I've been migrating most of my software/scripts over to GFF3, and have encountered a possible bug with Artemis (v11) on Linux x86_64.
When the GFF3 has multiple sequences in the ##FASTA section, Artemis dies with: Exception in thread "AWT-EventQueue-0" java.lang.ClassCastException: uk.ac.sanger.artemis.io.EmblStreamFeature at uk.ac.sanger.artemis.io.GFFDocumentEntry.combineGeneFeatures(GFFDocumentEntry.java:166) at uk.ac.sanger.artemis.io.GFFDocumentEntry.<init>(GFFDocumentEntry.java:75) However, if i REMOVE the >region00001 sequence so there is only the one >Seq sequence, all is ok. The extra sequences in the ##FASTA section are commonly used to store CDS translations, or when the GFF covers lots of sequences eg. contigs in an assembly. I have attached a .GFF3 file which causes this (and inlined it below for completeness). ##gff-version 3 Seq vbc region 20 60 . + . ID=region00001;product=Junk DNA ##FASTA >Seq ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC >region00001 GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATG Thank you. -- --Torsten Seemann --Victorian Bioinformatics Consortium, Dept. Microbiology, Monash University, AUSTRALIA
art_gff_multiple_seq_bug.gff3
Description: Binary data
_______________________________________________ Artemis-users mailing list Artemis-users@sanger.ac.uk http://lists.sanger.ac.uk/mailman/listinfo/artemis-users