of the structures solved on synchrotrons worldwide and of the
>> zillions in the PDB are of any use or biological relevance (original
>> question)? There is an enormous amount of waste, including the nasty
>> chemicals
>> use to grow crystals and to phase pointless structures, let's be honest.
>>
>> Best wishes,
>>
>> Radu
>>
>>
>>
>>> I think we are naive if we care about the method used to obtain the
>>> structure
>>> - what matters is getting at the structure.  What is great is that the
>>> variety
>>> of ways we can do this has increased meaning more samples become tractable
>>> for
>>> high resolution structure determination. I don’t see the point of
>>> ridiculous
>>> my method is better than your method arguments - for some samples all
>>> methods
>>> are equivalent, for some there is only one method that will yield answers -
>>> we
>>> just need to train students and develop methods that allow the broadest
>>> access. Everything else is bias-driven posturing. Let’s just solve some
>>> structures and learn something about biology.
>>>
>>>
>>> Susan
>>>
>>> Sent from my iPhone
>>>
>>>> On 17 Jul 2019, at 08:43, r...@mrc-lmb.cam.ac.uk 
>>>> wrote:
>>>>
>>>> Hi Both,
>>>>
>>>> I am not questioning the PDB stats, the issue was whether (crystal)
>>>> structures
>>>> are sufficiently relevant to address biological questions and justify the
>>>> resources. Fragment screening is one example where investment in protein
>>>> crystallography can still be justified (for now). But it doesn't really
>>>> ask
>>>> or
>>>> answer biological questions... for these, whether we like it or not,
>>>> macromolecular crystallography (or NMR, even in cell) cannot be the
>>>> future.
>>>> In
>>>> my opinion :-)
>>>>
>>>> Best wishes,
>>>>
>>>> Radu
>>>>
>>>>
>>>>> Stating the crystallography is dead might be a bit premature, it is
>>>>> still
>>>>> king
>>>>> for depositions.
>>>>>
>>>>>
>>>>>
>>>>> In 2017 we had a large number of fragment screening experiments
>>>>> deposited.
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>> From: CCP4 bulletin board  On Behalf Of Nukri
>>>>> Sanishvili
>>>>> Sent: 15 July 2019 23:09
>>>>> To: CCP4BB@JISCMAIL.AC.UK
>>>>> Subject: Re: [ccp4bb] challenges in structural biology
>>>>>
>>>>>
>>>>>
>>>>> I know it is going to hijack the original topic but I could not help...
>>>>>
>>>>>
>>>>>
>>>>> “The reports of deat

Re: [ccp4bb] challenges in structural biology

[radu]

Hi Susan,

We are not naive if we care about using the limited resources of this planet
responsibly. This has nothing to do with whoever's favourite method. I have
nothing against crystallography, it is a beautiful art and has been a success
historically. I have solved plenty of crystal structures myself and will
probably have to keep doing it for a little while. But it is naive to ignore
that the time to move on has arrived, and that we have to use resources to
develop better technologies which address the real biological questions
instead of keeping dinosaurs on life support.

How many of the structures solved on synchrotrons worldwide and of the
zillions in the PDB are of any use or biological relevance (original
question)? There is an enormous amount of waste, including the nasty chemicals
use to grow crystals and to phase pointless structures, let's be honest.

Best wishes,

Radu



> I think we are naive if we care about the method used to obtain the structure
> - what matters is getting at the structure.  What is great is that the variety
> of ways we can do this has increased meaning more samples become tractable for
> high resolution structure determination. I don’t see the point of ridiculous
> my method is better than your method arguments - for some samples all methods
> are equivalent, for some there is only one method that will yield answers - we
> just need to train students and develop methods that allow the broadest
> access. Everything else is bias-driven posturing. Let’s just solve some
> structures and learn something about biology.
>
>
> Susan
>
> Sent from my iPhone
>
>> On 17 Jul 2019, at 08:43, r...@mrc-lmb.cam.ac.uk 
>> wrote:
>>
>> Hi Both,
>>
>> I am not questioning the PDB stats, the issue was whether (crystal)
>> structures
>> are sufficiently relevant to address biological questions and justify the
>> resources. Fragment screening is one example where investment in protein
>> crystallography can still be justified (for now). But it doesn't really ask
>> or
>> answer biological questions... for these, whether we like it or not,
>> macromolecular crystallography (or NMR, even in cell) cannot be the future.
>> In
>> my opinion :-)
>>
>> Best wishes,
>>
>> Radu
>>
>>
>>> Stating the crystallography is dead might be a bit premature, it is still
>>> king
>>> for depositions.
>>>
>>>
>>>
>>> In 2017 we had a large number of fragment screening experiments deposited.
>>>
>>>
>>>
>>>
>>>
>>>
>>>
>>> From: CCP4 bulletin board  On Behalf Of Nukri
>>> Sanishvili
>>> Sent: 15 July 2019 23:09
>>> To: CCP4BB@JISCMAIL.AC.UK
>>> Subject: Re: [ccp4bb] challenges in structural biology
>>>
>>>
>>>
>>> I know it is going to hijack the original topic but I could not help...
>>>
>>>
>>>
>>> “The reports of death of (macromolecular) crystallography are greatly
>>> exaggerated.
>>>
>>> If we believed the prognosticators, it has been dead since the 80s when
>>> some
>>> folks made the claim that the only relevant structures were those solved
>>> by
>>> NMR.
>>>
>>> I think we've done quite well since then...
>>>
>>> Best,
>>>
>>> Nukri
>>>
>>>
>>>
>>> On Mon, Jul 15, 2019 at 3:45 PM >> <mailto:r...@mrc-lmb.cam.ac.uk> > wrote:
>>>
>>> Hi Tassos, Tim,
>>>
>>> I wonder why would you or anyone on this list worry whether biological
>>> questions that can be asked and answered with structures are relevant to
>>> justify the resources? I think there is abundant evidence that this is the
>>> case. Unless your point is that crystallography is now dead for all
>>> practical
>>> purposes... then yes, I fully agree :-) It would however be wrong to erase
>>> its
>>> historical contribution to understanding biology.
>>>
>>> Best wishes,
>>>
>>> Radu
>>>
>>>
>>>> I would wonder more if the biological questions you can *ask* with a
>>>> (crystal)
>>>> structure are sufficiently relevant to justify the resources.
>>>>
>>>> Sent from my iPhone
>>>>
>>>>> On 15 Jul 2019, at 22:08, Tim Grüne >>>> <mailto:tim.gru...@univie.ac.at> > wrote:
>>>>>
>>>>> Dear James,
>>>>>
>>>>> 10) are the biological questions that you can answer 

Re: [ccp4bb] challenges in structural biology

[radu]

Hi Both,

I am not questioning the PDB stats, the issue was whether (crystal) structures
are sufficiently relevant to address biological questions and justify the
resources. Fragment screening is one example where investment in protein
crystallography can still be justified (for now). But it doesn't really ask or
answer biological questions... for these, whether we like it or not,
macromolecular crystallography (or NMR, even in cell) cannot be the future. In
my opinion :-)

Best wishes,

Radu


> Stating the crystallography is dead might be a bit premature, it is still king
> for depositions.
>
>
>
> In 2017 we had a large number of fragment screening experiments deposited.
>
>
>
>
>
>
>
> From: CCP4 bulletin board  On Behalf Of Nukri
> Sanishvili
> Sent: 15 July 2019 23:09
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: Re: [ccp4bb] challenges in structural biology
>
>
>
> I know it is going to hijack the original topic but I could not help...
>
>
>
> “The reports of death of (macromolecular) crystallography are greatly
> exaggerated.
>
> If we believed the prognosticators, it has been dead since the 80s when some
> folks made the claim that the only relevant structures were those solved by
> NMR.
>
> I think we've done quite well since then...
>
> Best,
>
> Nukri
>
>
>
> On Mon, Jul 15, 2019 at 3:45 PM  <mailto:r...@mrc-lmb.cam.ac.uk> > wrote:
>
> Hi Tassos, Tim,
>
> I wonder why would you or anyone on this list worry whether biological
> questions that can be asked and answered with structures are relevant to
> justify the resources? I think there is abundant evidence that this is the
> case. Unless your point is that crystallography is now dead for all practical
> purposes... then yes, I fully agree :-) It would however be wrong to erase its
> historical contribution to understanding biology.
>
> Best wishes,
>
> Radu
>
>
>> I would wonder more if the biological questions you can *ask* with a
>> (crystal)
>> structure are sufficiently relevant to justify the resources.
>>
>> Sent from my iPhone
>>
>>> On 15 Jul 2019, at 22:08, Tim Grüne >> <mailto:tim.gru...@univie.ac.at> > wrote:
>>>
>>> Dear James,
>>>
>>> 10) are the biological questions that you can answer with a (crystal)
>>> structure sufficiently relevant to justify the resources?
>>>
>>> Best,
>>> Tim
>>>
>>>
>>>
>>> Am 15.07.2019 21:44, schrieb Holton, James M:
>>>> Hello folks,
>>>> I have the distinct honor of chairing the next Gordon Research
>>>> Conference on Diffraction Methods in Structural Biology (July 26-31
>>>> 2020).  This meeting will focus on the biggest challenges currently
>>>> faced by structural biologists, and I mean actual real-world
>>>> challenges.  As much as possible, these challenges will take the form of
>>>> friendly competitions with defined parameters, data, a scoring system,
>>>> and "winners", to be established along with other unpublished results
>>>> only at the meeting, as is tradition at GRCs.
>>>> But what are the principle challenges in biological structure
>>>> determination today?  I of course have my own ideas, but I feel like I'm
>>>> forgetting something.  Obvious choices are:
>>>> 1) getting crystals to diffract better
>>>> 2) building models into low-resolution maps (after failing at #1)
>>>> 3) telling if a ligand is really there or not
>>>> 4) the phase problem (dealing with weak signal, twinning and
>>>> pseudotranslation)
>>>> 5) what does "resolution" really mean?
>>>> 6) why are macromolecular R factors so much higher than small-molecule
>>>> ones?
>>>> 7) what is the best way to process serial crystallography data?
>>>> 8) how should one deal with non-isomorphism in multi-crystal methods?
>>>> 9) what is the "structure" of something that won't sit still?
>>>> What am I missing?  Is industry facing different problems than
>>>> academics?  Are there specific challenges facing electron-based
>>>> techniques?  If so, could the combined strength of all the world's
>>>> methods developers solve them?  I'm interested in hearing the voice of
>>>> this community.  On or off-list is fine.
>>>> -James Holton
>>>> MAD Scientist
>>>> 
>>>> To unsubscribe from the CCP4BB list, click t

Re: [ccp4bb] Non-specific disulfides in a secreted protein

[radu]

Hi Tomas,

I have seen something similar in the past, see PMID: 26998761. The problem
could be alleviated by tuning down expression levels, through plasmid
dilution. I guess that cellular QC mechanisms are overwhelmed if you push too
hard for overexpression. I'd test a range of 1:10 to 1:1000, or higher,
dilutions in empty (pLEXm or any irrelevant plasmid) to keep total DNA amounts
constant. Is there no hint of monomer whatsoever in your prep?

Best wishes,

Radu

-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305
www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu

> Dear All,
>
> we are purifying a small secreted protein from conditioned media and
> have a rather unusual problem.
>
> It is a small ectodomain (~11 kDa, pI ~6, His-tagged) of the type 1
> transmembrane receptor, crystal structures are known (of the protein
> that was produced in E.coli and refolded; we are secreting the same
> protein using mammalian cells) so we can design reasonable constructs.
> The protein is expressed and secreted by transiently transfected
> HEK293T cells that work very well for other ectodomains and
> extracellular proteins in our hands (PMID 17001101). The target
> protein has 10 cysteines that form 5 disulfides in the crystal
> structure (of E.coli-expressed and refolded protein), there should be
> no free cysteines and no non-specific disulfides. Unfortunately, once
> the protein is secreted, it forms non-specific dimers and higher-order
> oligomers in the media (standard DMEM/2% FBS) before purification
> (confirmed by Western blotting under non-reducing conditions). Using
> 0.5 mM DTT during SEC gives a nice monomeric peak (however, the
> protein suffers as suggested by weaker interactions with its binding
> partners). We don't understand how a secreted protein (which passes
> trafficking quality control in the cell) with a known disulfide
> pattern forms non-specific disulfide linked oligomers in the
> extracellular media. We tried expressing it at 37 C and 30 C, and have
> sequenced our constructs (plasmids) multiple times.
>
> If anyone has seen this kind of problem and successfully solved it
> (purified homogeneous crystallisation quality protein), please let us
> know if possible. I thank you for your help.
>
> Best wishes,
> Tomas
>
>
> Dr. Tomas Malinauskas
> University of Oxford
> Wellcome Centre for Human Genetics
> Division of Structural Biology
> Roosevelt Drive
> Oxford OX3 7BN
> United Kingdom
> to...@strubi.ox.ac.uk
> tomas.malinaus...@gmail.com
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Large scale insect cell expression

[radu]

Hi Joseph,

Apologies for not answering your question really :-) But, unless you plan to
focus on very peculiar insect cell proteins, I would suggest considering HEK
cells. See PMID: 30455477 for one of several possible systems. Cheaper,
easier, wave bag-friendly... Overall better than insect, especially for
membrane and secreted proteins. All vectors are with Addgene, early passage
cells from ATCC.

Best wishes,

Radu

-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305
www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu

> Dear ccp4 community,
>
>
> I'll soon start my own lab and together with other colleagues, would like to
> establish a facility to do large scale insect cell culture for
> crystallography. Has anyone had any experience with the wave bag systems for
> this purpose (for instance from GE)? I have heard that culture infection can
> be a problem with this system.
>
>
> Any advice or other helpful tips in this regard would be much appreciated.
>
>
> Best regards,
>
> Joseph.
>
>
>
>
> Joseph S. Brock | PhD
> Researcher
> Drew Lab
> Department of Biochemistry and Biophysics
> Stockholm University
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Suggestions for deglycosylaiton enzymes

[radu]

Oops,

I made a mistake in my previous email, apologies! Griffithsin would also
require high-Man glycans, so kifunensine treatment or GnTI-/- cells So
yes, it's either PNGase or cryo-EM...

Best wishes,

Radu



> Hi Savvas,
>
> Many Thanks for your inputs and references. This cell line used is not
> HEK293S *MGAT1-/-. *This particular batch was purified from HEK293
> cell-line stably expressing (created using lenti-methods by a
> former colleague) the protein of interest. In future, I will plan to do
> expression in the presence of Kifunensine, followed by EndoH treatment
> before complexation and crystallization.
>
> Best Wishes,
> Partha
>
>
> On Mon, Jul 16, 2018 at 12:53 PM, Savvas Savvides 
> wrote:
>
>> Dear Partha
>> you do not specify which HEK293 cell line you have used, but if it so
>> happens that it is the very handy HEK293S *MGAT1-/- *cell line
>> (previously known as HEK293S *GnTI-/- ) *which produces
>> N-linked Man5GlcNAc2 glycans you might want to consider using EndoH (e.g.
>> see Verstraete et al. DOI: 10.1038/ncomms14937) or even Jack-bean
>> alpha-mannosidase (e.g. see Bloch et al. https://doi.org/10.1016/j.
>> immuni.2017.12.008).
>> Kifunensine, an inhibitor of N-glycosylation processing, tends to work
>> quite well for protein expression in HEK293T and renders N-linked glycans
>> digestible by EndoH (see Chang et al. DOI 10.1016/j.str.2007.01.011 ; Felix
>> et al. http://dx.doi.org/10.1016/j.str.2015.06.019 ; Elegheert et
>> al. doi:10.1038/nsmb.2367).
>>
>> If resources and protein material allow, you might also want to consider
>> the permutation exercise of subjecting the complex to deglycosylation, or
>> the individual components followed by complex formation/purification, or
>> just one of the two components followed by complex formation/purification,
>> or even one of the two components followed by further deglycosylation of
>> the complex. We are becoming more and more apprehensive of the possible
>> role of glycans in complex formation.
>> And then there is of course the option to apply mutagenesis, e.g. via
>> N—>Q, to eliminate certain N-linked glycans either as a standalone
>> approach
>> or in combination with enzymatic glycan digestions as described above.
>>
>> Best wishes
>> Savvas
>>
>>
>> *---*
>> *Savvas Savvides*
>> VIB Center for Inflammation Research
>> Dept. Biochemistry & Microbiology, Ghent University
>> Technologiepark 927, B-9052 Ghent (Zwijnaarde), Belgium
>> +32 (0)472 928 519 (mobile) ; +32 9 331 36 60 (office) ; Skype:
>> savvas.savvides_skype
>> http://www.vib.be/en/research/scientists/Pages/Savvas-Savvides-Lab.aspx
>>
>> On 16 Jul 2018, at 20:53, Parthasarathy Sampathkumar 
>> wrote:
>>
>> Dear All,
>>
>> I am in a situation, almost for the first time within my limited
>> experience, that deglycosylation might be necessary to obtain crystal. So,
>> I thought of tapping to vast experience of CCP4BBers, while I am searching
>> literature.
>>
>> I have protein that has been expressed in HEK293 cells, secreted into
>> media, purified over IMAC and SEC columns. Crystallization-screens with its
>> binding partners (they form good complexes based on analytical SEC) have
>> not produced any useful hits (whereas complexes with related proteins
>> worked well). So, I plan to re-try complex formation and \crystallization
>> screen after deglysosylation.
>>
>> My question is: In practice, Does a kit (for example here: https://www.
>> sigmaaldrich.com/catalog/product/SIGMA/NDEGLY?lang=en=US)
>> containing Endo F1, F2, F3 be sufficient or should this be tried in
>> combination with PNGase (which requires
>> desaturating conditions)?!!
>>
>> Many Thanks in advance for your suggestions, and reference.
>>
>> Best Wishes,
>> Partha
>>
>> --
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>>
>>
>>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
>


-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305
www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1

Re: [ccp4bb] Suggestions for deglycosylaiton enzymes

[radu]

Hi Partha,

In this case (un-treated HEK293), you cannot use EndoH with already purified
proteins (as per your reply to Artem's email). The N-glycans will be
fucosylated, hence EndoH-insensitive (see PMID: 23623336 for background
infos). You can still use PNGase. But, as Artem suggested, this often causes
protein precipitation when it can access the sites on folded proteins. Apart
from shaving the glycan shield, PNGase causes unwanted mutations at the
N-linked sites: Asn -> Asp, which is where most problems stem from.

Nevertheless, since your fully glycosylated protein doesn't crystallize,
there's not much else you can do with the current prep Except for example
masking your glycans with a nice lectin such as griffithsin, which would be
very elegant for crystallography. Or indeed trying cryo-EM, where wild-type
N-linked glycans are extremely helpful! Why would anyone crystallize proteins
these days anyway :-)

Best wishes,

Radu
-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305
www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu

> Hi Savvas,
> Many Thanks for your inputs and references. This cell line used is not
HEK293S *MGAT1-/-. *This particular batch was purified from HEK293 cell-line
stably expressing (created using lenti-methods by a
> former colleague) the protein of interest. In future, I will plan to do
expression in the presence of Kifunensine, followed by EndoH treatment
before complexation and crystallization.
> Best Wishes,
> Partha
> On Mon, Jul 16, 2018 at 12:53 PM, Savvas Savvides 
wrote:
>> Dear Partha
>> you do not specify which HEK293 cell line you have used, but if it so
happens that it is the very handy HEK293S *MGAT1-/- *cell line
>> (previously known as HEK293S *GnTI-/- ) *which produces
>> N-linked Man5GlcNAc2 glycans you might want to consider using EndoH (e.g.
see Verstraete et al. DOI: 10.1038/ncomms14937) or even Jack-bean
alpha-mannosidase (e.g. see Bloch et al. https://doi.org/10.1016/j.
immuni.2017.12.008).
>> Kifunensine, an inhibitor of N-glycosylation processing, tends to work
quite well for protein expression in HEK293T and renders N-linked glycans
digestible by EndoH (see Chang et al. DOI 10.1016/j.str.2007.01.011 ; Felix
et al. http://dx.doi.org/10.1016/j.str.2015.06.019 ; Elegheert et al.
doi:10.1038/nsmb.2367).
>> If resources and protein material allow, you might also want to consider
the permutation exercise of subjecting the complex to deglycosylation, or
the individual components followed by complex formation/purification, or
just one of the two components followed by complex formation/purification,
or even one of the two components followed by further deglycosylation of
the complex. We are becoming more and more apprehensive of the possible
role of glycans in complex formation.
>> And then there is of course the option to apply mutagenesis, e.g. via
N—>Q, to eliminate certain N-linked glycans either as a standalone
approach
>> or in combination with enzymatic glycan digestions as described above. Best
wishes
>> Savvas
>> *---*
>> *Savvas Savvides*
>> VIB Center for Inflammation Research
>> Dept. Biochemistry & Microbiology, Ghent University
>> Technologiepark 927, B-9052 Ghent (Zwijnaarde), Belgium
>> +32 (0)472 928 519 (mobile) ; +32 9 331 36 60 (office) ; Skype:
savvas.savvides_skype
>> http://www.vib.be/en/research/scientists/Pages/Savvas-Savvides-Lab.aspx On
16 Jul 2018, at 20:53, Parthasarathy Sampathkumar 
wrote:
>> Dear All,
>> I am in a situation, almost for the first time within my limited
experience, that deglycosylation might be necessary to obtain crystal. So,
I thought of tapping to vast experience of CCP4BBers, while I am searching
literature.
>> I have protein that has been expressed in HEK293 cells, secreted into
media, purified over IMAC and SEC columns. Crystallization-screens with its
binding partners (they form good complexes based on analytical SEC) have
not produced any useful hits (whereas complexes with related proteins
worked well). So, I plan to re-try complex formation and \crystallization
screen after deglysosylation.
>> My question is: In practice, Does a kit (for example here: https://www.
sigmaaldrich.com/catalog/product/SIGMA/NDEGLY?lang=en=US) containing
Endo F1, F2, F3 be sufficient or should this be tried in combination with
PNGase (which requires
>> desaturating conditions)?!!
>> Many Thanks in advance for your suggestions, and reference.
>> Best Wishes,
>> Partha
>> --
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB=1
> 

Re: [ccp4bb] new ContaMiner features

[radu]

Hi Stefan,

I also owe you an apology for my bad choice of words. One can debate about
usefulness, but Pavel is right, the software is not "bizarre". And, as several
people pointed out, it certainly addresses a need (which I didn't know about).
Mea culpa.

Best wishes,

Radu


> Dear Gerard
>
> I am really sorry that my badly formulated 'final word of warning' has made
> you and others spend much time for composing well-formulated replies. I was
> at PX1 yesterday, and Leo reminded me of the issue, hence I included it
> into my message.
> You are absolutely right that reports of anomalies should go to the
> developers - however the issue here is already known (as shown in the
> STARANISO Warning message) and cannot be solved by us at the ContaMiner
> level. Given the popularity of Staraniso, I just wanted to inform our users
> that this particular issue is propagated into the ContaMiner results. I
> should have worded it more carefully.
>
> Many thanks to Leo and Pierre for helping explain!
>
> With best wishes
> Stefan
>
>
>
> On 24 November 2017 at 13:07, Gerard Bricogne <g...@globalphasing.com>
> wrote:
>
>> Dear Radu,
>>
>>  I would not want to take undue advantage of this already
>> voluminous thread, but your PS takes us into a different direction,
>> namely the whole myth-ridden topic of "weak data" - but that will be
>> for another thread, another time ;-) .
>>
>>
>>  With best wishes,
>>
>>   Gerard.
>>
>> --
>> On Fri, Nov 24, 2017 at 01:02:08AM -, r...@mrc-lmb.cam.ac.uk wrote:
>> > Hi Leo,
>> >
>> > I agree that the horror beamline stories you describe are far too common.
>> > Unfortunately, they start earlier, in the wet lab or even before.
>> Exactly the
>> > same attitude (careless construct design, crystallising whatever "dirty"
>> > samples, not bothering optimising cryoprotection and so on) leads to
>> wasting a
>> > lot of resources, including synchrotron time. In some cases, as people
>> pointed
>> > out, problems such as contaminations (and even more so anisotropic data,
>> for
>> > the matter) are unavoidable. But too often, as we all know, it's simply
>> bad
>> > practice, lack of training etc. Web servers can only help up to a
>> point...
>> >
>> > Best wishes,
>> >
>> > Radu
>> > PS: At least, one day, maximum-likelihood refinement programs will deal
>> with
>> > weak data satisfactorily :-) Nobody likes to throw data away.
>> >
>> >
>> > > Dear all,
>> > >
>> > > to join Pierre's comments on what 'strange' things happen at the
>> beamlines...
>> > > yet not too strange for (too) many people: huge screening of salt
>> crystals,
>> > > complete data collection of dramatically low resolution data, full
>> power
>> > > coupled with 360Deg data collection etc. etc. etc. We do unfortunately
>> see too
>> > > many 'blind shots, deal with it later, and move on' experiments that it
>> > > becomes depressive. I personally do not see why we would close our
>> eyes to
>> > > servers and/or data analysis tools that could help you think less, or
>> better
>> > > say help you understanding what is eventually happening with your data.
>> > >
>> > > Cheers, leo
>> > >
>> > > -
>> > > Leonard Chavas
>> > > -
>> > > Synchrotron SOLEIL
>> > > Proxima-I
>> > > L'Orme des Merisiers
>> > > Saint-Aubin - BP 48
>> > > 91192 Gif-sur-Yvette Cedex
>> > > France
>> > > -
>> > > Phone:  +33 169 359 746
>> > > Mobile: +33 644 321 614
>> > > E-mail: leonard.cha...@synchrotron-soleil.fr
>> > > -
>> > >
>> > >> On 24 Nov 2017, at 00:23, Edward A. Berry <ber...@upstate.edu> wrote:
>> > >>
>> > >> My 2 cents worth:
>> > >> I think contaminer is an extremely useful service. I may be a sloppy
>> > >> biochemist,
>> > >> but I am not the only one. There are multiple structures in the
>> database of
>> > >> say
>> > >> bacterioferritin or AcrB that were solved from crystals that were
>> supposed
>> > >> to
>> > >> be something else. I remember in a discussion with the organizer of my
>> > >> session
>> > >> at a Gordon conference, she excitedly 

Re: [ccp4bb] new ContaMiner features

[radu]

Hi Leo,

I agree that the horror beamline stories you describe are far too common.
Unfortunately, they start earlier, in the wet lab or even before. Exactly the
same attitude (careless construct design, crystallising whatever "dirty"
samples, not bothering optimising cryoprotection and so on) leads to wasting a
lot of resources, including synchrotron time. In some cases, as people pointed
out, problems such as contaminations (and even more so anisotropic data, for
the matter) are unavoidable. But too often, as we all know, it's simply bad
practice, lack of training etc. Web servers can only help up to a point...

Best wishes,

Radu
PS: At least, one day, maximum-likelihood refinement programs will deal with
weak data satisfactorily :-) Nobody likes to throw data away.


> Dear all,
>
> to join Pierre's comments on what 'strange' things happen at the beamlines...
> yet not too strange for (too) many people: huge screening of salt crystals,
> complete data collection of dramatically low resolution data, full power
> coupled with 360Deg data collection etc. etc. etc. We do unfortunately see too
> many 'blind shots, deal with it later, and move on' experiments that it
> becomes depressive. I personally do not see why we would close our eyes to
> servers and/or data analysis tools that could help you think less, or better
> say help you understanding what is eventually happening with your data.
>
> Cheers, leo
>
> -
> Leonard Chavas
> -
> Synchrotron SOLEIL
> Proxima-I
> L'Orme des Merisiers
> Saint-Aubin - BP 48
> 91192 Gif-sur-Yvette Cedex
> France
> -
> Phone:  +33 169 359 746
> Mobile: +33 644 321 614
> E-mail: leonard.cha...@synchrotron-soleil.fr
> -
>
>> On 24 Nov 2017, at 00:23, Edward A. Berry <ber...@upstate.edu> wrote:
>>
>> My 2 cents worth:
>> I think contaminer is an extremely useful service. I may be a sloppy
>> biochemist,
>> but I am not the only one. There are multiple structures in the database of
>> say
>> bacterioferritin or AcrB that were solved from crystals that were supposed
>> to
>> be something else. I remember in a discussion with the organizer of my
>> session
>> at a Gordon conference, she excitedly announced that there would be
>> preliminary
>> crystallographic data on respiratory Complex I. But by the time of the
>> conference
>> the authors discovered they had crystallized something else. And the
>> beautiful crystals
>> of Paracoccus Complex II (from Doug Rees's lab?) that graced the catalog of
>> Hampton Research (And I believe were part of the basis for the first
>> membrane
>> protein screen) never saw publication.  The authors of
>>  http://www.sciencedirect.com/science/article/pii/S0304416506000894
>> certainly feel there is a real problem.  Some proteins crystallize readily
>> even when
>> present as minor contaminants. And some protein complexes become more
>> heterogeneous
>> if over-purified due to partial loss of loosely-bound subunits.
>> Most of my career I've worked with high-abundance natural-source proteins.
>> During a recent foray into the realm of overexpressed proteins, my group
>> has
>> crystallized (and solved) at least a half dozen wrong proteins from E.
>> coli.
>> I spent months on one of these (ATCase in Rhomb sg with low-level
>> obverse/reverse
>> twinning that caused it to sometimes index as P3) Then solved the rest
>> rapidly
>> by checking the closest several hits with nearest-cell.  All of these E.coli
>> proteins
>> were already present in the PDB. I wonder how many were from accidental
>> crystals.
>> And now bacterioferritin (this time from M. smegmatis) keeps coming back to
>> haunt us.
>>
>> I would say any time with a new crystal when a molecular replacement
>> unexpectedly fails,
>> and even before you start to collect heavy atom or selenomet data, it would
>> be worth
>> to submit to nearest-cell and contaminer. I would be more likely to question
>> the
>> utility of an anisotropy correction server, given that modern
>> maximum-likelihood
>> refinement programs can deal with weak data satisfactorily (speaking from
>> ignorance- I'm sure supporting evidence and examples exist, I just haven't
>> bothered to look them up. And I know my colleagues here at Upstate have
>> used
>> anisotropy correction to good effect with a difficult problem- I hope they
>> weren't using filled-in maps!)
>> eab
>>
>> On 11/23/2017 03:24 PM, Tristan Croll wrote:
>>> Dear Radu,
>>>
>>> I think this is a little harsh. Biology is a fabulously messy thing, and
>>> very prone t

Re: [ccp4bb] new ContaMiner features

[radu]

Hi Tom, Tristan, Pierre,

So long that some people find ContaMiner useful, than fair enough :-) But I
still find it really hard to believe that this is a "common" occurrence. Maybe
"regular" at beamlines (who are not to blame of course), but I doubt that
frequency is high. Otherwise, they should really keep away from certain users
;-))

For curiosity I've checked with people around (I happen to be in Oxford
tonight), including some previously involved in running a rather successful,
and high throughput, structural genomics facility here. The answers were, so
far, all negative (i.e. thankfully haven't encountered of such accidents). I'm
wondering whether "crystallisation contaminants" might be related to a
particular type of targets, or expression system, or purification
strategies... I'll check the paper Tristan suggested when I get the chance.

Best wishes,

Radu


> I agree with Tristan, it can be quite easy to crystallise a contaminant even
> when one is trying to be careful during the purification process.
> Before everyone had a mass spec, looking at gels didn't tell you as much as
> you needed to know, as many proteins don't stain well, so are hard to see on
> the gel (and as mentioned, can be in very small quantities and still
> crystallise).
>
> Cheers, tom
>
> -Original Message-
> From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of
> r...@mrc-lmb.cam.ac.uk
> Sent: Friday, 24 November 2017 6:36 AM
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: Re: [ccp4bb] new ContaMiner features
>
> Dear Stefan,
>
> Just a couple of thoughts:
>
> - first of all I think that Gerard is absolutely right, it would have been
> nice to raise such issues first with the developers. In my experience,
> Staraniso does a fantastic job if used correctly.
>
> - but if you're OK with public trials, may I ask: why on Earth would anybody
> need ContaMiner? Are you trying to offer some sort of computational cure for
> sloppy biochemistry? There is zero point in crystallizing crap samples, sorry
> to say this. In my 17 or so years in Strubi I've never heard of anybody
> crystallizing a "contaminant", being it a purification tag or whatever.
>
> I suppose this might have happened to somebody you know, hence the motivation
> to spend time on the bizarre ContaMiner. Which is a pity, a silly outcome
> would only teach people to do their job (or train their robots) properly.
>
> Best wishes,
>
> Radu
>
> --
> Radu Aricescu
> MRC Laboratory of Molecular Biology
> Francis Crick Avenue
> Cambridge Biomedical Campus
> Cambridge CB2 0QH, U.K.
> tel: +44-(0)1223-267049
> fax: +44-(0)1223-268305
> www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu
>
>> Dear Stefan,
>>
>>  Regarding your final paragraph: your server carries a warning
>> with the exact wording:
>>
>>  "Submitting StarAniso files can give you suspicious results. Use
>> with care!"
>>
>>  It seems rather regrettable that you are posting such a public
>> warning without ever having contacted the STARANISO developers about
>> your observations, nor giving any information about what you call
>> "suspicious" or what the "care" you recommend would consist of.
>>
>>  We have taken a great deal of care ourselves in developing the
>> program and offering it to the community through a server, and the
>> least we would have expected is that any pattern of "suspicious"
>> results would be referred to us so that we could investigate them.
>> There may be some assumptions made in MoRDa that we are not aware of,
>> that might be incompatible with assumptions made in STARANISO - who
>> knows? Or it could be that some particularly badly collected datasets
>> are made to look worse after their anisotropy analysis.
>>
>>  Could we discuss your observations, and what it is exactly that
>> you call "suspicious", before they end up being referred to in such an
>> uninformative manner as some sort of "Government Health Warning"?
>>
>>  I think that would be nice :-) and we would be only too keen to
>> take whatever extra "care" is needed ourselves. We would all learn
>> something.
>>
>>
>>  With best wishes,
>>
>>   Gerard.
>>
>> (on behalf of the STARANISO developers)
>>
>> --
>> On Thu, Nov 23, 2017 at 05:02:39PM +0100, Stefan Arold wrote:
>>> Dear Community,
>>>
>>> A quick message to announce the following two new features on our
>>> ContaMiner web server for the automated detection of unwantedly
>>> 

Re: [ccp4bb] new ContaMiner features

[radu]

Dear Stefan,

Just a couple of thoughts:

- first of all I think that Gerard is absolutely right, it would have been
nice to raise such issues first with the developers. In my experience,
Staraniso does a fantastic job if used correctly.

- but if you're OK with public trials, may I ask: why on Earth would anybody
need ContaMiner? Are you trying to offer some sort of computational cure for
sloppy biochemistry? There is zero point in crystallizing crap samples, sorry
to say this. In my 17 or so years in Strubi I've never heard of anybody
crystallizing a "contaminant", being it a purification tag or whatever.

I suppose this might have happened to somebody you know, hence the motivation
to spend time on the bizarre ContaMiner. Which is a pity, a silly outcome
would only teach people to do their job (or train their robots) properly.

Best wishes,

Radu

-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305
www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu

> Dear Stefan,
>
>  Regarding your final paragraph: your server carries a warning
> with the exact wording:
>
>  "Submitting StarAniso files can give you suspicious results. Use
> with care!"
>
>  It seems rather regrettable that you are posting such a public
> warning without ever having contacted the STARANISO developers about
> your observations, nor giving any information about what you call
> "suspicious" or what the "care" you recommend would consist of.
>
>  We have taken a great deal of care ourselves in developing the
> program and offering it to the community through a server, and the
> least we would have expected is that any pattern of "suspicious"
> results would be referred to us so that we could investigate them.
> There may be some assumptions made in MoRDa that we are not aware of,
> that might be incompatible with assumptions made in STARANISO - who
> knows? Or it could be that some particularly badly collected datasets
> are made to look worse after their anisotropy analysis.
>
>  Could we discuss your observations, and what it is exactly that
> you call "suspicious", before they end up being referred to in such an
> uninformative manner as some sort of "Government Health Warning"?
>
>  I think that would be nice :-) and we would be only too keen to
> take whatever extra "care" is needed ourselves. We would all learn
> something.
>
>
>  With best wishes,
>
>   Gerard.
>
> (on behalf of the STARANISO developers)
>
> --
> On Thu, Nov 23, 2017 at 05:02:39PM +0100, Stefan Arold wrote:
>> Dear Community,
>>
>> A quick message to announce the following two new features on our
>> ContaMiner web server for the automated detection of unwantedly
>> crystallised contaminants (
>> https://strube.cbrc.kaust.edu.sa/contaminer/submit)
>>
>> 1) online visualisation of 2FoFc and FoFc maps. In cases of positive
>> results, the ‘UglyMol’ tab allows to inspect 2FoFc and FoFc maps
>> directly
>> in the web browser. Thi
>>
>> 2) life-update. Previously, results were sent to you once all ~2000 MR jobs
>> were finished. Now, the individual results for each potential contaminant
>> will appear as soon as they are finished. This feature should substantially
>> shorten the time for identifying positive results (i.e. contaminant
>> detected), which are terminated faster than negative ones.
>>
>> 3) custom contaminants. In the ‘Advanced’ tab, users can upload own PDB
>> files (more than one is possible) to be included as search models. This
>> feature can be used to include PDB files from your lab bench neighbour’s
>> project to test for potential lab internal contaminations (through
>> bacterial contamination or through mix-up of plasmids or glycerol stocks).
>> This feature could also be ‘abused’ as a means to use the MoRDa pipeline
>> to
>> run molecular replacements with template structures that are not yet
>> deposited in the PDB; for example to run molecular replacement and initial
>> refinement for liganded or complexed versions of an unpublished structure.
>> This might be particularly interesting for crystallographers away from
>> their usual home software environment (e.g. at the beamline).
>>
>> Finally, a word of warning – Staraniso files might give false positives if
>> they have large anisotropic cuts.
>>
>> Keep your crystals clean!
>>
>> With best wishes
>>
>> The ContaMiner Team
>
> --
>
>  =

Re: [ccp4bb] Large scale mammalian expression system recommendation?

[radu]

Hi Nate,

There can be no consensus I guess, most importantly because transmembrane
proteins are so diverse :-)

We typically use transient transfection at the screening stage, and often for
large-scale expression (e.g. PMID 24909990). Bac-Mam has some advantages
(nicely described in 25299155, 27041595), but it's obviously more time
consuming. Lentiviral systems (we use Clontech) are also great.

But again the target often determines the choice of system. Whether it
contains multiple subunits, whether overexpression has a negative impact on
cell health (a tetO switch can be helpful, 12370422). Also, I'd use different
systems depending whether the recombinant protein is intended for functional,
fluorescence microscopy, structural analyses (say X-ray vs cryo-EM).

Best wishes,

radu
-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305
www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu


> Hello everyone,
>
> I wonder if there is a consensus for what is currently the best system to
> express transmembrane proteins in mammalian cells?
>
> I think that baculovirus transduction ("Bacmam" anf the likes) has been
> used historically more (?) but would like to know if the modern adenovirus
> systems offer any advantages in terms of expression levels. I used both in
> the past but not for transmembrane proteins and never compared them back to
> back for the same protein.
>
> Has anyone attempted a direct comparison? (It has to be mammalian cells, so
> baculovirus/insect cells won't do).
>
> Thanks for any comments/insights,
>
> Nate
>

Re: [ccp4bb] Error in assignment of symmetry operators

[radu]

Dear Gerard,

Thank you for the answer, absolutely not a problem! I am very grateful for all
the great software from Global Phasing and I know that support is great.
Enjoying the STARANISO server for example atm.

Best wishes,

Radu


> Dear Radu,
>  Nice to know that your problem is sorted and that you are pleased
> with the results you are getting from BUSTER.
>  Clemens had drafted an answer along exactly the same lines and
> circulated it around the team for comments, but we were momentarily
distracted by something else and the CCP4BB experts beat us to it :-)
>  I should say that this is not a representative case: we usually
> respond quickly and spare no pains to give users the help they need.
>  With best wishes,
>   Gerard.
> --
> On Tue, Jun 20, 2017 at 05:02:24PM +0100, r...@mrc-lmb.cam.ac.uk wrote:
>> Hi Robbie, Pietro,
>> Thank you for the quick replies! I tried this before, but must have messed up
>> things afterwards somehow... Anyway, tried again and now Buster works
beautifully. Indeed the molecule was a couple of unit cells away from the
origin, as the error message suggests... My fault.
>> Best wishes,
>> Radu
>> > Hi Radu,
>> > This may be caused by the coordinates being too many unit cells away from
>> the
>> > origin. In COOT you can easily ?symmetry move coordinates here?  to a
>> place
>> closer to the origin.
>> > Hope this helps,
>> > Robbie
>> > Sent from my Windows 10 phone
>> > Van: r...@mrc-lmb.cam.ac.uk<mailto:r...@mrc-lmb.cam.ac.uk>
>> > Verzonden: dinsdag 20 juni 2017 16:14
>> > Aan: CCP4BB@JISCMAIL.AC.UK<mailto:CCP4BB@JISCMAIL.AC.UK>
>> > Onderwerp: [ccp4bb] Error in assignment of symmetry operators Dear All,
>> > Apologies for posting a Buster-related question to this list, the
>> buster-discuss one seems less active :-) I am trying to run a refinement job,
>> > and hit the following problem:
>> > ERROR : [run_buster-0046] unable to create initial SCREEN
>> > output with gelly - see
>> > refine/01-BUSTER/Cycle-1/gelly_screen.log)
>> > Looking in the gelly_screen.log, the problem reported is:
>> >  Getting symmetry operators from TNT.
>> >  gelly will classify symmetry using pdb-like convention:
>> >   SYMOP   SYMMETRY
>> >  NNNMMM   OPERATOR
>> >1555   X,Y,Z
>> >2555   -X,Y,-Z
>> >3555   1/2+X,1/2+Y,Z
>> >4555   1/2-X,1/2+Y,-Z
>> >  where NNN -> operator number and MMM -> translation vector
>> > *** ERROR in assignment of symmetry operators NNNMMM (M<1 or M>9). ***
>> ERROR
>> maybe the molecules are far away from the origin.
>> > I tried everything I could think of to fix this, no luck so far I'm
>> probably making a very silly mistake... But would be very grateful for any
advice!
>> > Best wishes,
>> > Radu
>> > PS: space group is C2
>> > --
>> > Radu Aricescu
>> > MRC Laboratory of Molecular Biology
>> > Francis Crick Avenue
>> > Cambridge Biomedical Campus
>> > Cambridge CB2 0QH, U.K.
>> > tel: +44-(0)1223-267049
>> > fax: +44-(0)1223-268305
>> > www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu

Re: [ccp4bb] Error in assignment of symmetry operators

[radu]

Hi Robbie, Pietro,

Thank you for the quick replies! I tried this before, but must have messed up
things afterwards somehow... Anyway, tried again and now Buster works
beautifully. Indeed the molecule was a couple of unit cells away from the
origin, as the error message suggests... My fault.

Best wishes,

Radu


> Hi Radu,
> This may be caused by the coordinates being too many unit cells away from
the
> origin. In COOT you can easily ‘symmetry move coordinates here’  to a place
closer to the origin.
> Hope this helps,
> Robbie
> Sent from my Windows 10 phone
> Van: r...@mrc-lmb.cam.ac.uk<mailto:r...@mrc-lmb.cam.ac.uk>
> Verzonden: dinsdag 20 juni 2017 16:14
> Aan: CCP4BB@JISCMAIL.AC.UK<mailto:CCP4BB@JISCMAIL.AC.UK>
> Onderwerp: [ccp4bb] Error in assignment of symmetry operators
> Dear All,
> Apologies for posting a Buster-related question to this list, the
buster-discuss one seems less active :-) I am trying to run a refinement
job,
> and hit the following problem:
> ERROR : [run_buster-0046] unable to create initial SCREEN
> output with gelly - see
> refine/01-BUSTER/Cycle-1/gelly_screen.log)
> Looking in the gelly_screen.log, the problem reported is:
>  Getting symmetry operators from TNT.
>  gelly will classify symmetry using pdb-like convention:
>   SYMOP   SYMMETRY
>  NNNMMM   OPERATOR
>1555   X,Y,Z
>2555   -X,Y,-Z
>3555   1/2+X,1/2+Y,Z
>4555   1/2-X,1/2+Y,-Z
>  where NNN -> operator number and MMM -> translation vector
> *** ERROR in assignment of symmetry operators NNNMMM (M<1 or M>9). *** ERROR
maybe the molecules are far away from the origin.
> I tried everything I could think of to fix this, no luck so far.... I'm
probably making a very silly mistake... But would be very grateful for any
advice!
> Best wishes,
> Radu
> PS: space group is C2
> --
> Radu Aricescu
> MRC Laboratory of Molecular Biology
> Francis Crick Avenue
> Cambridge Biomedical Campus
> Cambridge CB2 0QH, U.K.
> tel: +44-(0)1223-267049
> fax: +44-(0)1223-268305
> www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu

[ccp4bb] Error in assignment of symmetry operators

[radu]

Dear All,

Apologies for posting a Buster-related question to this list, the
buster-discuss one seems less active :-) I am trying to run a refinement job,
and hit the following problem:

ERROR : [run_buster-0046] unable to create initial SCREEN
output with gelly - see
refine/01-BUSTER/Cycle-1/gelly_screen.log)

Looking in the gelly_screen.log, the problem reported is:

 Getting symmetry operators from TNT.
 gelly will classify symmetry using pdb-like convention:
  SYMOP   SYMMETRY
 NNNMMM   OPERATOR
   1555   X,Y,Z
   2555   -X,Y,-Z
   3555   1/2+X,1/2+Y,Z
   4555   1/2-X,1/2+Y,-Z
 where NNN -> operator number and MMM -> translation vector

*** ERROR in assignment of symmetry operators NNNMMM (M<1 or M>9).
*** ERROR maybe the molecules are far away from the origin.

I tried everything I could think of to fix this, no luck so far I'm
probably making a very silly mistake... But would be very grateful for any
advice!

Best wishes,

Radu
PS: space group is C2

-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305
www: http://www2.mrc-lmb.cam.ac.uk/group-leaders/a-to-g/radu-aricescu

[ccp4bb] Fwd: Re: [ccp4bb] Glycoprotein expression question

[radu]

Hi Savvas,

Thank you for kindly pointing to our review. Bernhard, in my experience your
case is a rare exception rather than the rule, so indeed lucky. Adrian
summarised very nicely the wide impact glycans may have on folding,
trafficking and/or function. To keep things simple, there is no need to mutate
the N-glycosilation sites for structural work (other than perhaps to probe
their impact, but people don't seem to do this normally). PMID: 17355862
describes how to deal with these if the aim is to improve crystal quality. For
cryo-EM, glycans should definitely stay on. Why would one risk solving
meaningless structures?

Best wishes,

Radu

-- 
Radu Aricescu
MRC Laboratory of Molecular Biology
Francis Crick Avenue
Cambridge Biomedical Campus
Cambridge CB2 0QH, U.K.
tel: +44-(0)1223-267049
fax: +44-(0)1223-268305


 Original message 
>Date: Wed, 12 Apr 2017 10:24:10 +0200
>From: CCP4 bulletin board <CCP4BB@JISCMAIL.AC.UK> (on behalf of Savvas
Savvides <savvas.savvi...@ugent.be>)
>Subject: Re: [ccp4bb] Glycoprotein expression question
>To: CCP4BB@JISCMAIL.AC.UK
>
>Dear Bernhard
>Our campaigns over the years aiming to produce mammalian cytokines and the
ectodomains of cytokine receptors via eukaryotic expression systems (mainly
in several HEK293 flavors) for structural biology, have taught us that the
N-linked glycosylation issue remains a very empirical exercise. Our protein
targets are typically 15-70 kDa and have 2-6 predicted N-linked glycosylation
sites. For instance, we have seen that elimination of even one such site by
mutagenesis can abrogate protein secretion. So for those cases one may even
make an argument for a glycosylation ‘hotspot'.  Also, eliminating all
possible N-linked glycosylation sites at once in the couple of cases tried
has been synonymous with zero protein secretion. Our consensus of the
‘magic combo’ in terms of expression levels and stability is a reduction
of N-linked glycosylation sites by up to 1/3. Such reduced levels of
glycosylation also appear to be amenable for enzymatic glycan trimming in
subsequent stages of sample preparation with good results.
>The article http://dx.doi.org/10.1016/j.sbi.2013.04.003 by Aricescu and Owens
may provide some additional perspectives.
>
>best wishes
>Savvas
>
>
>> On 11 Apr 2017, at 22:34, Bernhard Rupp <hofkristall...@gmail.com> wrote:
>>
>> Hi Fellows,
>>
>> a humble question for our glyco-expressionists:
>>
>> I have mutated out the Asns of the N-glycoslation consensus sites for Asp
>> (Asp simply because the PNGaseF treated protein stays stable so I thought
that might be a good guess)
>> and indeed the unglycosilated mutant expresses well and gets secreted as
planned.
>>
>> But rumor has it that glycoproteins that are mutated to non-glyc often are
not processed correctly and
>> that we had just dumb luck.
>>
>> May I poll the educated opinion of the erudite here?
>>
>> Cheers, BR
>>
>> --
>> Bernhard Rupp
>> Crystallographiae Vindicis Militum Ordo
>> http://www.hofkristallamt.org/
>> b...@hofkristallamt.org
>> +1 925 209 7429
>> +43 767 571 0536
>> --
>> :(){ :|: & };:
>> --

Re: [ccp4bb] FW: [ccp4bb] Fwd: [ccp4bb] just out of totally idle curiosity ...

[Radu Aricescu]

Hi JPK,
Not sure about them, but I was a bit surprised to get this ID a couple of years ago: 4COF!
Nice structure nevertheless :-)
Best wishes,
Radu
On 9 Nov 2016 10:40 p.m., "Keller, Jacob" <kell...@janelia.hhmi.org> wrote:
>
> I recently was surprised to be looking at a structure with the unfortunate PDBID of 5HIT. I wonder what the authors thought when they got this ID back from RCSB!
>
>  
>
> JPK
>
>  
>
> From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of Robbie Joosten
> Sent: Wednesday, November 09, 2016 4:18 PM
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: Re: [ccp4bb] FW: [ccp4bb] Fwd: [ccp4bb] just out of totally idle curiosity ...
>
>  
>
> There is nothing wrong with discussing sex at work, either theorethical http://www.rcsb.org/pdb/search/structidSearch.do?structureId=1sex or experimental http://www.rcsb.org/pdb/explore/explore.do?structureId=3sex 
>
>  
>
>  
>
>  
>
> Sent from my Windows 10 phone
>
>  
>
> Van: Reza Khayat
> Verzonden: woensdag 9 november 2016 21:43
> Aan: CCP4BB@JISCMAIL.AC.UK
> Onderwerp: Re: [ccp4bb] FW: [ccp4bb] Fwd: [ccp4bb] just out of totally idle curiosity ...
>
>  
>
> I Agree with Edward. No discussion of politics, religion, or sex at work.
>
>  
>
> Best wishes,
>
> Reza
>
>  
>
> Reza Khayat, PhD
>
> Assistant Professor 
>
> City College of New York
>
> Department of Chemistry
>
> New York, NY 10031
>
> 
>
> From: CCP4 bulletin board <CCP4BB@JISCMAIL.AC.UK> on behalf of Gloria Borgstahl <gborgst...@gmail.com>
> Sent: Wednesday, November 9, 2016 1:24 PM
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: Re: [ccp4bb] FW: [ccp4bb] Fwd: [ccp4bb] just out of totally idle curiosity ...
>
>  
>
> Eddie Snell for President
>
>  
>
> On Wed, Nov 9, 2016 at 11:02 AM, Edward Snell <esn...@hwi.buffalo.edu> wrote:
>>
>> As a Brexit and Trumpet affected person having a foot in both countries ,this topic is too far off the normal discussion on CCP4 and probably better taken up privately.  CCP4 is not a political discussion site. With CCP4 the signal is unusually high and the noise low when compared to any discussion board. I for one would like to keep it there. Political views aside, we’re all trying to achieve the same scientific goals. Let’s remember that and keep that the focus.
>>
>>  
>>
>> Edward Snell Ph.D.
>>
>> President and CEO Hauptman-Woodward Medical Research Institute
>>
>> Assistant Prof. Department of Structural Biology, University at Buffalo
>>
>> 700 Ellicott Street, Buffalo, NY 14203-1102
>>
>> Phone: (716) 898 8631 Fax: (716) 898 8660
>>
>> Skype:  eddie.snell Email: esn...@hwi.buffalo.edu 
>>
>> Heisenberg was probably here!
>>
>>  
>
>  

Re: [ccp4bb] Trimming of carbohydrate chains

[A. Radu Aricescu]

Dear Herman,

Assuming that the protein is eukaryotic, and glycans N-linked, various ways of 
dealing with the issue are described in PMID: 17355862.

Best wishes,

radu


--
A. Radu Aricescu, PhD
MRC Senior Research Fellow
Associate Professor

University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547
https://www.strubi.ox.ac.uk/research/a-radu-aricescu


 Original message 
Date: Wed, 15 Oct 2014 13:03:13 +
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of 
herman.schreu...@sanofi.com)
Subject: [ccp4bb] Trimming of carbohydrate chains  
To: CCP4BB@JISCMAIL.AC.UK

Dear Bulletin Board,

I am struggling with a protein domain of 15 kDa, with about 22 kDa 
carbohydrate attached. So far, the domain did not crystallize and I suspect 
the carbohydrate may hinder crystallization. Completely removing the 
carbohydrate results in low expression yields and poorly soluble protein, so I 
would like to try to remove some, but not all carbohydrate. Does anyone has a 
good protocol to trim, but not completely remove the carbohydrate?

Thank you,
Herman Schreuder 

Re: [ccp4bb] Sighting of Protein Crystals in Vivo?!

[A. Radu Aricescu]

Hi Jacob,

They are not too small to mount I think, at least 20 microns long (compared to 
the size of surrounding cells). But what do you mean by littered? There seems 
to be just one cell with crystals out of say 10 expressing eGFP. And why are 
there only 10 or so expressing GFP out of ~200 or more cells in the field? This 
does not look like transient expression using a normal plasmid...

Very intriguing nevertheless!

radu

--
A. Radu Aricescu, PhD
University Research Lecturer

University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547


 Original message 
Date: Fri, 15 Feb 2013 14:44:32 -0500
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Jacob Keller 
j-kell...@fsm.northwestern.edu)
Subject: [ccp4bb] Sighting of Protein Crystals in Vivo?!  
To: CCP4BB@JISCMAIL.AC.UK

   Dear Crystallographers,
   I was looking at some live, control HEK cells
   expressing just eGFP, and to my great surprise, saw
   littered across the dish what appeared to be small
   fluorescent needles (see attached--sorry about the
   size, but it's only ~1MB total.) Can these possibly
   be fortuitous protein crystals? They were too small
   to mount I think, and for what it's worth,
   parallel-transfected HeLa cells did not have these
   things. But, some needles could be seen in the DIC
   images as well, and the needles were only
   fluorescent with GFP filter sets, and not CFP, YFP,
   or texas red filters. I thought of whale myoglobin
   crystallizing on the decks of ships, but never
   thought I would see this
   Jacob

   --
   ***
   Jacob Pearson Keller, PhD
   Postdoctoral Associate
   HHMI Janelia Farms Research Campus
   email: j-kell...@northwestern.edu
   ***

GFP_crystals_DIC.png (938k bytes)

GFP_crystals_Fluorescence.png (586k bytes)

[ccp4bb] Postdoctoral position, C2D2, University of York

[A. Radu Aricescu]

An exciting junior postdoc opportunity, ideal for the structure-educated 
biochemist looking to brush-up their maths skills (or finally put them to some 
good use :-)): Mathematical modelling of bi-­directional synaptic signalling

Details at:

http://www.nature.com/naturejobs/science/jobs/303788-Discipline-hopping-internships

or

http://www.york.ac.uk/c2d2/internships/

For informal enquiries contact: radu.caline...@york.ac.uk


--
A. Radu Aricescu, PhD
University Research Lecturer

University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547


 Original message 
Date: Tue, 29 Jan 2013 10:46:09 +
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Andrew Carter 
cart...@mrc-lmb.cam.ac.uk)
Subject: [ccp4bb] Postdoctoral position  MRC Laboratory of Molecular Biology, 
Cambridge, UK  
To: CCP4BB@JISCMAIL.AC.UK

   An opportunity is available for a postdoctoral
   researcher to work on structural or single molecule
   studies of the microtubule motor dynein. The project
   aims to characterise functionally relevant parts of
   the cytoplasmic dynein complex in order to
   understand its motility, regulation and interaction
   with cargos. There will be opportunities to combine
   structural biology with assays that take advantage
   of single molecule fluorescence microscopy.



   I am looking for an enthusiastic individual who is
   likely to thrive in a laboratory with a friendly and
   supportive atmosphere. You should have a PhD in a
   relevant biological subject and a desire to
   understand dynein's structure and function.
   Experience is required in one or more of the
   following areas: molecular biology, protein
   expression, protein crystallisation or single
   molecule biophysics.



   Successful applicants will be awarded a three-year
   Career Development Fellowship. The fellowship is a
   training and development position for a
   post-doctoral scientist who has recently completed
   their doctoral studies, is moving into a new
   research discipline or has limited experience of key
   transferable skills.



   Applications are handled by the RCUK Shared Services
   Centre; to apply please visit our job board at
   www.topcareer.jobs. If you are unable to apply
   online please contact us on 01793 867003 quoting
   reference IRC80031



   For more information about the position please
   contact me (Andrew Carter)
   (cart...@mrc-lmb.cam.ac.uk) or visit my lab website
   at http://www2.mrc-lmb.cam.ac.uk/groups/cartera



   Best wishes

   Andrew

Re: [ccp4bb] install crystallography software on mac

[A. Radu Aricescu]

Best place to start:

http://scottlab.ucsc.edu/~wgscott/xtal/wiki/index.php/Crystallography_on_OS_X


--
A. Radu Aricescu, PhD
University Research Lecturer

University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547


 Original message 
Date: Mon, 28 Jan 2013 17:09:30 +0800
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of LISA 
science...@gmail.com)
Subject: [ccp4bb] install crystallography software on mac  
To: CCP4BB@JISCMAIL.AC.UK

   Hi all,
   I am trying to install ccp4, phenix, coot and other
   crystallography software on my mac. I am not
   familiar with mac, neither Linux system. Please give
   me some protocols to install these software and how
   to update them. I appreciate it.

   Lisa

Re: [ccp4bb] The effect of His-tag location on crystallization

[A. Radu Aricescu]

Or indeed support surreal structures :-))
(PMID: 11853672 vs PMID: 14749821 and so on)

--
A. Radu Aricescu, PhD
University Research Lecturer
MRC Career Development Award Fellow

University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547


 Original message 
Date: Wed, 27 Jun 2012 12:21:22 -0400
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Bosch, 
Juergen jubo...@jhsph.edu)
Subject: Re: [ccp4bb] The effect of His-tag location on crystallization  
To: CCP4BB@JISCMAIL.AC.UK

   Here's another example:
   http://www.pdb.org/pdb/explore/explore.do?structureId=2F62
   dimer with His-tag-ears without His6-tag this
   would not have been possible.
   Jürgen
   On Jun 27, 2012, at 12:04 PM, Brad Bennett wrote:

 I think it was an N-terminal RGS-type His tag in
 3O8Y (human lipoxygenase) that mediated crystal
 contacts with a symmetry related molecule. As I
 recall, this tag composed a B-strand that formed a
 nice interface with a native B-strand of the
 symmetry related molecule. Pretty cool...
 -Brad

 On Wed, Jun 27, 2012 at 11:00 AM, Phoebe Rice
 pr...@uchicago.edu wrote:

   With Flp recombinase - DNA complexes, a
   C-terminal His tag triggered a different (but
   sadly not better) crystal form, and the His side
   chains packed against the bases at the end of a
   neighboring DNA duplex.

   =
   Phoebe A. Rice
   Dept. of Biochemistry  Molecular Biology
   The University of Chicago
   phone 773 834 1723
   
 http://bmb.bsd.uchicago.edu/Faculty_and_Research/01_Faculty/01_Faculty_Alphabetically.php?faculty_id=123
   http://www.rsc.org/shop/books/2008/9780854042722.asp

    Original message 
   Date: Wed, 27 Jun 2012 10:14:58 -0400
   From: CCP4 bulletin board
   CCP4BB@JISCMAIL.AC.UK (on behalf of R. M.
   Garavito rmgarav...@gmail.com)
   Subject: Re: [ccp4bb] The effect of His-tag
   location on crystallization
   To: CCP4BB@JISCMAIL.AC.UK
   
  Most of the comments you will get will be
   anecdotal
  in that people will report the successful
   results
  and do not take the time or effort to
   characterize
  the less successful results.  This often
   occurs
  because the tagged portion of the protein is
   most
  often disordered, even in the best crystals.
Thus,
  other than saying tagging on this end
   works, but
  tagging on that end doesn't, there is
   little more
  you can say.  Each case will be different,
   and it is
  almost impossible to arrive at any
   generalized
  conclusion.
  We prefer C-terminal tagged proteins for a
   number of
  reasons, but if an N-terminally tagged
   protein
  crystallizes well, so be it.  Of the dozens
   of N-
  and C-tagged protein structures we have
   solved in my
  lab and with collaborators, I have only seen
   one
  case of an ordered His-tag:  the His
   residues had
  coordinated Cd ions, which proved essential
   for
  getting good crystals.  However, beyond that
   there
  was not much more to say.
  For your protein and the resulting crystals,
   an
  N-terminally tagged protein crystallized
   well.
   Whether you can draw any more conclusions
   from
  these results depends on characterizing
   crystals of
  both N- and C-tagged proteins.  Just
   assuming that
  the C-tagged protein is trying to
   crystallize in the
  same or related crystal form as the N-tagged
   protein
  is an unwarranted assumption without
   experimental
  evidence to back it up.  That is why most
   groups
  just run with the winner.
  Cheers,
  Michael
   
   
  R. Michael Garavito, Ph.D.
  Professor of Biochemistry  Molecular
   Biology
  603 Wilson Rd., Rm. 513
  Michigan State University
  East Lansing, MI 48824-1319
  Office:  (517) 355-9724 Lab:  (517)
   353-9125
  FAX:  (517) 353-9334
   Email:  rmgarav...@gmail.com
   
   
  On Jun 26, 2012, at 9:06 PM, weliu wrote:
   
Dear all,
   
We crystallized a protein and found that
   crystal
quality greatly depended on the location
   of
His-tag. When a His-tag was added at the
C-terminus, only crystalline

Re: [ccp4bb] mammalian expression vector

[A. Radu Aricescu]

Hi Jerry,

You may find that pcDNA3.1 won't give you the protein yields needed for 
crystallization. Have a look at PMID: 17001101 for an alternative. Your Kozak 
sequence looks good,

radu

--
A. Radu Aricescu, PhD
University Research Lecturer
MRC Career Development Award Fellow

University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547


 Original message 
Date: Tue, 13 Mar 2012 19:36:30 -0700
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Jerry McCully 
for-crystallizai...@hotmail.com)
Subject: [ccp4bb] mammalian expression vector  
To: CCP4BB@JISCMAIL.AC.UK

   Dear ALL;

 As an alternative strategy to avoid endotoxin,
   I plan to express the protein in mammalian cells.

 As suggested by others, the typical vector is
   pcDNA3.1(+).  Does anyone have comments on this
   vector or recommend some other powerful vectors?

I am new to mammalian expression. I designed a
   Kozak sequence followed by a BSA signal peptide in
   order to clone the target into pcDNA3.1(+).

 Is it right?  Tentative Kozak sequence:
   GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCCT

  Thanks a lot,

   Jerry

Re: [ccp4bb] FW: [ccp4bb] highly glycosylated protein

[A. Radu Aricescu]

Dear Wei,

If I understood correctly your description, the protein aggregates when 
produced whith complex N-linked glycosylation, and behaves better when the 
glycosylation is immature (i.e. following kifunensine treatment I suppose ?). 
May I suggest that this is a rather atypical situation?

It is also not clear to me whether the behaviour you describe follows 
deglycosylation attempts or not?

Unless your protein is meant to be an ER lumen resident, mature glycosylation 
should help stabilize it. I would suggest against spending time and effort in 
making a stable CHO LecR cell line, at this stage at least. It will give you no 
better protein that kifunensine-trated HEK293 cells. Transient expression in 
the HEK 293S GnTI-, as suggested by others, will be a lot faster (a week will 
probably give you enough material to understand your protein, which is what you 
still need to do now, play with deglycosylation conditions etc) and produce a 
more homogeneous sample than CHOs (which are leaky, see Chang et al 2007, PMID: 
17355862, for details).

Best wishes,

radu

--
A. Radu Aricescu, PhD
University Research Lecturer
MRC Career Development Award Fellow

University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547


 Original message 
Date: Tue, 17 May 2011 18:35:50 +0200
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Wei Li 
wei...@helmholtz-hzi.de)
Subject: [ccp4bb] FW: [ccp4bb] highly glycosylated protein  
To: CCP4BB@JISCMAIL.AC.UK



   Dear  Pascal and Matthias,

   I am sorry for the delay of reply, thanks very much
   for your suggestions on the glycosylation protein.
   Now I am  trying to do a stable cell line with CHO
   lec 3.8.2.1 cells, this cell line could express
   protein with shorter glycans. I hope several weeks
   later I could get some better result. I will also
   try to use the Glycosylation deficient cell lines.



   I am still working on it, thanks again for your
   valuable advice.





   Best regards,



   Wei

















   From: Matthias Zebisch
   [mailto:matthias.zebi...@bbz.uni-leipzig.de]
   Sent: 2011年5月13日 18:15
   To: Wei Li
   Subject: Re: [ccp4bb] highly glycosylated protein



   Try to get hold of GntI deficient HEK293S cells (not
   commercially available). Expression takes two weeks
   but you can achieve comparable yields to HEK293T.
   These cells yield very homogenous bands on SDS PAGE.
   However, check also for O glycosylation prediction.
   As you appear to be from Braunschweig, ask Prof.
   Sträter in Leipzig. He can send you these cells.

   Good luck,

   Matthias

   From: Pascal Egea [mailto:pas...@msg.ucsf.edu]
   Sent: 2011年5月13日 18:01
   To: Wei Li
   Cc: CCP4BB@jiscmail.ac.uk
   Subject: Re: [ccp4bb] highly glycosylated protein



   Hi Wei,



   Glycosylation usually stabilize proteins although it
   is a source of structural heterogeneity for us
   crystallographers.Since you are expressing in HEK293
   cells, there is a strain of cells that is deficient
   for glycosylation (it was designed by Gobind Khorana
   at the MIT I believe). You may want to try this.
   This is particularly useful when you express
   membrane proteins, it avoids hyperglycosylation. You
   may want to try a lightly glycosylated version of
   your protein and see if it behaves correctly,

   The other extreme solution is to identify all
   occupied sequons in your protein and eventually
   inactivate them by mutagenesis to have a completely
   deglycosylated protein. This solution is probably
   not the best since glycosylation usually stabilize
   proteins and may be essential to their biological
   function and activity. So it is to be considered
   with a lot of caution.



   Hope this helps.



   --
   Pascal F. Egea, PhD
   Assistant Professor
   UCLA, David Geffen School of Medicine
   Department of Biological Chemistry
   356 Boyer Hall
   office (310)-983-3515
   lab  (310)-983-3516
   email   pe...@mednet.ucla.edu

   

   Helmholtz-Zentrum für Infektionsforschung GmbH |
   Inhoffenstraße 7 | 38124 Braunschweig |
   www.helmholtz-hzi.de

   Vorsitzende des Aufsichtsrates: MinDir’in Bärbel
   Brumme-Bothe, Bundesministerium für Bildung und
   Forschung
   Stellvertreter: MinDirig Heiko Gevers,
   Niedersächsisches Ministerium für Wissenschaft und
   Kultur
   Geschäftsführung: Prof. Dr. Dirk Heinz; Ulf
   Richter, MBA
   Gesellschaft mit beschränkter Haftung (GmbH)
   Sitz der Gesellschaft: Braunschweig
   Handelsregister: Amtsgericht Braunschweig, HRB 477

Re: [ccp4bb] Deglycosylation enzymes

[A. Radu Aricescu]

Hi Aaron,

There is a very simple way around (or through :-)) such walls of silence. Both 
enzymes are rather small (see UniProt Q9XBM8 and P36911) and in a week or so 
you can have synthetic cDNAs built as you wish. The cost should be equivalent 
to the purchase of a few enzyme aliquots, so not a bad deal in long term.

Best wishes,

radu

--
A. Radu Aricescu, PhD
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547


 Original message 
Date: Fri, 18 Jun 2010 17:10:55 +1000
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Aaron Oakley 
aar...@uow.edu.au)
Subject: [ccp4bb] Deglycosylation enzymes  
To: CCP4BB@JISCMAIL.AC.UK

Hi all,

I am looking to obtain plasmids encoding the deglycosylating enzymes 
peptide-N-glycosidase F and endoglycosidase F1
for expression as fusion proteins with GST. They were described in the 
following paper:

Deglycosylation of proteins for crystallization using recombinant fusion 
protein glycosidases.
F. Grueninger-Leitch, A. D'Arcy, B. D'Arcy, and C. Chène
Department of Gene Technologies, Pharma Preclinical Research, F. Hoffmann-La 
Roche AG, Basel, Switzerland.
Protein Sci. 1996 December; 5(12): 2617–2622.

Has anyone here had any luck obtaining them? I understand that a materials 
transfer agreement is needed.
I have tried contacting the authors and Hoffmann-La Roche via four difference 
channels and have met with a
wall of silence! Any help here would be appreciated!

With thanks,

a++

Re: [ccp4bb] update on SeMet production

[A. Radu Aricescu]

Dear Tim,

I'd dare to say that SeMet labelling in mammalian cells is in 
fact routine (at least in our lab, and others' around the 
world) for quite a while :-) 
Since you mentioned CHO LecR cells, one can find references as 
early as 1994 from Wayne Hendrickson's lab (PMID: 7922031) and 
many others followed. More recently, people have moved to 
transient expression and probably the easiest labelling method 
for HEK293 cells can be found in PMID: 17001101.

Best wishes,

radu

--
A. Radu Aricescu, PhD
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547

 Original message 
Date: Tue, 23 Mar 2010 13:39:09 +0100
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf 
of Jovine Luca luca.jov...@ki.se)
Subject: Re: [ccp4bb] update on SeMet production  
To: CCP4BB@JISCMAIL.AC.UK

Dear Tim,

Although it is not routine, it can be done in mammalian cells 
too! For example, have a look at this:

   
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2242577/pdf/2008.p
df

HTH,

Luca

-
---
Luca Jovine, Ph.D.
Karolinska Institutet
Department of Biosciences and Nutrition  Center for 
Biosciences
Hälsovägen 7, SE-141 57 Huddinge, Sweden
Voice: +46.(0)8.6083-301  FAX: +46.(0)8.6081-501
E-mail: luca.jov...@ki.se
W3: http://jovinelab.org
-
---

On Mar 23, 2010, at 1:25 PM, Tim Gruene wrote:

 Dear all,
 
 since I am currenty preparing a lecture on crystallography 
I am wondering about
 the status quo of the production of SeMet proteins.
 In 2003, if I remember correctly, it was possible to 
express SeMet proteins in
 E.coli and insect cells.
 
 Has this been extended to other systems, and if so, which 
ones?
 
 Thanks a lot, 
 Tim
 
 -- 
 --
 Tim Gruene
 Institut fuer anorganische Chemie
 Tammannstr. 4
 D-37077 Goettingen
 
 GPG Key ID = A46BEE1A
 

[ccp4bb] OXION Postdoc fellowships and DPhil/PhD studentships

[A. Radu Aricescu]

OXION is a research initiative grouping 25 UK laboratories based in Oxford, 
Cambridge and London and aimed at structural and functional characterisation of 
ion channels (http://oxion.dpag.ox.ac.uk/).

Two training fellowships (at the junior or senior postdoctoral level, 
application deadline: Nov 14th, 2008) and up to four graduate studentships 
(application deadline: Jan 9th, 2009), generously funded by the Wellcome Trust, 
have been recently advertised. More details can be found at: 
http://oxion.dpag.ox.ac.uk/fellowshipsandstudentships

Candidates with experience in membrane protein expression, purification and 
crystallization are warmly invited to apply :-)

Best wishes,

radu

--
A. Radu Aricescu, PhD
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287551
Fax: +44-1865-287564

Re: [ccp4bb] Deglycosylation

[A. Radu Aricescu]

Dear Eugenio,

I believe the paper by Chang VT et al 2007 (PMID: 17355862) might offer the 
answers you're after (assuming N-glycosylation is your main concern). For 
O-linked sugars, the situation is much more complex, reflecting their 
diversity: mucin-type can usually be dealt with by construct design (eliminate 
Ser/Thr/Pro-rich domains), for other types have a look at 
http://www.prozyme.com/pdf/gk80110.pdf for example.

Best wishes,

radu


--
A. Radu Aricescu, PhD
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287551
Fax: +44-1865-287547


 Original message 
Date: Thu, 25 Sep 2008 11:30:24 -0700
From: Eugenio De la Mora [EMAIL PROTECTED]  
Subject: [ccp4bb] Deglycosylation  
To: CCP4BB@JISCMAIL.AC.UK

Dear all,
We have some troubles with the cristallization of glycosylated proteins and 
want to try to deglycosate them. We have never done this so we want to know 
what enzymes are the best (efficiency; less protein loss, ... ). And if  it 
gaves better results in crystallization screens.

Thank you

Eugenio De la Mora
Instituto de Biotecnologia 
Universidad NAcional Autonoma de Mexico


  

[ccp4bb] Fwd: [ccp4bb] HEK293S

[A. Radu Aricescu]

Dear Vaheh,

I'm not aware of a commercial or cell bank source, but you can get these cells 
from HG Khorana's lab at MIT.

Best wishes,

radu

--
A. Radu Aricescu, PhD
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287551
Fax: +44-1865-287547
---BeginMessage---
Please, forgive my partially off-topic question.

I'm looking for commercial or cell bank source for GnTI-deficient
HEK293S cells and will appreciate any suggestions on how to get them.

P.S. It's partially off-topic since the cells will be used to produce
protein for crystallography.

Thanks.

___
Vaheh




To the extent this electronic communication or any of its attachments contain 
information that is not in the public domain, such information is considered by 
MedImmune to be confidential and proprietary.  This communication is expected 
to be read and/or used only by the individual(s) for whom it is intended.  If 
you have received this electronic communication in error, please reply to the 
sender advising of the error in transmission and delete the original message 
and any accompanying documents from your system immediately, without copying, 
reviewing or otherwise using them for any purpose.  Thank you for your 
cooperation.
---End Message---

Re: [ccp4bb] insect expression system

[A. Radu Aricescu]

Dear Yong-fu,

Why would you worry about insect expression systems if you already can secrete 
your constructs in mammalian cells? For such proteins, transient expression in 
HEK cells for example gives higher yields than baculo, is faster, cheaper, you 
can nicely control glycosylation, easily do Se-Met labelling and so on.

Here are some references (PMID): 17355862, 17001101, 16823037,  11788735, 
16082028.

Radu

--
A. Radu Aricescu, PhD
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287551
Fax: +44-1865-287547


 Original message 
Date: Wed, 28 May 2008 10:40:16 -0400
From: Yong-Fu Li [EMAIL PROTECTED]  
Subject: [ccp4bb] insect expression system  
To: CCP4BB@JISCMAIL.AC.UK

   Hi,

   I searched my mail box for possible answers you have
   given but couldn't find any. The question is about
   selecting insect expression systems for mammalian or
   viral glycosylated proteins. There is confirmed
   expression of the target proteins in mammalian
   cells. They are secreted into the media.

   1) Baculovirus system
   2) Drosophila system

   Which system would you recommend for high expression
   and convenience?
   Has anyone ever compared those systems side by side?

   Any suggestions or references are greatly
   appreciated.

   Yongfu Li