Re: [R] length of a string

2007-09-05 Thread Benilton Carvalho
As long as you keep in mind Prof. Ripley's comment, you're going to be fine with nchar(). http://tolstoy.newcastle.edu.au/R/e2/devel/07/05/3450.html Remember that what you want exactly is given by nchar(obj, type="chars"), which is **NOT** the default on R 2.5.1 (only on R-2.6.0). In your

Re: [R] length of a string

2007-09-05 Thread Ted Harding
On 05-Sep-07 13:50:57, João Fadista wrote: > Dear all, > > I would like to know how can I compute the length of a string in a > dataframe. Example: > > SEQUENCE ID > TGCTCCCATCTCCACGGHR04FS00645 > ACTGAACTCCCATCTCCAAT HR0595847847 > > I w

Re: [R] length of a string

2007-09-05 Thread Henrique Dallazuanna
Hi, sapply(levels(df[,"SEQUENCE"]), nchar) Where 'df' is your data.frame -- Henrique Dallazuanna Curitiba-Paraná-Brasil 25° 25' 40" S 49° 16' 22" O On 05/09/07, João Fadista <[EMAIL PROTECTED]> wrote: > > Dear all, > > I would like to know how can I compute the length of a string in a > datafr

Re: [R] length of a string

2007-09-05 Thread Paul Smith
On 9/5/07, João Fadista <[EMAIL PROTECTED]> wrote: > I would like to know how can I compute the length of a string in a dataframe. > Example: > > SEQUENCE ID > TGCTCCCATCTCCACGGHR04FS00645 > ACTGAACTCCCATCTCCAAT HR0595847847 > > I would like t

Re: [R] length of a string

2007-09-05 Thread Chuck Cleland
João Fadista wrote: > Dear all, > > I would like to know how can I compute the length of a string in a dataframe. > Example: > > SEQUENCE ID > TGCTCCCATCTCCACGGHR04FS00645 > ACTGAACTCCCATCTCCAAT HR0595847847 > > I would like to know how

Re: [R] length of a string

2007-09-05 Thread Jared O'Connell
How's this? > x = data.frame(ID=c("asdf","asdfasdf"),1:2) > x ID X1.2 1 asdf1 2 asdfasdf2 > nchar(as.character(x$ID)) [1] 4 8 > Assuming ID is a factor, if not, you can remove the as.character(). On 9/5/07, João Fadista <[EMAIL PROTECTED]> wrote: > > Dear all, > > I would l

Re: [R] length of a string

2007-09-05 Thread Bill.Venables
one: +61 7 3286 7700 mailto:[EMAIL PROTECTED] http://www.cmis.csiro.au/bill.venables/ -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of João Fadista Sent: Wednesday, 5 September 2007 11:51 PM To: r-help@stat.math.ethz.ch Subject: [R] length of a str

[R] length of a string

2007-09-05 Thread João Fadista
Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGGHR04FS00645 ACTGAACTCCCATCTCCAAT HR0595847847 I would like to know how to compute the length of each SEQUENCE.