[galaxy-user] Boxplot error.

Hello, I'm pretty new for Galaxy. I am running a local Galaxy server on Mac. I tried to draw a boxplot from summary statistics created from groomed fastq data. Then I got error message as follows: An error occurred running this job: gnuplot> set term png size 2048,768 ^ line 0: unknown or am

[galaxy-user] how to download onto a server?

Hi, I would like to transfer results files (e.g., accepted_hits.bam) from my Galaxy history onto a server — not my local computer. How do I do that? Best, Ann --- Ann Loraine, Ph.D. Associate Professor Department of Bioinformatics and Genomics University of North C

[galaxy-user] Barcode splitting

I have lllumina sequences which are barcoded in the sequence identifier e.g.: @FCC186GACXX:6:1101:1473:2060#TCGCAGGA/1 CTCCACGAAACCGGAAGGGTAGGTTCGGTCAACTCGTTCCTCACAATTTGCCCGATTCTCAGATTGGTGACCTCTCTC The '#TCGCAGGA" is the barcode. As the barcode is not on the 5' or 3' end I cannot u

Re: [galaxy-user] extracting a subset of sequences from a very large fasta file(1.5 million)

Hi Perumal, There isn't a simple fasta extraction tool on the public Main Galaxy server, but the extraction is possible and could be grouped into a workflow for re-use once completed. This is simpler that it first looks, really just 4 steps: 1. Convert the fasta file to tabular: 'FASTA

Re: [galaxy-user] how to download onto a server?

Hi Ann, From a shell/unix window on your server, use "curl" to download datasets. The link can be obtained by right clicking the floppy disk icon inside a history item and choosing "Copy Link Address" (for most datasets) or "Download Dataset/Download bam_index" (for BAM datasets there are two

Re: [galaxy-user] NGS with Arabidopsis thaliana built-in-index

Hi Tom, A mismatch between chromosome identifiers can definitely be problematic. These have to be exact. The TAIR 10 genome in Galaxy has these identifiers: chr1 chr2 chr3 chr4 chr5 chrM chrC Comparing these to your GTF file would be the way to see if any mismatches remain. On 12/2/12 10:0

[galaxy-user] December 3, 2012 Distribution & News Brief

December 3, 2012 Distribution & News Brief * Complete News Brief * * Highlights:* * *NGS: Mapping* tools *Bowtie

[galaxy-user] compare two dataset

Hi all, I got my cuffdiff output and I have to compare results from two (or eventually more) different dataset. Does anybody know if there is a way to do that on Galaxy? Also more in general, is there a manual for the Galaxy tools? That would be very helpful for someone who is new on the field (l

Re: [galaxy-user] Barcode splitting

Hi, How comes the barcode not be at 5' or 3' end, do you have primer sequences or stuff like that ? The barcode you show cannot be found in the sequence you show... I know that FastqMCF is an alternative tool that can be found in the toolshed and that deals with barcode. Philippe 2012/12/3 Rajar