\def\TOrt#1{\expanded{\Ort{\ctxlua{userdata.Lookup("#1")}}}#1} % Loc + Text
\defineprocessor[kursiv][style=italicface]
\def\TFOrt#1{\expanded{\Ort[kursiv->]{\ctxlua{userdata.Lookup("#1")}}}#1} % Loc
in Footnote + Text
works. :)
(I always define \TIndex to avoid doubling,
onscreen[option=max, delay=5]
\setuppagetransitions[random]
\setupbodyfont[50pt]
\starttext
\dorecurse{2}{%
\startmakeup[page][style=\bf\ss, align=center]
\recurselevel
\stopmakeup%
}
\stoptext
The output PDF document may contain a /Page object such as:
6 0 ob
\setuppagetransitions[random]
\setupbodyfont[50pt]
\starttext
\dorecurse{25}{%
\startmakeup[page][style=\bf\ss, align=center]
\recurselevel
\stopmakeup%
}
\stoptext
Just in case it helps,
in the PDF.
This is my question, how to set these using an environment file, thus NOT the
same file as the \startdocument in a project structure.
The problem is something in your environment/style file which causes a problem
with the \setupdocument setup. What you should do to find the sulprit is
to check if the metadata
> end up in the PDF file. You could have a environment file for \setupdocument
> but the goal here was to check the resulting metadata in the PDF.
>> This is my question, how to set these using an environment file, thus NOT
>> the same file as the \startdocu
could have a environment file for
\setupdocument but the goal here was to check the resulting metadata in
the PDF.
This is my question, how to set these using an environment file, thus
NOT the same file as the \startdocument in a project structure.
The problem is something in your environment/style file wh
> reference spread over two lines with different font style and
> > justification, plus a slightly different text for the table of contents.
> >
> > So that I can alter the styling of the section headings without having
> > to recode each \startsection command, I ha
James Withers schrieb am 22.07.2020 um 21:20:
Dear list
I have a document with section headings which include a title, date and
reference spread over two lines with different font style and
justification, plus a slightly different text for the table of contents.
So that I can alter
Dear list
I have a document with section headings which include a title, date and
reference spread over two lines with different font style and
justification, plus a slightly different text for the table of contents.
So that I can alter the styling of the section headings without having
URL[wiki] [http://wiki.contextgarden.net][][wiki
> \ConTeXt\ ]
>
> It may be better to use `\ConTeXT{}` with no space afterwards.
>
> 3. Why use abbreviated names:
>
> \configurerpdp[style=\italique]
> \configurertextespdp[\date \hfill Modèle \ConTeXt]
&
{}` with no space afterwards.
3. Why use abbreviated names:
\configurerpdp[style=\italique]
\configurertextespdp[\date \hfill Modèle \ConTeXt]
I am guessing `pdp` is somehow an abbreviation of `footer`. One of the things
that I really like about ConTeXt compared to LaTeX is that there are no funny
file: MWE_test_itemize_french.tex
% interface=fr
\configurerdétailler[style=gras]
\débuttexte
\débutdétailler[a]
\élément Texte premiere
\élément Texte second
\findétailler
\fintexte
It works properly with "minimal" modifications of mult-def.lua
file: mult-def.lua.initial+diffminimalse
with a simple example
file: MWE_test_itemize_french.tex
% interface=fr
\configurerdétailler[style=gras]
\débuttexte
\débutdétailler[a]
\élément Texte premiere
\élément Texte second
\findétailler
\fintexte
It works properly with "minimal" modifications of mult-def.lua
file: mult-def.l
: MWE_test_itemize_french.tex
% interface=fr
\configurerdétailler[style=gras]
\débuttexte
\débutdétailler[a]
\élément Texte premiere
\élément Texte second
\findétailler
\fintexte
It works properly with "minimal" modifications of mult-def.lua
file: mult-def.lua.initial+diffminimalsetupite
old,
>width=broad]
>
> \defineenumeration
>[definition]
>[text=Définition,
> number=yes,
> headcommand=\groupedcommand{}{.},
> style=italic]
>
> \starttext
>
> \startdefinition
> \blank
> \startxtable[align={lohi,middle},w
ve=serried,
>title=yes,
>titleleft=,
>titleright=,
>prefix=yes,
>prefixsegments=chapter,
>way=bychapter,
>titlestyle=bold,
>width=broad]
>
> \defineenumeration
>[definition]
>[text=Définition,
> number=
=,
titleright=,
prefix=yes,
prefixsegments=chapter,
way=bychapter,
titlestyle=bold,
width=broad]
\defineenumeration
[definition]
[text=Définition,
number=yes,
headcommand=\groupedcommand{}{.},
style=italic]
\starttext
\startdefinition
\blank
\startxtable[align
Hello,
I would like to reduce the space between the numbering and the title of the
chapters, sections and subsections.
I would also like to have this:
1 My first chapter
1.1 My first section
1.1.1 My first subsection
\setuplist
[chapter]
[style=bold,width=10mm]
\starttext
\placelist
,style=bold,numbercommand=\groupedcommand{}{\blank[2cm]},after={\blank[3cm]},command=\MyChapter]
What happens if you remove `numbercommand=...,`?
Aditya___
If your question is of interest to others as well, please add
to my
setup in the 'real' example, and maybe that's where I've gone wrong, but
why am I losing the chapter number?
\define[2]\MyChapter
{\framed[frame=off,width=broad,align=middle,number=yes]{#1\blank[1cm]#2}}
\setuphead
[chapter][header=empty,alternative=middle,style=bold,numbercommand
Hello,
I want a vertical space between the label and the chapter title: is this
the right way to proceed ?
Thank you.
Fabrice
\setuplabeltext[chapter=Chapitre~]
\unexpanded\def\Title#1#2{\framed[frame=off,width=fit,align=flushleft]{#1\blank#2}}
\setuphead
[chapter]
[style=\bfc,
command
eringsetup=userdata:margintext]
>
> \startsetups [userdata:margintext]
> \margindata
> [inright]
> [style={\switchtobodyfont[9pt]},
> width=\rightmarginwidth,
> align={flushleft,broad},
> stack=yes]
> {\startframedtext[before=,after=,offse
=userdata:margintext]
\startsetups [userdata:margintext]
\margindata
[inright]
[style={\switchtobodyfont[9pt]},
width=\rightmarginwidth,
align={flushleft,broad},
stack=yes]
{\startframedtext[before=,after=,offset=0pt,width=max,frame=off]
\getinlineuserdata
ration[proposition][alternative=top,text=Proposición,headalign=middle,numberconversion=R,headstyle=\WORDS,style=\emph,referenceprefix=prop]
> > \starttext
> > \startproposition[1]
> > \dorecurse{10}{\input ward}
> > \stopproposition
> > \in[prop:1]
> > \
ration[proposition][alternative=top,text=Proposición,headalign=middle,numberconversion=R,headstyle=\WORDS,style=\emph,referenceprefix=prop]
> \starttext
> \startproposition[1]
> \dorecurse{10}{\input ward}
> \stopproposition
> \in[prop:1]
> \stoptext
>
> works almost perfectly.
The following:
\setupinteraction[state=start,focus=standard,color=black,contrastcolor=black]
\defineenumeration[proposition][alternative=top,text=Proposición,headalign=middle,numberconversion=R,headstyle=\WORDS,style=\emph,referenceprefix=prop]
\starttext
\startproposition[1]
\dorecurse{10
right]
> > \setupmargindata [marginfigure][command=\vbox,align=middle]
>
> \setupmargindata [marginfigure][command=\vbox,align=middle,stack=yes]
>
> > \startsetups [userdata:margintext]
> > \margindata
> > [inright]
> > [%style=\smallbodyfont,
> > st
lign=middle]
\setupmargindata [marginfigure][command=\vbox,align=middle,stack=yes]
> \startsetups [userdata:margintext]
> \margindata
> [inright]
> [%style=\smallbodyfont,
> style={\switchtobodyfont[9pt]},
> width=\rightmarginwidth,
stack=yes,
>
]
\setupmargindata [marginfigure][command=\vbox,align=middle]
\defineuserdata [margintext] [alternative=margintext]
\defineuserdataalternative [margintext] [renderingsetup=userdata:margintext]
\startsetups [userdata:margintext]
\margindata
[inright]
[%style=\smallbodyfont,
style
` for mathmatrix:
\definemathmatrix[bmatrix][matrix:brackets][simplecommand=BMATRIX]
\starttext
Default style:
\startformula
\startbmatrix
\NC 1 \NC 2 \NC 3 \NR
\NC 4 \NC 5 \NC 6 \NR
\NC 7 \NC 8 \NC 9 \NR
\stopbmatrix
\stopformula
Compact style:
\startformula
\BMATRIX{1, 2, 3; 4, 5, 6
t I mean:
> the
> > LaTeX commands are small and neat; the ConTeXt commands are not.
>
> As explained in the last paragraph, there are pre-built shortcuts for the
> main alignments and you can define your own to match amsmath style, if you
> wish.
>
> If you are worried about
; the ConTeXt commands are not.
As explained in the last paragraph, there are pre-built shortcuts for the main
alignments and you can define your own to match amsmath style, if you wish.
If you are worried about typing, look into tab completion for your editor of choice. For
example, in vim, I
> for (true) beginners. And, no offense, but I thought it was poorly typeset
> as well...
I think it doesn’t make a lot of sense to try to understand the whole thing at
once.
You need to start small with a project and some basic structuring, then add
your style requirements one after the oth
ther small once you realize that a lot of configuration
keys are similar (there is no need to document 'before' or 'style' with
each comand ... most beginners styles have too much code
- in addition to manuals (the ones that i write are often around some
specific mechanism and they only make sense
e{myindent}#1.}
\defineenumeration[sats][
text={Sats},
style={\em},
title=yes,
titlestyle=,
width=fit,
headstyle={\smallcaps\setcharacterkerning[sats]},
headcommand={\vakuum},
number=yes,
alternative=serried,
indenting={yes,\measure{myindent}},
]
\defineenumeration[SATS][sats][
headstyle=
indices not, but in order to do
that I need to adapt some references and might overlook some ... no big
deal as there are not that many.
-- Some math rendering is quite hard codes wrt style and already much
has been made configurable (either controlled by keywords or by
additional parameters
finished a review of level 2 (and some level 3)
> pages.
>
> Several tweaks all over the place like:
>
> - Fonts: full update for newcomers,
> - Try to be responsive "enough" for smartphone
> - More homogeneous style / theme
> - Old Content category and tag pages, up
update for newcomers,
- Try to be responsive "enough" for smartphone
- More homogeneous style / theme
- Old Content category and tag pages, update dead links
- Layout:
- do the todo, like merging content of paper setup + paper sizes pages
- complete the flow with imposition
to be responsive "enough" for smartphone
- More homogeneous style / theme
- Old Content category and tag pages, update dead links
- Layout:
- do the todo, like merging content of paper setup + paper sizes pages
- complete the flow with imposition
- rework the "Further reading section&
jbf schrieb am 03.06.2020 um 01:21:
Thanks Wolfgang. Clearly that fixes the problem. I also came up with
another solution which avoids the need to define a MyChapterCommand,
by first setting up the normal chapter as:
\setuphead
[chapter]
[header=empty,alternative=middle,style=bold
Thanks Wolfgang. Clearly that fixes the problem. I also came up with
another solution which avoids the need to define a MyChapterCommand, by
first setting up the normal chapter as:
\setuphead
[chapter]
[header=empty,alternative=middle,style=bold,numbercommand=\groupedcommand{}{\blank[2cm
}
\setupalign[width,hz,hanging,hyphenated]% reset alignment
\stopsetups
\setuphead[chapter][
page=left,
number=no,
command=\gobbletwoarguments,
before=,
after={\directsetup{bigchapter}},
style={\ChapterFont},
]
This is the result:
https://www.dreiviertelhaus.de/editionka/lauf-los-buch
\def\do_look#id{%
\edef\currentlook{#id}%
\dosingleempty\do_do_look%
}
\def\do_do_look[#parms]#content{%
\begingroup
\iffirstargument\setupcurrentlook[#parms]\fi
%This handles style and color
\uselookstyleandcolor\c!style\c!color%
#content%
\endgroup%
}
\protect
}%
\dosingleempty\do_do_look%
}
\def\do_do_look[#parms]#content{%
\begingroup
\iffirstargument\setupcurrentlook[#parms]\fi
%This handles style and color
\uselookstyleandcolor\c!style\c!color%
#content%
\endgroup%
}
\protect %%
\stopmodule
What have I
ixes can
> be useful (e.g. to avoid component and style files with the same name) but
> aren't necessary.
Usually my project and environment have the same name, but different prefix (in
my weird nomenclature).
>>> 2. Use the result option on the command line, e.g. "context
>
for your
>>> product.
>> I force nobody to use that.
> No and everybody has to find a system which fits best for him, prefixes can
> be useful (e.g. to avoid component and style files with the same name) but
> aren't necessary.
>>> 2. Use the result
myfilename for your
product.
I force nobody to use that.
No and everybody has to find a system which fits best for him, prefixes
can be useful (e.g. to avoid component and style files with the same
name) but aren't necessary.
2. Use the result option on the command line, e.g. "context --r
xtended).
>> – Kerning is not yet perfect.
>> – Accents sit a bit too close on the letters.
>> – Swash capitals don’t fit the style at all, they look like some modern hand
>> font like Lucida Handwriting.
>
> Thanks a lot for your insights.
>
> From the repo I g
, oldstyle
> numbers a bit too small.
> – Small caps are lacking accented vowels including umlauts.
> – Cyrillic is missing Kyrgyz/Kazakh letters (i.e. Cyrillic extended).
> – Kerning is not yet perfect.
> – Accents sit a bit too close on the letters.
> – Swash capitals don’t
c is missing Kyrgyz/Kazakh letters (i.e. Cyrillic extended).
– Kerning is not yet perfect.
– Accents sit a bit too close on the letters.
– Swash capitals don’t fit the style at all, they look like some modern hand
font like Lucida Handwriting.
Marco Patzer schrieb am 17.05.2020 um 19:04:
On Sun, 17 May 2020 18:16:13 +0200
"Jan U. Hasecke" wrote:
I am currently writing a text where I want to include text snippets
either by including files or including buffers.
What is the best way to style all these included buffers?
I k
Am 17.05.20 um 19:04 schrieb Marco Patzer:
>>
>> Is it somehow possible to apply styles to all buffers that gets
>> included via \getbuffer by defining a special getbuffer-style?
>
> \setupbuffer has before and after keys which can be used. Example:
>
> \setupbuff
On Sun, 17 May 2020 18:16:13 +0200
"Jan U. Hasecke" wrote:
> I am currently writing a text where I want to include text snippets
> either by including files or including buffers.
>
> What is the best way to style all these included buffers?
>
> I know
Hi all,
I am currently writing a text where I want to include text snippets
either by including files or including buffers.
What is the best way to style all these included buffers?
I know that I can do something like this:
\startcolumns
\getbuffer[Muenchen]
\stopcolumns
Or do something
\setupinteraction[state=start]
\setupcolors[textcolor=colorone]
\setupbackgrounds[page][background=color,backgroundcolor=nearlywhite]
\usemodule[vim]
\startvimrc[name=minor-groups]
hi Function cterm=NONE
hi Stringcterm=NONE
hi Delimiter cterm=NONE
\stopvimrc
\startcolorscheme[oceansunset]
\def
This does give me ythe look of a link, but not a working link. Outside of
textext() it works. Is there a way to get a working link in a MetaFun picture?
Thx,
G
\setupinteraction
[state=start,
color=blue,
style=bold]
\starttext
\goto{works}[url(https://ea.rna.nl/2011/06/05
checks if a highlighting style is
available for `rubyMethodName`; if not it tries `rubyFunction`; and if not it
tries `Function`.
Although something similar might have been possible in 2context.vim, I follow
the `TOHtml` function of vim, and simply created a single tag for each syntax
, $VIMRUNTIME/syntax/ruby.rb contains the following lines:
hi def link rubyMethodName rubyFunction
hi def link rubyFunction Function
So, `rubyMethodName` maps to `rubyFunction`, which in turn maps to `Function`.
Now, a vim colorscheme first checks if a highlighting style is available
or[nearlywhite] [r=0.988, g=0.988, b=0.988]
\setupinteraction[state=start]
\setupcolors[textcolor=colorone]
\setupbackgrounds[page][background=color,backgroundcolor=nearlywhite]
\usemodule[vim]
\unprotect
\startcolorscheme[oceansunset]
\definesyntaxgroup[Comment][\c!color={co
[style=bold]
And I was able to achieve a result with a short line above where the
page number should be - but by adopting the solution below I have now
lost the page number.
\setuppagenumbering
[alternative=doublesided,location={footer,middle}]
\setupfootertexts[{\framed[frame=off,topframe
={colortwo},\c!style=italic]
% etc.
\stopcolorscheme
\protect
which I use as described in the wiki:
\definevimtyping
[...]
[...
alternative=oceansunset,
...]
But that does not seem to have any effect (if I change the colors, the
syntax highlighting does
[alternative=doublesided,location={footer,middle}]
\setupfooter
[style=bold]
And I was able to achieve a result with a short line above where the
page number should be - but by adopting the solution below I have now
lost the page number.
\setuppagenumbering
[alternative=doublesided,location
Quick question: Is \startcolorscheme... \stopcolorscheme (still)
supported by t-vim?
In a template I wrote long time ago to typeset code, I have:
\usemodule[vim]
\unprotect
\startcolorscheme[oceansunset]
\definesyntaxgroup[Comment][\c!color={colortwo},\c!style=italic
hanging punctuation, less severe style
\definefontfeature
[default]
[default]
%%[protrusion=quality,expansion=quality]
[protrusion=punctuation,expansion=quality]
\setupalign[hz,hanging]
% Setup white space between paragraphs
\setupwhitespace[medium]
% Choose a font
\setupbodyfont[pagella
={footer,middle}]
\setupfooter
[style=bold]
And I was able to achieve a result with a short line above where the
page number should be - but by adopting the solution below I have now
lost the page number.
\setuppagenumbering
[alternative=doublesided,location={footer,middle}]
\setupfootertexts
d of thing found here Creating a
style file in ConTeXt | Random Determinism where the writer explains
things bit by bit but importantly, offers a summary of the code at the
end. I probably don't need the lengthy explanation but the summary of
code is most helpful - except that it is n
ind of thing found here Creating a
style file in ConTeXt | Random Determinism where the writer explains things
bit by bit but importantly, offers a summary of the code at the end. I
probably don't need the lengthy explanation but the summary of code is most
helpful - except that it is not about
I am trying to get an URL link in a textext() via METAPOST. I’ve got this
before \starttext (or after, tried both):
\setupinteraction
[state=start,
color=blue,
style=bold]
The intended link shows up in blue and bold, but it is not clickable.
I’ve turned ConTeXt tracing on and see
level primitives (it is actually a set of
primitives that put stuff on top of each other). The \frac is the
interfaced variant.
Also a structure like
$\Uover style \textstyle{1}{2}$
seems a little bit far from the usual ConTeXt atmposphere… Would it not be
possible to have
${1} \Uover[style
${1} \Uover {2}$
like the more friendly ${1} \over {2}$ instead of having
$\Uover{1}{2}$
which is more like the \frac structure.
Also a structure like
$\Uover style \textstyle{1}{2}$
seems a little bit far from the usual ConTeXt atmposphere… Would it not be
possible to have
${1} \Uover[style
present was a variant on \over which normally is used like
{{1}\over{2}}
i.e. the only time when tex looks back and needs to tweak styles. The
alternative is:
$\Uover{1}{2}$ etc
which looks forward but is otherwise compatible, apart from supporting
an optional keyword
$\Uover style
> Fabrice
> >
> > \startproduct Seconde
> >
> > \environment modules
> > \environment specialite-style
> > \environment specialite-macros
> >
> > \startfrontmatter
> > \component specialite-titlepage
> > \component s
On Thu, 7 May 2020, Fabrice Couvreur wrote:
Hi,
Here is part of a project that is starting to be heavy ; when i add a
chapter i do context seconde.tex
How do I compile only the chapter I just added ?
Thank you.
Fabrice
\startproduct Seconde
\environment modules
\environment specialite-style
Hi,
Here is part of a project that is starting to be heavy ; when i add a
chapter i do context seconde.tex
How do I compile only the chapter I just added ?
Thank you.
Fabrice
\startproduct Seconde
\environment modules
\environment specialite-style
\environment specialite-macros
> Am 05.05.2020 um 10:35 schrieb Hynek, Stefan :
>
> Hello fellow ConTeXies,
>
> since April 2019 it is possible to use \setupregister with
> compress=text which is a fine addition and has its use cases.
> Unfortunately, I am confronted with the demand to style th
Hello fellow ConTeXies,
since April 2019 it is possible to use \setupregister with
compress=text which is a fine addition and has its use cases.
Unfortunately, I am confronted with the demand to style the registers
with 'f.' for a following single page and else with page ranges. Since
On 5/4/2020 17:13, Wolfgang Schuster wrote:
Rik Kabel schrieb am 04.05.2020 um 23:07:
List,
The following example works with MkIV latest, but fails with LMTX
latest (Win10 x64). The complaint is ! Missing math style, treated as
\displaystyle.
\starttext
\startitemize
Rik Kabel schrieb am 04.05.2020 um 23:07:
List,
The following example works with MkIV latest, but fails with LMTX
latest (Win10 x64). The complaint is ! Missing math style, treated as
\displaystyle.
\starttext
\startitemize
\item
Level 1 first
\startitemize
List,
The following example works with MkIV latest, but fails with LMTX latest
(Win10 x64). The complaint is ! Missing math style, treated as
\displaystyle.
\starttext
\startitemize
\item
Level 1 first
\startitemize
\item
Level 2 first
t/fonts/mkiv/type-imp-texgyre.mkiv'
> selectfont > the requested fallback font 'file:Helvetica.ttc' for
> typeface 'optima' style 'ss' was ignored because no files where found.
The fallback font for cyrillic, Helvetica.ttc, is not found. No problem with
Optima reported.
Best, Hrab
[optima]
> The error is:
> fonts > typescripts > unknown library 'optima'
> open source > level 3, order 6, name
> '/usr/local/context-osx-64/tex/texmf-context/tex/context/fonts/mkiv/type-imp-texgyre.mkiv'
> close source> level 3, order 6, name
> '/usr/local/context
ocal/context-osx-64/tex/texmf-context/tex/context/fonts/mkiv/type-imp-texgyre.mkiv'
close source> level 3, order 6, name
'/usr/local/context-osx-64/tex/texmf-context/tex/context/fonts/mkiv/type-imp-texgyre.mkiv'
selectfont > the requested fallback font 'file:Helvetica.ttc' for typ
, I think (not that I need it, I only want the
ss form anyway).
This has still nothing to do with the serif/roman style,
what the setup does is to map the slanted and boldslanted
alternatives to the italic files. You can achieve the same
with two additional \definefontsynonym lines for &qu
ld be
> handled in a ConTeXt style file. Five years ago I tried to create such a
> style file by hand, but I gave up.
XSL was designed specifically to parse XML. ConTeXt has facilities for
mapping XML tokens, as you've used. Depending on the complexity of
what you're trying to accompli
text and I think the structure too
> so that it was beyond my knowledge to generate a general style file for
> all texts.
And it’s probably impossible. Like with HTML and ePub export, the mapping of
structures is very individual.
Best, Hraban
__
welcome.
2. The "Deutsches Text Archiv" has prepared a text corpus of German
texts up to 1900 in TEI PS XML, so we could use them directly to typeset
books. What I am looking for is a script to extract all XML tags/tokens
from their files to have a complete list of things that should be
]
\setupbodyfontenvironment[default] [em=italic]
Not necessary because Pagella has no slanted alternative and \sl uses
the italic alternative.
\setupdelimitedtext[blockquote][style=\tfx,
before={\blank\setupinterlinespace[line=2.4ex]},after={\blank}]
My publisher thinks the default scaling of 'x' (0.8) is too
I have the following setup currently, involving:
\definefontfamily[mainface][rm][texgyrepagella][tf=file:texgyrepagella-regular.otf]
\setupbodyfont[mainface,11pt]
\setupbodyfontenvironment[default] [em=italic]
\setupdelimitedtext[blockquote][style=\tfx,
before={\blank\setupinterlinespace[line
\par to make the change of
>> linespacing work:
>> \framed[align=flushright,frame=on,offset=none,width=106.400bp]{\colored[r=0.000,
>> g=0.000,
>> b=0.000]{\switchtobodyfont[11.0pt] \setupinterlinespace[14pt] \rm
>> [My]\\Application\\(Component)\par }}
>>
-archive.com/ntg-context@ntg.nl/msg45676.html
Use style/color keys when possible.
\starttext
\framed
[align=flushright,
offset=none,
width=106.400bp,
foregroundcolor=black,
foregroundstyle={\switchtobodyfont[11.0pt]\setupinterlinespace[line=2.4ex]}]
{[My]\par Application\par (Component)\par
t;
> \starttext
>
> \startframed
> \samplefile{knuth}
> \stopframed
>
> \startframed[width=max,align=normal]
> \samplefile{knuth}
> \stopframed
>
> \stoptext
>
> or do you want to change to change the spacing
>
> \starttext
>
> \startframedtext[widt
want to have a linebreak at the end of the frame
\starttext
\startframed
\samplefile{knuth}
\stopframed
\startframed[width=max,align=normal]
\samplefile{knuth}
\stopframed
\stoptext
or do you want to change to change the spacing
\starttext
\startframedtext[width=max,style
gt;> right = false,
>> }
>>
>> local all = table.setmetatableindex({ }, function(t,k)
>> return shared
>> end)
>>
>> languages.hyphenators.traditional.installmethod("dna",
>> f
the kind of thing found here Creating a
style file in ConTeXt | Random Determinism
<https://randomdeterminism.wordpress.com/2009/10/21/creating-a-style-file-in-context/>
where the writer explains things bit by bit but importantly, offers a
summary of the code at the end. I probably don'
ary,word,n)
return all
end
)
\stopluacode
\definehyphenationfeatures
[dna]
[characters=all,
alternative=dna]
\starttext
\startframedtext[width=6cm,style=mono]
\sethyphenationfeatures[dna]
\setuphyphenation[method=traditional]
GATTGCTTAC
>
> languages.hyphenators.traditional.installmethod("dna",
> function(dictionary,word,n)
> return all
> end
> )
> \stopluacode
>
> \definehyphenationfeatures
> [dna]
> [characters=all,
> alternative=dna]
>
>
end
)
\stopluacode
\definehyphenationfeatures
[dna]
[characters=all,
alternative=dna]
\starttext
\startframedtext[width=6cm,style=mono]
\sethyphenationfeatures[dna]
\setuphyphenation[method=traditional]
GATTGCTTACTCCTGGTTGG%
TCTTACATTCTGTCGCCTC%
CTACTAGAG
);
draw fullsquare xyscaled (1.8cm,3.8cm) withcolor \MPcolor{violet};
draw lmt_text[
text = s,
color = c,
style = "bold",
]
)
enddef;
draw card("A",red) rotatedaround((1cm,2cm),5);
draw card("L",green) rotatedarou
[content]
> [list={chapter,section,title,subject,subsection}]
> \setuplist[chapter][style=normal,alternative=b, before=]
Hi Julian,
\completecontent is similar to simply use:
\title{Contents}
\placelist[content]
If you include title in \setupcombinedlist[content], you are
t; \setupcombinedlist
> [content]
> [list={chapter,section,title,subject,subsection}]
> \setuplist[chapter][style=normal,alternative=b, before=]
>
> Grateful for any help with this,
Usually the unnnumbered headers aren’t part of any ToC, but since you include
title, you also get the T
1001 - 1100 of 7117 matches
Mail list logo
