For what it’s worth, I’ve submitted a talk.
Hope to see a bunch of people in SF.
-Geoff
On Apr 1, 2023 at 5:54:46 AM, Egon Willighagen
wrote:
>
> Hi all,
>
> this seems interesting:
>
> -- Forwarded message -
> From: Susi Lehtola susi.lehtola*_*alumni.helsinki.fi <
>
> As a reminder, there's an infinite number of structures that SMILES can't
> handle. (Endohedral fullerenes and catenanes, to name two.)
Over the years, Rich Apodaca has also blogged about the many limitations to the
common connection-table type representation. (Helicene chirality, delocalized
a PDF…)
-Geoff
---
Prof. Geoffrey Hutchison
Department of Chemistry
University of Pittsburgh
tel: (412) 648-0492
email: geo...@pitt.edu
twitter: @ghutchis
web: https://hutchison.chem.pitt.edu/
___
Blueobelisk-discuss mailing list
Blueobelisk-d
> I write them as a nested lookahead parser, relying on end-of-sections. I
> would now rewrite in Python + a parser like ANTLR which Lezan and I used for
> NLP of phrases in ChemicalTagger. We probably need to have more heuristics
> for blocks of numbers and relate them to presumed atom
in chemistry are likely not over yet.
Best of luck!
-Geoff
---
Prof. Geoffrey Hutchison
Department of Chemistry
University of Pittsburgh
tel: (412) 648-0492
email: geo...@pitt.edu
twitter: @ghutchis
web: https://hutchison.chem.pitt.edu/
> On Jan 12, 2021, at 4:42 PM, Craig James wrote:
>
> I have suggested that there are Open tools that they may not yet have
> discovered. They have needs for (at least):
> * 2-D chemical editor and display
I do not think such a thing currently exists. The ChemDoodle tool, while not
open, is at least low cost, and they do support open source web
> I should be able to give you our list of approved (U.S.) oncology agents. I
> think I can also give you our list of oncology investigational agents.
Aren't most of these in the MESH database? (https://www.nlm.nih.gov/mesh/)
-Geoff
> 2. https://github.com/nrnb/GoogleSummerOfCode/issues/47
> The second idea is in JavaScript where I envision use of remote
> services that can convert SMILES and/or identifiers to SVG images of
> 2D depictions.
There may be benefits to using CDK for this, but I think there are already ways
for
Ugh. I'm speechless. Very sad news.
-Geoff
---
Prof. Geoffrey Hutchison
Department of Chemistry
University of Pittsburgh
tel: (412) 648-0492
email: geo...@pitt.edu
web: http://hutchison.chem.pitt.edu/
--
Accelerate Dev
Does anyone know how to represent an octahedral complex by SMILES?
Yes, there are full examples here:
http://opensmiles.org/opensmiles.html#chirality
Look for “Octahedral Centers” under the stereochemistry.
Cheers,
that helps,
-Geoff
---
Prof. Geoffrey Hutchison
Department of Chemistry
University of Pittsburgh
tel: (412) 648-0492
email: geo...@pitt.edu
web: http://hutchison.chem.pitt.edu/
--
Precog is a next-generation analytics
And now for something completely different ... I'm looking for an image of a
DNA strand that's quite long and that I can manipulate.
Here’s my suggestion. If you make up a Fasta file, Open Babel can generate XYZ
coordinates, e.g.
DNA
GATTACAGATTACAGATTACA
So that’s, say “dna.fasta”
babel
. Geoffrey Hutchison
Department of Chemistry
University of Pittsburgh
tel: (412) 648-0492
email: geo...@pitt.edu
web: http://hutchison.chem.pitt.edu/
--
Live Security Virtual Conference
Exclusive live event will cover all
.
What's the number of pages we are talking about? Can we migrate the
database, or do we need to copy the content manually? (which we did
for the CDK at least three times...)
I have to think there's a way to script this if the database can't be migrated.
-Geoff
---
Prof. Geoffrey Hutchison
in HTML5 on depth-first.com.
Cheers,
-Geoff
---
Prof. Geoffrey Hutchison
Assistant Professor, Department of Chemistry
University of Pittsburgh
http://hutchison.chem.pitt.edu/
Office: (412) 648-0492
--
Gaining the trust
On Aug 10, 2010, at 8:06 AM, Egon Willighagen wrote:
I will bring along printed posters of Bioclipse...
Chris, shall we bring some (old) prints of CDK News too?
Any idea how many we should print/bring? I mean, I think 20-30 per table, times
4-5 tables by the CINF sessions sounds about right.
even if all the code was rewritten, the code ownership would not change
at least if the changes are incremental. If this is true, you might be
unable to relicense OpenBabel without permission from OpenEye even if
all the original code is rewritten.
Actually, what Craig is referencing (I
Here's another one...Octopus
http://www.tddft.org/programs/octopus/wiki/index.php/Main_Page
Octopus in particular is not aimed at end-users. It's a package for DFT
developers to experiment.
Cheers,
-Geoff
--
Download
any suggestions regarding where to meet for the Blue Obelisk Dinner in SF?
Buca di Beppo? It's close to the Moscone Center, although I didn't check if
it's also close to the hotel. I'd like to make sure we can get back to the
Sci-Mix posters.
If people are OK with Italian, I'll look into
/corg/content?_nfpb=true_pageLabel=PP_ARTICLEMAINnode_id=132content_id=CNBP_024004use_sec=truesec_url_var=region1
CINF Harry’s Party (NT)
5:30 p.m. – 7:30 p.m.
Palace Hotel, Presidential Suite
Cheers,
-Geoff
---
Prof. Geoffrey Hutchison
Assistant Professor, Department of Chemistry
University
The original Blue Obelisk *is* somewhere in SF, right?
San Diego, actually. I think Peter gave the first blue obelisk awards in SF
-- he found some crystal store somewhere.
Cheers,
-Geoff
--
The Planet: dedicated and
On Aug 3, 2009, at 1:36 PM, David C.Lonie wrote:
cml xmlns=http://www.xml-cml.org/schema;
convention=cml:conformerList
molecule id=m1_1... contents... /molecule
FWIW, all that Avogadro uses for conformers (at the moment, subject to
change!) are sets of coordinates and an energy.
Yes,
The chemical-structures project has a nice selection of common
molecular structures in CML. But it only has straight-chain sugars.
Does anyone know of a nice selection of cyclic sugars -- particularly
the common forms of fructose, glucose... etc. I know I can grab each
of these off of
files with the Chem Structures database:
http://chem-file.sourceforge.net/
I also intend to use these as fragments for Avogadro. My reading is
that these are intended for the public domain, correct?
Thanks again,
-Geoff
---
Prof. Geoffrey Hutchison
Department of Chemistry
University
No, it's not even spring yet. (Although it has been very warm here in
Pittsburgh.)
But it's close to time for Google Summer of Code. Over the last few
years, we have been reasonably successful with chemistry projects
through other mentoring organizations (particularly KDE).
On Aug 22, 2008, at 4:43 PM, [EMAIL PROTECTED] wrote:
It is my understanding that Babel is FOSS. If this is incorrect,
please be sure to let me know.
No, it is not. The original Babel (which you used) does not have any
sort of open source license. It's free to distribute, but was blocked
On Aug 25, 2008, at 3:56 PM, [EMAIL PROTECTED] wrote:
There is no indication in the babel-1.6 source tree that I could find
to indicate that it is not FOSS.
If you take a look at any source file:
This file is part of the Babel Program
Copyright (C) 1992-96 W. Patrick Walters and Matthew T.
I've been sitting on this for a day or two while finding out more
information, but you should check out the cheminformatics toolkit
RDKit which, like OpenBabel, has its origins in a commercial
company...
Thanks Noel, this looks really great. Does Greg seem interested in
continuing
Basically this means there is no clear resolution to the issue of
smi23d and patents.
...
Sheesh, and all we did was implement an algorithm from a paper :(
Yes, I know the feeling. This is why so many people are against
software patents. Of course the situation is not much better in wet
29 matches
Mail list logo
