Wildcards not working
I am trying to cd into a directory referenced by a value in a list with wildcards like shell command ls test* or cd test* however nothing seems to work, I have tried amongst others $dir9= system(ls $dir1.*\$); opendir(DIRLIST,.); $dir9=grep$dir1.*\$, readdir DIRLIST -- Linux, Gnome what more do you need http://www.redtux.demon.co.uk -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
extra characters return plus 0 in script
I'm getting confused - I have the following script
open(DESK,gtkdoclist) or die cant open;
@desk1=DESK;
foreach $desk1 (@desk1){
chomp $desk1;
print $desk1\n;
$gtkdoc1=system(grep -h gtk_doc_min_version= $desk1);
chomp $desk1;
print $gtkdoc1;
however the output is this
(notice the zeros at the start of line)
atk/configure.in
gtk_doc_min_version=0.6
0atk/configure
gtk_doc_min_version=0.6
0at-spi/configure.in
gtk_doc_min_version=0.6
0at-spi/configure
gtk_doc_min_version=0.6
0bonobo-activation/configure.in
gtk_doc_min_version=0.6
the source file looks like this
atk/configure.in
atk/configure
at-spi/configure.in
at-spi/configure
bonobo-activation/configure.in
bonobo-activation/configure
As you can see there are extraneous returns and zeros - anyone any idea
where they are coming from?
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: extra characters return plus 0 in script
On Fri, 2002-11-22 at 05:44, John W. Krahn wrote:
Mike wrote:
I'm getting confused - I have the following script
open(DESK,gtkdoclist) or die cant open;
@desk1=DESK;
foreach $desk1 (@desk1){
chomp $desk1;
print $desk1\n;
$gtkdoc1=system(grep -h gtk_doc_min_version= $desk1);
chomp $desk1;
print $gtkdoc1;
Solved the immediate problem but now from this script
#!/usr/bin/perl -w
open(DESK,gtkdoclist) or die cant open;
@desk1=DESK;
foreach $desk1 (@desk1){
print $desk1;
$desk3=$desk1;
$gtkdoc1=`grep gtk_doc_min_version= $desk1`;
chop $gtkdoc1;
chomp $gtkdoc1;
chomp $gtkdoc1;
print $gtkdoc1\n;
@gtkdoc2=split /=/, $gtkdoc1;
print $gtkdoc2[1]\n;
$gtkdoc3=$gtkdoc2[1];
$mult='10';
$gtkdoc4=$gtkdoc3 * $mult;# this is the error
print $gtkdoc3
$gtkdoc5=$gtkdoc1;
gives the following error
atk/configure.in
gtk_doc_min_version=0.6
0.6
Filehandle main::0.6 never opened at ./gtkdocchk line 17, DESK line
41.
as you can see (0.6) my var for calculation seems in scope but
calculation is not taking place
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: extra characters return plus 0 in script
On Sat, 2002-11-23 at 04:50, John W. Krahn wrote:
Mike wrote:
On Fri, 2002-11-22 at 05:44, John W. Krahn wrote:
Mike wrote:
I'm getting confused - I have the following script
open(DESK,gtkdoclist) or die cant open;
@desk1=DESK;
foreach $desk1 (@desk1){
chomp $desk1;
print $desk1\n;
$gtkdoc1=system(grep -h gtk_doc_min_version= $desk1);
chomp $desk1;
print $gtkdoc1;
Did you try the code that I posted here in my last reply?
I modified my code to use backticks, when the code worked up to that
point - thanks.
Solved the immediate problem but now from this script
#!/usr/bin/perl -w
open(DESK,gtkdoclist) or die cant open;
^^
You should include the actual file name and the $! variable in the error
message.
I know I should (and would if the file handle was not being opened -
noting after this would work if it wasn't)
@desk1=DESK;
foreach $desk1 (@desk1){
print $desk1;
^ ^
The quotation marks are not required as the print function will convert
everything it prints to a string.
$desk3=$desk1;
$gtkdoc1=`grep gtk_doc_min_version= $desk1`;
Do you understand what the backticks do in a scalar context?
I think so - ie: feeding the result back to perl ($gtkdoc1 above)
chop $gtkdoc1;
chomp $gtkdoc1;
chomp $gtkdoc1;
Do you understand what chop() and chomp() do?
yep - just making sure
print $gtkdoc1\n;
@gtkdoc2=split /=/, $gtkdoc1;
print $gtkdoc2[1]\n;
$gtkdoc3=$gtkdoc2[1];
$mult='10';
$gtkdoc4=$gtkdoc3 * $mult;# this is the error
print $gtkdoc3
^
The actual error is here. Something is missing.
$gtkdoc5=$gtkdoc1;
gives the following error
atk/configure.in
gtk_doc_min_version=0.6
0.6
Filehandle main::0.6 never opened at ./gtkdocchk line 17, DESK line
41.
as you can see (0.6) my var for calculation seems in scope but
calculation is not taking place
That is because the result of the multiplication is stored in a
different variable then the one you are printing.
sorry about the typo in the last print. I am still trying to work out
where the error is coming from.
more errors follow to show more of what seems to be happening
glib/configure.in
gtk_doc_min_version=0.6
0.6
Filehandle main::6 never opened at ./gtkdocchk line 17, DESK line 41.
glib/configure
gtk_doc_min_version=0.6
0.6
Filehandle main::6 never opened at ./gtkdocchk line 17, DESK line 41.
gnome-panel/configure.in
gtk_doc_min_version=0.9
0.9
Filehandle main::9 never opened at ./gtkdocchk line 17, DESK line 41
The Filehandle main error seems to be referencing the first digit to the
right of the decimal point
As I understand it up to my problem is
I split $gtkdoc1 - OK
I print $gtkdoc2[1] - OK
I assign this to $gtkdoc3 -Ok
I print this to be sure (0.6 or 0.9 or 0.7 etc) -Ok
then I try to assign to gtkdoc4 a multiplication of $gtkdoc3 * $mult,
which is where it goes toes up
John
--
use Perl;
program
fulfillment
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Problem calling sub
(@file1){
#$file1=~s/gtk_doc_min_version=0.7/gtk_doc_min_version=0.10/g;
#print GTKDOCERR1 $file1
#};
#close GTKDOCERR;
#close GTKDOCERR1;
#open (GTKDOCERR1,gstdoc.m4) or die no such file1;
#open (GTKDOCERR,common//m4//gst-doc.m4) or die no such file3 $@;
#@file3=GTKDOCERR1;
#print GTKDOCERR @file3;
system (CPPFLAGS=$cflags ./configure --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --disable-gtk-doc --disable-more-warnings --disable-plugin-builddir);
system './autogen.sh';
system (CPPFLAGS=$cflags ./configure --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --disable-gtk-doc --disable-more-warnings --disable-plugin-builddir);
system 'make';
system (checkinstall -R -y --pkgname=$dir1 --pkgversion=$ARGV[0] --pkgrelease=$ARGV[1] --strip=$strip --stripso=$stripso);
}
elsif ( $dir1 eq 'mb_client' ) {
system './autogen.sh';
system (CPPFLAGS=$cflags ./configure --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --enable-gtk-doc=no --disable-more-warnings );
system 'make';
system (checkinstall -R -y --pkgname=$dir1 --pkgversion=$ARGV[0] --pkgrelease=$ARGV[1] --strip=$strip --stripso=$stripso);
}
elsif ( $dir1 eq 'mad-0.14.2b' or $dir1 eq 'cog-0.5.1' or $dir1 eq 'startup-notification-0.4' ) {
system (./configure --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --enable-gtk-doc=no --disable-more-warnings );
system 'make';
system (checkinstall -R -y --pkgname=$dir1 --pkgversion=$ARGV[0] --pkgrelease=$ARGV[1] --strip=$strip --stripso=$stripso);
}
elsif ( $dir1 eq 'Hermes-1.3.2' ) {
system(rm -rf libtool lt*);
system(libtoolize --force);
system './autogen.sh';
system (./configure --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --enable-gtk-doc=no --disable-more-warnings );
system 'make';
system (checkinstall -R -y --pkgname=$dir1 --pkgversion=$ARGV[0] --pkgrelease=$ARGV[1] --strip=$strip --stripso=$stripso);
}
elsif ( $dir1 eq 'nautilus' ) {
system (./autogen.sh --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --enable-gtk-doc=no --disable-more-warnings );
system 'make';
system (checkinstall -R -y --pkgname=$dir1 --pkgversion=$ARGV[0] --pkgrelease=$ARGV[1] --strip=$strip --stripso=$stripso);
}
elsif ( $dir1 eq 'gtkhtml2' ) {
system (CPPFLAGS=$cflags ./autogen.sh --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --enable-gtk-doc=no --disable-more-warnings );
system 'make';
system (checkinstall -R -y --pkgname='libgtkhtml2' --pkgversion=$ARGV[0] --pkgrelease=$ARGV[1] --strip=$strip --stripso=$stripso);
}
elsif ( $dir1 eq 'libxslt' ) {
system (CPPFLAGS=$cflags ./autogen.sh --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --enable-gtk-doc=no --disable-more-warnings );
system 'make';
system(make install);
}
else
{
system (CPPFLAGS=$cflags ./autogen.sh --prefix=$prefix --sysconfdir=$sys --localstatedir=$local $debug --enable-gtk-doc=no --disable-more-warnings);
system 'make';
system (checkinstall -R -y --pkgname=$dir1 --pkgversion=$ARGV[0] --pkgrelease=$ARGV[1] --strip=$strip --stripso=$stripso);
}
system(make distclean);
chdir $dir0;
$dir3=getcwd();
print $dir3\n;
system(/home/mike/rmla);
};
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Question about permissions
I have developed an intranet perl/postgesql app which works fine except for one bizarre problem I have all the appropriate scripts with the following permissions -rw-r-xr-- 1 mike apache However periodically the permissions change with the group ownership changing. This is on Fedora with perl-5.8.1, apache-2.0.47,postgresql-7.4.2 Anyone any clues why this is happening? -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
OT - problem with script running on a refresh
Hi I have a CGI/dbi script which whenever the page is reloaded the
following executes
print start_multipart_form (POST);
print Subject, popup_menu(-name='Subject1',-values=[EMAIL PROTECTED]);
print Area, popup_menu(-name='area1',-values=[EMAIL PROTECTED]),p;
print Description,textfield(-name='file_desc',-size='50');
$subj1=param('Subject1');
$area1=param('area1');
$desc=param('file_desc');
#print $subj1;
#$subj2=param('Subject1');
#$area2=param('area1');
$row3=$dbh-prepare(SELECT subj_id FROM tb_file_subj WHERE subj_desc
= ?);
$row4=$dbh-prepare(SELECT area_id FROM tb_file_area WHERE area_desc
= ?);
$row3-bind_param(1,$subj1);
$row4-bind_param(1,$area1);
$row3-execute();
$row4-execute();
while (($subj2) = $row3-fetchrow_array()){
$subj3=$subj2;
}
print $subj3;
while (($area2) = $row4-fetchrow_array()){
$area3=$area2;
}
print $area3;
$sth=$dbh-prepare(q{INSERT INTO tb_files (subj, area, file_no,
file_desc) select ?, ?,(SELECT coalesce(max(file_no),0)+1 FROM tb_files
WHERE subj = ? AND area = ?),?}) ;
$sth-bind_param(1,$subj3);
$sth-bind_param(2,$area3);
$sth-bind_param(3,$subj3);
$sth-bind_param(4,$area3);
$sth-bind_param(5,$desc);
$sth-execute ;
print p;
if($DBI::errstr ne ''){
print $DBI::errstr\n;
}
print p;
print submit;
print end_form;
This is not I want - I only want it to execute when I click submit - is
this possible?
Curioisly, when I click refresh, the values dont reset
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
OT - problem with script running on a refresh
Hi I have a CGI/dbi script which whenever the page is reloaded the
following executes
print start_multipart_form (POST);
print Subject, popup_menu(-name='Subject1',-values=[EMAIL PROTECTED]);
print Area, popup_menu(-name='area1',-values=[EMAIL PROTECTED]),p;
print Description,textfield(-name='file_desc',-size='50');
$subj1=param('Subject1');
$area1=param('area1');
$desc=param('file_desc');
#print $subj1;
#$subj2=param('Subject1');
#$area2=param('area1');
$row3=$dbh-prepare(SELECT subj_id FROM tb_file_subj WHERE subj_desc
= ?);
$row4=$dbh-prepare(SELECT area_id FROM tb_file_area WHERE area_desc
= ?);
$row3-bind_param(1,$subj1);
$row4-bind_param(1,$area1);
$row3-execute();
$row4-execute();
while (($subj2) = $row3-fetchrow_array()){
$subj3=$subj2;
}
print $subj3;
while (($area2) = $row4-fetchrow_array()){
$area3=$area2;
}
print $area3;
$sth=$dbh-prepare(q{INSERT INTO tb_files (subj, area, file_no,
file_desc) select ?, ?,(SELECT coalesce(max(file_no),0)+1 FROM tb_files
WHERE subj = ? AND area = ?),?}) ;
$sth-bind_param(1,$subj3);
$sth-bind_param(2,$area3);
$sth-bind_param(3,$subj3);
$sth-bind_param(4,$area3);
$sth-bind_param(5,$desc);
$sth-execute ;
print p;
if($DBI::errstr ne ''){
print $DBI::errstr\n;
}
print p;
print submit;
print end_form;
This is not I want - I only want it to execute when I click submit - is
this possible?
Curioisly, when I click refresh, the values dont reset
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
Re: Mail::Sendmail
On Wed, 2004-06-09 at 10:59 +0200, Miguel ngel Morales wrote: Hi all! I am using Mail::Sendmail module to send e-mails from my perl application but the text of these messages seems to be too much long and when receiving the e-mail the text of the message is not complete. Do yo know if there are any message size limitation? It this limitation exists, what module, without limitation, can I use? Thanks in advance, Miguel ngel Have you tried MIMEtools/mailtools (they let you send attachments as well) ** Madrid 2003 Global IPv6 Summit Presentations and videos on line at: http://www.ipv6-es.com This electronic message contains information which may be privileged or confidential. The information is intended to be for the use of the individual(s) named above. If you are not the intended recipient be aware that any disclosure, copying, distribution or use of the contents of this information, including attached files, is prohibited. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
Very wierd problem with CGI.pm
Has anyone ever come accross this wied problem before I have a script which pulls records from a DB then loops into a form and shows each record, with the id no being concatenated to the field name to give a unique record id. However if I have this Banked,textfield(-name='bk_amt'.$bank_inv,-value=$bk_amt1); the params are zeroed but if I have this Banked,textfield(-name=' bk_amt'.$bank_inv,-value=$bk_amt1); (ie; a space) everything is fine Anyone have any idea what is going on here? -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
Re: Very wierd problem with CGI.pm
On Sat, 2004-06-12 at 08:30 -0700, David Storrs wrote:
On Fri, Jun 11, 2004 at 01:07:54PM +0100, mike wrote:
Has anyone ever come accross this wied problem before
I have a script which pulls records from a DB then loops into a form and
shows each record, with the id no being concatenated to the field name
to give a unique record id.
However if I have this
Banked,textfield(-name='bk_amt'.$bank_inv,-value=$bk_amt1);
the params are zeroed
but if I have this
Banked,textfield(-name=' bk_amt'.$bank_inv,-value=$bk_amt1);
(ie; a space)
everything is fine
Anyone have any idea what is going on here?
Can't really tell without seeing your form but my first guess would be
that the HTML for the textfield looks something like this:
input type=text name= bk_amt ...
Meaning that its name actually IS ' bk_amt' and not 'bk_amt'.
Therefore, when you try to access the field name without a space,
there is no such field, so you get nothing.
No, wrong way round, if I name the test field WITHOUT a space then I
have a problem, if there is a space it works sort of (it re-orders the
params)
this is the script in full (except user/pass info)
#!/usr/bin/perl -w
use warnings;
use CGI::Carp;
use CGI qw/:standard/;
print header;
print start_html(-title=Banking Input,-BGCOLOR='#FCD08C',);
use DBI;
;use DBD::Pg;
$dbh=DBI-connect(dbi:Pg:dbname=data_cc,$user,$pw);
$row1=$dbh-prepare(SELECT date_paid,bank_inv,amount_paid, cheque ,
bk_date , bk_amt FROM vw_banking GROUP BY bank_inv,date_paid,
amount_paid,cheque,bk_date , bk_amt);
$row1-execute();
print start_multipart_form (POST,'bankchg.pl');
while (($date_paid,$bank_inv,$amount_paid,$cheque,$bk_date,$bk_amt1)=
$row1-fetchrow_array()){
print $date_paid,$bank_inv,$amount_paid, $cheque , $bk_date ,
$bk_amt,, br /;
print Inv Id ,textfield('id'.$bank_inv,$bank_inv,10), amount ,
textfield('amount'.$bank_inv,$amount_paid,10),Bank date, textfield
('bk_date'.$bank_inv,$bk_date,10),Cheque ,textfield
('cheque'.$bank_inv,$cheque,20),
print Banked,textfield(-name='bk amt'.$bank_inv,-value=$bk_amt1);
}
print submit();
print end_form;
print end_html;
this is the table structure
View public.vw_banking
Column| Type | Modifiers
-+---+---
date_paid | date |
bank_inv| integer |
amount_paid | numeric(10,2) |
code| character varying(15) |
sum | numeric |
cheque | character varying(20) |
bk_date | date |
bk_amt | numeric(15,2) |
--Dks
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
Passing httpd auth details to cgi-script
Is it possible to pass user/password from apache auth to cgi-scripts. To explain I have apache set to authenticate using htpasswd, checking a file in /etc/httpd When users access the site they get a user/password prompt This then leads to a bunch of cgi-scripts which access DBI::DBDpg Is it possible to get the authentication details and pass them to the scripts so they can be passed to postgres so PG can then authenticate without further user input (pg is using md5 auth) thanks fo any tips -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
Re: Using MIME::Lite to send mail/or attachments
On Wed, 2004-06-23 at 10:22 -0700, jason corbett wrote: Can anyone tell me where I can find MIME::Lite or any other perl method to send attachments/documents in mail format? If you have tips or scripts on using it to send mail (documents attached), please let me know. Thanks, JC try MIME::Entity - I find it nice -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
Testing for empty value
I have the following code
print date times,@date,br;
if ($ti1){
print time 1 is not empty;
}
else {
print time 1 is empty;
}
If there is a value it works but not if there isn't ie:
if there is a value it prints time 1 is not empty, but if there is not
nothing comes out
anyone any ideas?
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
HELP! Reg-ex question
Given the following code snippet: - print $text\n; my $text=sour red apples; my $pattern=(sour); my $replacement=very \$1; $text=~s/$pattern/$replacement/; print $text\n; - I was expecting very sour red apples to be printed, but instead I got very $1 red apples. I tried changing: $text=~s/$pattern/$replacement/; to $text=~s/$pattern/$replacement/ee; but that did not work either. How can I make it work, so that it was as if I had written: $test=~s/$pattern/very $1/; # With the very $1 being extracted from the #$replacement variable Thanks -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: rearrange text
Well this is the final code I put together with everyones help from this
group:
#!/usr/bin/perl
use warnings;
use strict;
print Enter the path of the INFILE to be processed:\n;
chomp (my $infile = STDIN);
open(INFILE, $infile)
or die Can't open INFILE for input: $!;
print Enter in the path of the OUTFILE:\n;
chomp (my $outfile = STDIN);
open(OUTFILE, $outfile)
or die Can't open OUTFILE for input: $!;
print Enter in the LENGTH you want the sequence to be:\n;
chomp (my $len = STDIN);
my ($name, @seq);
while ( INFILE ) {
chomp;
unless ( /^\s*$/ or s/^\s*(.+)// ) {
$name = $1;
my @char = ( split( // ), ( '-' ) x ( $len - length ) );
push @seq, ' '.@char $name;
}
}
{
local $ =\n;
print OUTFILE R 1 [EMAIL PROTECTED]; # The top of the file is
supposed
}
close INFILE;
close OUTFILE;
Basically it will take this file:
dog
atcgc
cat
atcgctac
mouse
agctata
and turn it into this:
R 1 10
a t c g c - - - - - dog
a t c g c t a c - - cat
a g c t a t a - - - mouse
However, I forgot that sometime the imput data is like this:
dog
agatgtagt
agtggttga
agggagc
cat
gcatcgatg
agcatatgc
mouse
actagcatc
acgtacgat
That is the sequence of letters can span multiple lines. I would like
the above script to handle input data that can possibly span several
lines as well as those that do not. and output as mentioned above.
You all have been much help! I have really learned a lot with the help
you've given so far!
-Thanks!
-Mike
In article [EMAIL PROTECTED],
[EMAIL PROTECTED] (David Wall) wrote:
--On Monday, August 25, 2003 6:50 PM -0400 Mike Robeson
[EMAIL PROTECTED] wrote:
OK, I feel like an idiot. When I initially asked for help with this I
just realized that I forgot two little details. I was supposed to add
the number of sequences as well as the length of the sequences at the
top of the output file.
That is this file:
dog
agatagatcgcatcga
cat
acgcttcgatacgctagctta
mouse
agatatacgggtt
is relly supposed to be:
3 22
a g a t a g a t c g c a t c g a - - - - - -dog
a c g c t t c g a t a c g c t a g c t t a -cat
a g a t a t a c g g g t t - - - - - - - - -mouse
The '3' represents the number of individual sequences in the file (i.e.
dog, cat, mouse). And the 22 is the number of letters and dashes there
are. The length is already in the script as $len. I am able to get the
length listed at the top. However, I cannot find a way to have the
number of sequences (the 3 in this case) printed to the top.
Here's one way (slightly altering John's solution), but it will use lots of
memory if the sequences are long.
#!/usr/bin/perl
use warnings;
use strict;
my ($name, $num_seq, @seq);
my $len = 30;
while ( DATA ) {
unless ( /^\s*$/ or s/^\s*(\S+)// ) {
my $name = $1;
my @char = ( /[acgt]/g, ( '-' ) x $len )[ 0 .. $len - 1 ];
push @seq, @char$name;
$num_seq++;
}
}
{
local $ =\n;
print [EMAIL PROTECTED];
}
__DATA__
dog
agatagatcgcatcga
cat
acgcttcgatacgctagctta
mouse
agatatacgggt
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Perl and Jscript Question
Im working on an example from a book and incorperating perl script to a scroll type program this is what I have for perl: #!/usr/bin/perl print Content-type: application/x-javascript\n\n; print var result = new Array(; use LWP::Simple; $URL = get 'http://www.perl.org'; print $URL; print \)\n; On the web page in put: SCRIPT LANGUAGE=JavaScript src=http://www.mydomain.com/cgibin/myscript.pl; !-- //-- /SCRIPT SCRIPT LANGUAGE=JavaScript !-- document.write(result) //-- /SCRIPT I get an error result no defined I believe it is in teh perl code that my error originates. Thanks ! Mike -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
very confused - chdir not working
Hi
I am building the following script to recurse back and forth down a
directory tree
Unfortunatel chdir does not work
This is the script
#!/usr/bin/perl -ww
open(BLD_LIST,buildlist);
my @pkg=BLD_LIST;
my $ver=$ARGV[2];
my $name=$ARGV[0];
my $release=$ARGV[1];
foreach my $pkg (@pkg){
my $dir1=$pkg;
use Cwd;
my $dir2=getcwd();
my $dir3=$dir2/$dir1/;
chdir $dir3 or die cannot change;
my $dir4=getcwd();
print $dir3\n
the print shows the directory that I am trying to change to but chdir
just does not work
--
Linux, Gnome what more do you need
http://www.redtux.demon.co.uk
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: very confused - chdir not working
On Fri, 2002-10-11 at 05:36, Michael Fowler wrote:
On Fri, Oct 11, 2002 at 04:16:41AM +0100, mike wrote:
Unfortunatel chdir does not work
In what way doesn't it work? Are you getting an error? How are you
verifying it doesn't work?
no errors but directory does not change
with use script and -ww all I get is my output from a die statement
This is the script
#!/usr/bin/perl -ww
open(BLD_LIST,buildlist);
my @pkg=BLD_LIST;
my $ver=$ARGV[2];
my $name=$ARGV[0];
my $release=$ARGV[1];
foreach my $pkg (@pkg){
my $dir1=$pkg;
use Cwd;
my $dir2=getcwd();
my $dir3=$dir2/$dir1/;
chdir $dir3 or die cannot change;
my $dir4=getcwd();
print $dir3\n
You're missing a close brace. Is there more code?
yep - missed the copy
the print shows the directory that I am trying to change to but chdir
just does not work
What do you see when you print $dir4?
the previous directory ie: not changed
Michael
--
Administrator www.shoebox.net
Programmer, System Administrator www.gallanttech.com
--
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
--
Linux, Gnome what more do you need
http://www.redtux.demon.co.uk
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: very confused - chdir not working
On Fri, 2002-10-11 at 09:14, Michael Fowler wrote: On Fri, Oct 11, 2002 at 06:50:00AM +0100, mike wrote: On Fri, 2002-10-11 at 05:36, Michael Fowler wrote: On Fri, Oct 11, 2002 at 04:16:41AM +0100, mike wrote: Unfortunatel chdir does not work In what way doesn't it work? Are you getting an error? How are you verifying it doesn't work? no errors but directory does not change with use script and -ww all I get is my output from a die statement You get output from your die statement? So, the script dies with the error cannot change on line ...? If that's the case, that's an error; include $! in your die and that'll tell you why the chdir failed. Also, that's the second time you've used -ww, so I'm thinking it isn't a typo. Only one -w is necessary. What do you see when you print $dir4? the previous directory ie: not changed Ok, this would imply the die is never being called, i.e. chdir never fails. So, let's clear this up; does your die ever get called? Just to clarify - $dir4 only gets printed if I remove the die When I add a print $dir3 it shows what it shows is this ../build.pl /root/cvs/esound # this the output of $dir3 / cannot change No such file or directory at ./build.pl line 13, BLD_LIST line 55. this is ls in same directory, as you can see esound is there [root@localhost cvs]# ls atkesoundgnome-desktop gnome-vfs libglade librsvg bonobo-activation g2_build gnome-icon-theme gtk+ libgnome libwnck build1.pl g2buildlist gnome-mime-data gtk-doc libgnomecanvas libxml2 buildlist gail gnome-panel gtk-engines libgnomeprintlibxslt buildlist1 glib gnome-session intltool libgnomeprintui libzvt build.pl gnome-applets gnome-terminallibart_lgpl libgnomeui linc build.sh gnome-common gnome-themes libbonobo libgtop ORBit2 eelgnome-control-center gnome-utils libbonoboui libIDL pango Michael -- Administrator www.shoebox.net Programmer, System Administrator www.gallanttech.com -- -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] -- Linux, Gnome what more do you need http://www.redtux.demon.co.uk -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: very confused - chdir not working
On Fri, 2002-10-11 at 23:08, Michael Fowler wrote:
On Fri, Oct 11, 2002 at 04:40:30PM +0100, mike wrote:
../build.pl
/root/cvs/esound # this the output of $dir3
/
cannot change No such file or directory at ./build.pl line 13,
BLD_LIST line 55.
this is ls in same directory, as you can see esound is there
I don't have any context for what the three lines you output are. The
reason you can't chdir, though, is clear; now all you have to figure out is
why you're getting an error. I can assure you it's not because either Perl
or the chdir function is broken, so it must be something else.
Perhaps your current directory isn't what you think it is. I'd suggest you
make it more clear in your print; i.e. something along the lines of:
print cwd: , getcwd(), , chdir to: $dir\n;
chdir($dir) || die(Unable to chdir to directory \$dir\: \l$!.\n);
That way you know where you are in the filesystem, and what you're trying to
chdir to.
I have fixed the problem now, it turns out it was not a problem but one
of context with shell commands, by using system instead of backticks it
works
thanks for help
for info - revised script (I wrote in bash in the end but just wanted to
work out why it wasn't working)
#!/usr/bin/perl -ww
open(BLD_LIST,buildlist);
my @pkg=BLD_LIST;
my $ver=$ARGV[2];
my $name=$ARGV[0];
my $release=$ARGV[1];
foreach my $pkg (@pkg){
my $dir1=$pkg;
$dir1=~chomp $dir1;
use Cwd;
$dir0=getcwd();
print $dir0\n;
chdir $dir1;
$dir2=getcwd();
print $dir2\n;
system './autogen.sh';
chdir $dir0;
$dir3=getcwd();
print $dir3\n;
}
Michael
--
Administrator www.shoebox.net
Programmer, System Administrator www.gallanttech.com
--
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
--
Linux, Gnome what more do you need
http://www.redtux.demon.co.uk
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: DBI prepare syntax
That was a rookie mistake :). Double quotes works, thanks Beginner!
Beginner [EMAIL PROTECTED] wrote: On 8 Nov 2007 at 8:59, Mike wrote:
Hi,
#Update override_exclude set th_flag=N to indicate that thesaurus entries
#have been added to sierra2_thesaurus.xml
use DBI;
my $dbh = DBI-connect(dbi:mysql:endeca_tracking,$user,$password);
my $sth = $dbh-prepare('update override_exclude set th_flag=N
where pid=$pid') or die Couldn't prepare statement .$dbh-errstr;
$sth-execute;
I'm no guru but shouldn't you be double quoting the prepare
statement:
my $sth = $dbh-prepare(update override_exclude set th_flag='N'
where pid=$pid)
or better still
my $sth = $dbh-prepare('update override_exclude set th_flag=N
where pid=?)
$sth-execute($pid);
HTH,
Dp.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/
__
Do You Yahoo!?
Tired of spam? Yahoo! Mail has the best spam protection around
http://mail.yahoo.com
Re: DBI prepare syntax
Perl is Awsome! Thanks for explaining that basic concept to me Douglas!
Douglas Hunter [EMAIL PROTECTED] wrote: Mike wrote:
Hi,
I have a variable setup as $pid and i've tried to call this in the prepare
part of the DBI module but i'm get an Unknown column $pid syntax error.
Probably $pid was passed as a string instead of a variable inside the prepare
(''). Anyone has an idea of how i can fix this? Thanks.
DBD::mysql::st execute failed: Unknown column '$pid' in 'where clause' at
createThesaurus.pl line 33,
---
while ( ) {
next if $. == 1; # exclude header
chomp;
my ($pid,$thesaurus_from,$thesaurus_to,$thesaurus_type) = split /\|/;
#Update override_exclude set th_flag=N to indicate that thesaurus entries
#have been added to sierra2_thesaurus.xml
use DBI;
my $dbh = DBI-connect(dbi:mysql:endeca_tracking,$user,$password);
my $sth = $dbh-prepare('update override_exclude set th_flag=N
where pid=$pid') or die Couldn't prepare statement .$dbh-errstr;
The prepare statement here is inside single quotes, inside of which Perl
doesn't interpolate variables (it does inside double quotes). But DBI
has a mechanism called placeholders that allow you to not worry about
quoting and interpolation of variables, documented under the section
Placeholders and Bind Values in the DBI documentation.
You can change your prepare statement to:
$dbh-prepare('update override_exclude set th_flag=? where pid=?')
(the question marks denote the placeholder)
$sth-execute;
And then change your execute to:
$sth-execute( N, $pid );
to pass along the list of values meant to take the place of your
placeholders. This is generally safer than passing variables directly
to your prepare statement. For instance, if $pid held a nasty string
that terminated the original statement and then followed up with
something destructive, such as 5; truncate table_foo;, bad things
could happen. With placeholders you don't have to worry about that, as
the database driver fixes that up by quoting it properly (not to say you
shouldn't still validate input to a database!)
Hope that helps a bit,
-- Douglas
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/
__
Do You Yahoo!?
Tired of spam? Yahoo! Mail has the best spam protection around
http://mail.yahoo.com
DBI prepare syntax
Hi,
I have a variable setup as $pid and i've tried to call this in the prepare part
of the DBI module but i'm get an Unknown column $pid syntax error.
Probably $pid was passed as a string instead of a variable inside the prepare
(''). Anyone has an idea of how i can fix this? Thanks.
DBD::mysql::st execute failed: Unknown column '$pid' in 'where clause' at
createThesaurus.pl line 33,
---
while ( NEW ) {
next if $. == 1; # exclude header
chomp;
my ($pid,$thesaurus_from,$thesaurus_to,$thesaurus_type) = split /\|/;
#Update override_exclude set th_flag=N to indicate that thesaurus entries
#have been added to sierra2_thesaurus.xml
use DBI;
my $dbh = DBI-connect(dbi:mysql:endeca_tracking,$user,$password);
my $sth = $dbh-prepare('update override_exclude set th_flag=N where
pid=$pid') or die Couldn't prepare statement .$dbh-errstr;
$sth-execute;
__
Do You Yahoo!?
Tired of spam? Yahoo! Mail has the best spam protection around
http://mail.yahoo.com
Pass a wild card argument in Win32
I've searched google and much of this group to find the answer to this problem with no luck. I am able to pass regular arguments to perl but is it possible to get the * operator to work like it does in Linux? Like typing in *.cpp to pass perl all .cpp files. I already fixed the issue getting the file type to open C:\perl\bin \perl 1% %* but this doesnt seem to work with the wild card. Thank you. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/
RE: extracting links from HTML data (7my own problem usiing grep
On Wed, 2002-01-16 at 07:15, Gary Hawkins wrote:
However the script continues
print @list3;
my $var1='META';
@lista= grep{$var1} @list3;## not picked up at all
print @lista
anyone any clues
Suppose I'm a little confused but perhaps you meant:
print @list3;
@lista= grep(/META/, @list3);
print @lista;
/g
thanks a lot
couple of points
this is basically a learning/getting rid of rustiness exercise
why is this syntax not mentioned in programming perl - any ideas?
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: Greedy 'split' ???
On Thu, 2002-01-17 at 00:55, Michael Fowler wrote: On Wed, Jan 16, 2002 at 03:57:44PM -0800, Scott Lutz wrote: $DOM_NAME, my $TLD) = split(/\./, $domain); creates two variable out of an inputted domain name, until this comes along: domainname.org.uk which it interprets as : $DOM_NAME = domainname $TLD = org so is it possible to do a 'greedy split' ?? Specifying a third argument to split would solve this problem how you want. E.g. my $domain = domainname.org.uk; my($DOM_NAME, $TLD) = split(/\./, $domain, 2); $DOM_NAME eq 'domainname' $TLD eq 'org.uk' However, unless you're guaranteed that the first portion of the name will be the domain, and the last portion will be the toplevel, this won't work in all situations. Given the above, www.foo.org.uk would parse as 'www' and 'foo.org.uk'. The only solution to this problem would be to know what toplevels you can have and parse it based on that. as an idea would using reverse on the string before split be an idea, then reversing the spit strinngs + a join on $array[1],array[2] etc -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
question re mtiong email tags
Hi I have been trying to set oup a script for munging html files My problem is trying to match tags in html which of course have specific meanings in perl. Does anyone hve any advice on this or know of a good resource (this is something of a building up expertise in perl fundamentals so not interseted in module references) Bsically I just want to get some idea about escaping the sodding things -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Perl Help
I dont thing my ISP's News Server is working properly so I will thry it
from here.
I am trying to log the users IP via the web and nothing happens the date
nore the ip get there. Also if I put the append to the open statement I
get an error via the web also. This is the code. I got it to show up
via the web but it never gets to the file. Is there something I am
missing?
#!/usr/bin/perl
$logfile = '/usr/local/apache/logs/ipaccess.log';
$date = scalar localtime;
open(IPLOG, $logfile) || die Cannot open $logfile;
$ip = $ENV{'REMOTE_ADDR'};
print IPLOG $date;
print IPLOG $ip;
close IPLOG;
If I do it this way it errors out via the web:
#!/usr/bin/perl
$logfile = '/usr/local/apache/logs/ipaccess.log';
$date = scalar localtime;
open(IPLOG, $logfile) || die Cannot open $logfile;
$ip = $ENV{'REMOTE_ADDR'};
print IPLOG $date;
print IPLOG $ip;
close IPLOG;
Mike
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
LISTBOX Problem
I am trying to populate a list box in a form with using the following
script and it works fine doing it this way:
#!/usr/bin/perl
print Content-type: text/html\n\n;
print HTMLHEAD\n;
print TITLE Current Weather Products/TITLE\n;
print /HEAD\n;
print BODY\n;
#print select name=\select\\n;
print form name=\form\\n;
print select name=\radar\
onChange=\window.location=document.form.radar.options[document.form.radar.selectedIndex].value\\n;
print option value=\\Zone Forecasts/option\n;
chdir(/var/www/html/members/wx/zfp/) || die Cannot chdir to
/var/www/html/members/wx/zfp/ ($!);
while (*) {
print option
value=\http://www.myserver.com/members/wx/zfp/$_\;$_/option \n;
}
/select\n
/BODY\n
/HTML\n
END
Here is the problem. If I change it to this:
#!/usr/bin/perl
print Content-type: text/html\n\n;
printEND
HTMLHEAD
TITLE Current Weather Products/TITLE
/HEAD
BODY
form name=\form\
select name=\radar\
onChange=\window.location=document.form.radar.options[document.form.radar.selectedIndex].value\
option value=\\Zone Forecasts/option
END
chdir(/var/www/html/members/wx/zfp/) || die Cannot chdir to
/var/www/html/members/wx/zfp/ ($!);
while (*) {
print option
value=\http://www.myserver.com/members/wx/zfp/$_\;$_/option \n;
}
printEND
/select\n
/BODY\n
/HTML\n
END
It errors out Can someone help me with this?
syntax error at ./listfiles.pl line 13, near chdir
(Might be a runaway multi-line string starting on line 4)
BEGIN not safe after errors--compilation aborted at ./listfiles.pl line
14.
Thanks Mike
Execute perl Script
How do you execute a perlscript within a perl script via the web? Mike -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: Dates Perl SQL7
On Wed, 2002-02-20 at 11:26, Mason, Andrew wrote: This is a concept question rather than a code question. I have a script which produces a simple report on some simple disk space stats for servers I work with. I thought it would be useful to put this information into a database on a daily basis. This would allow me to then look at historic data. Currently I am inserting the date a character string. I have learned that while I can do this I greatly limit my capabilities at the SQL end. SQL7 uses a number to represent date and time. I am sure that Perl does (or at least) can also treat numbers like this. Can anyone suggest what commands (or even modules) I should look up, relating to dates and times and conversion between different formats (Ie useful ones for manipulation vs human recognisable ones). From experience with SQL7 I would convert your character strings to iso dates first ie:10/12/2001 to 20011210 then SQL7 will be able to handle them assuming date is dd/mm/ split /'/'/; print $2$1$0 etc then should be an easy import (yes very quick and dirty) TAI rw -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Passing Arguments into a Program
If a program calls a perl script as follows: /tmp/perltest.pl abc def ghi jkl mno Is there a variable which would contain the arguments? -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
input with the symbol
What happens if I call a perl script as follows: test.pl abc What picks up the abc inside the script? In shell scripting I would just use a read statement (read a). Is there a like function in perl? -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
split delimiters query
Am I right in thinking that if you double quote the seperator in split the seperator is added to the array ie: @array3=split(/\t/,$value4); would add \t to the end of @array3 while @array3=split(/\t/,$value4); would not -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
Re: split delimiters query
On Wed, 2005-02-02 at 12:54 -0500, Jay wrote: On Wed, 02 Feb 2005 12:39:17 +, mike [EMAIL PROTECTED] wrote: Am I right in thinking that if you double quote the seperator in split the seperator is added to the array ie: @array3=split(/\t/,$value4); would add \t to the end of @array3 while @array3=split(/\t/,$value4); would not I think we need a little more information here, maybe a sample value for $value4. Split, though, doesn't add anything; it removes the delimiter. If you have: $value4 = one\ttwo\tthree\tfour\tfive ; @array3=split(/\t/, $value4) ; returns @array3 = [one, two, three, four, five] The delimiter is never included in the returned data. If you questions is really what happens when there is a trailing delimiter, or an empty field in the data?, the answer is, trailing delimiters are ignored, otherwise empty strings are returned. So if $value4 = \tone\t\ttwo\tthree\t\tfour\tfive\t ; then @array3 = [, one, , two, three, , four, five] If you need some other behavior, you need to constuct a more complex regex for split, but simple adding quotes doesn't change the behavior. HTH, afraid it did in my case (screwed up a dba query, which is how I noticed) the code without quoting the delimiter works with no further changes, this is on a fc3 box --jay -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
Re: split delimiters query
On Wed, 2005-02-02 at 09:23 -0500, Wiggins d'Anconia wrote:
mike wrote:
Am I right in thinking that if you double quote the seperator in split
the seperator is added to the array ie:
@array3=split(/\t/,$value4); would add \t to the end of @array3 while
As you have written it above I get a syntax error:
String found where operator expected at ./test.pl line 12, at end of line
(Missing semicolon on previous line?)
Can't find string terminator '' anywhere before EOF at ./test.pl line 12.
If you meant, C/\t/ then I still don't think you will get what you
want. Csplit just isn't that smart.
No the problem was that this ( with the quote in the right place) was
giving me what I didnt want.
this is the code
@value=param();
shift (@value);
shift (@value);
pop (@value);
print @value;
foreach $value (@value){
$value1=substr($value,0,9);
if ($value1 eq work_emai){
push (@value2,param($value));
push (@value2,\t);
#print $value2;
}
else {
push (@value2,param($value));
push (@value2,'##');
#print param($value)
}
}
$value4=join('',@value2);
print br,value4,$value4,br;
@array3=split(/\t/,$value4);
@[EMAIL PROTECTED];
with \t the \t was being inserted into a db field, without it
everything was hunky dory
@array3=split(/\t/,$value4); would not
What are you really trying to do?
http://danconia.org
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
DBI problem
I have the following query which works in psql
SELECT to_char('05 Feb 2005'::date,'-MM-DD')
However when I run it in DBI I get
$row6=$dbh-prepare(SELECT to_char('2005-02-05'::date,'-MM-DD'));
#$row6-bind_param(1,'2005-02-05');
$row6-execute();
Can't call method prepare on an undefined value at /home/www/cgi-
bin/times_upd_multi.pl line 46., referer: http://localhost/cgi-
bin/times_input_mult.pl
(I have tried various variations)
anyone any idea of a workaround?
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
CGI/DBI - Can anyone work out why this fails
I have the following code
$cat1;
if ($cat1){
my $cat1=%$category%;
}
else {
$cat1=$category;
}
$row=$dbh-prepare(SELECT contact_id,first_name,last_name,organisation
FROM tb_contacts WHERE (organisation ILIKE ? OR last_name ILIKE ?) OR
contact_id = ?);
$cat1;
print $cat1;
$row-bind_param(1,$cat1);
$row-bind_param(2,$cat1);
$row-bind_param(3,$cat1);
$row-execute();
this fails with
DBD::Pg::st execute failed: ERROR: invalid input syntax for integer:
ford at /home/www/cgi-bin/con_role_add_sel2_org.pl line 33., referer:
http://localhost/cgi-bin/con_role_add_sel1.pl
It only fails if I have both the name and int WHERE Criteria - in psql
it works fine
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
RE: CGI/DBI - Can anyone work out why this fails
On Fri, 2005-02-11 at 08:02 -0500, Bob Showalter wrote:
mike wrote:
I have the following code
$cat1;
if ($cat1){
my $cat1=%$category%;
The my here is scoped to this if { } block, so you aren't changing the
outer $cat1
}
else {
$cat1=$category;
}
$row=$dbh-prepare(SELECT
contact_id,first_name,last_name,organisation FROM tb_contacts WHERE
(organisation ILIKE ? OR last_name ILIKE ?) OR contact_id = ?);
$cat1;
print $cat1;
$row-bind_param(1,$cat1);
$row-bind_param(2,$cat1);
$row-bind_param(3,$cat1);
Why are you binding $cat1 to param 3 (contact_id)?
$row-execute();
this fails with
DBD::Pg::st execute failed: ERROR: invalid input syntax for integer:
ford at /home/www/cgi-bin/con_role_add_sel2_org.pl line 33.,
referer: http://localhost/cgi-bin/con_role_add_sel1.pl
I'm guessing that contact_id is a numeric column?
Set DBI-trace(2) before the call to execute and you can see exactly what's
being passed to the backend.
apologies this is the current state (which still fails the same way
$cat1=%$category%;
$catid1=$category;
$row=$dbh-prepare(SELECT contact_id,first_name,last_name,organisation
FROM tb_contacts WHERE organisation ILIKE ? OR last_name ILIKE ? OR
contact_id IN (SELECT contact_id FROM tb_contacts WHERE
contact_id= ?));
#$cat1;
print $cat1;
$row-bind_param(1,$cat1);
$row-bind_param(2,$cat1);
$row-bind_param(3,$catid1);
$row-execute();
output is
SELECT contact_id,first_name,last_name,organisation FROM tb_contacts
WHERE organisation ILIKE '%ford%' OR last_name ILIKE '%ford%' OR
contact_id IN (SELECT contact_id FROM tb_contacts WHERE contact_id=
'ford')
ERROR: invalid input syntax for integer: ford
It only fails if I have both the name and int WHERE Criteria - in psql
it works fine
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
CGI and sub question
I have cgi script which works fine if I call another cgiscript. However if I transfer it to runas a sub within the original script some unwanted things happen some variables dissapear The script tries to run the run the sub on open, rather than after submit. After submitting, it is impossible to reload the original form (auth errors) anyone any ideas. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
CGI and sub question
I have cgi script which works fine if I call another cgiscript. However if I transfer it to runas a sub within the original script some unwanted things happen some variables dissapear The script tries to run the run the sub on open, rather than after submit. After submitting, it is impossible to reload the original form (auth errors) anyone any ideas. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
Re: CGI and sub question
On Wed, 2005-02-16 at 14:36 -0500, Chris Devers wrote:
On Wed, 16 Feb 2005, mike wrote:
[Does] anyone [have] any ideas[question-mark]
Post the code.
We cannot help you without being able to see the code in question.
--
Chris Devers
Here it is
#!/usr/bin/perl -ww
use CGI qw/:standard/;
use DBI;
print header;
print start_html(-title=Timesheet,-BGCOLOR='#FCD08C',);
print h1(Type in details of times worked and adjustments);
print br,br,br;
my $user=param('user');
my $pw=param('pass');
my $year=param('year1');
my $month1=param('mon1');
my $date1=param('date1');
if($month1 '10'){
$month2=substr($month1,1,1)}
else{
$month2=$month1
};
$monthsel=$year$month2;
$dbh=DBI-connect(dbi:Pg:dbname=data_cc,$user,$pw);
$sth=$dbh-prepare(q{INSERT INTO tb_times
(date,user1,adj,ti1,ti2,to1,to2,ei,eo,adj_am2,adj_am) SELECT DISTINCT
date1,?,'W','00:00'::time,'00:00'::time,'00:00'::time,'00:00'::time,'00:00'::time,'00:00'::time,
'00:00'::time, '00:00'::time FROM tb_cal WHERE (?||date1||'W') NOT IN (SELECT
(user1||date||'W') FROM tb_times) AND
date_part('year',date1)||date_part('month',date1)=?});
$sth-bind_param(1,$user);
$sth-bind_param(2,$user);
$sth-bind_param(3,$monthsel);
$sth-execute();
#$row3=$dbh-prepare(SELECT typeabsence FROM lk_absence ORDER BY
typeabsence);
print start_multipart_form (POST,update);
$dbh=DBI-connect(dbi:Pg:dbname=data_cc,$user,$pw);
$row1=$dbh-prepare(SELECT date1,ti1 ,to1,ti2,to2,adj,ei,eo,CASE WHEN
date1 = left(now(),'10') THEN flex_ours ELSE' 00:00:00' END,CASE WHEN
date1 = left(now(),'10') THEN flex_bal ELSE' 00:00:00'
END ,lieu,to_char(date1::date,'Dy'), to_char(date1::date,'DD Mon
'),date1||adj,adj,adj_am,adj_am2 FROM vw_times_list1 WHERE (user1||
date_part('year',date1)||date_part('mon',date1)) = ? ORDER BY date1);
$row1-bind_param(1,$date3);
$row1-execute();
print table border = 1,th,day,td,Date,td,Time In,td,Break
Start,td,Break End,td,Time Out,td,Evening In,td,Evening
Out,td,flex hours,td,flex bal,td,lieu,td,adjustment,td,lieu
adjustment,td,type;
while (($days,$ti1,$to1,$ti2,$to2,$adj,$ei,$eo,$flex,$flex_bal,$lieu,
$dayname,$date_pretty,$key1,$adj,$adj_am1,$adj_am2)= $row1-
fetchrow_array()) {
$row3=$dbh-prepare(SELECT typeabsence FROM lk_absence ORDER BY
typeabsence);
$row3-execute();
@absence;
while (($abtype)= $row3-fetchrow_array()) {
push (@absence,$abtype)
}
@times= ($ti1,$to1,$ti2,$to2,$adj,$days,$ei,$eo,$flex,$flex_bal,$lieu,
$date_pretty,$key1,$adj,$adj_am1,$adj_am2);
$days1=$days;
print Tr;
print td,$dayname;
print hidden(-name='day'.$key1,-default=$days1);
print td,textfield(-name='dayp'.$key1,-size='9',-maxlength='12',-
default=$date_pretty);
default=$days);
default=$month2);
print td,textfield(-name='ti1'.$key1,-size='6',-maxlength='12',-
default=$times[0]);
print td,textfield(-name='to1'.$key1,-size='6',-maxlength='12',-
default=$times[1]);
print td,textfield(-name='ti2'.$key1,-size='6',-maxlength='12',-
default=$times[2]),br;
print td,textfield(-name='to2'.$key1,-size='6',-maxlength='12',-
default=$times[3]);
print td,textfield(-name='e1'.$key1,-size='6',-maxlength='12',-
default=$times[6]);
print td,textfield(-name='e2'.$key1,-size='6',-maxlength='10',-
default=$times[7]);
print td,textfield(-name='flex'.$key1,-size='6',-maxlength='12',-
default=$times[8],-style='Color:White;background: red');
print td,textfield(-name='bal'.$key1,-size='6',-maxlength='12',-
default=$times[9],-style='Color:white;background: red');
print td,textfield(-name='lieu'.$key1,-size='6',-maxlength='10',-
default=$times[10],-style='Color:white;background: red');
print td,textfield(-name='adjam1'.$key1,-size='6',-maxlength='10',-
default=$adj_am1);
print td,textfield(-name='adjam2'.$key1,-size='6',-maxlength='10',-
default=$adj_am2);
print td,popup_menu(-name='adjt'.$key1,-values=[EMAIL PROTECTED],-
default=$adj);
($wkday,$month,$day,$time,$year)=split(/\s+/,localtime);
}
print /table;
print hidden ('user',$user);
print hidden ('pass',$pw);
print p,submit(-name='Save Changes',-style='background:red;
Color:white;border-style:radius;border-size:5');
print end_form,p,p,p,p;
print end_html;
sub update {
$user=param('user');
$pw=param('pw');
@value=param();
$dbh=DBI-connect(dbi:Pg:dbname=data_cc,$user,$pw);
print $monthsel;
pop @value;
pop @value;
pop @value;
#print @value,br;
@value2;
foreach $value (@value){
$value1=substr($value,0,5);
if ($value1 eq adjt2){
push (@value2,param($value));
push (@value2,'~');
}
else {
push (@value2,param($value));
push (@value2,'#');
}
}
$value4=join('',@value2);
@array3=split(/~/,$value4);
$adj_date=param('adj_date');
foreach $array3(@array3){
@times1=split(/#/,$array3);
$row7=$dbh-prepare(SELECT DISTINCT to_char(date::date,'-MM-DD')
FROM tb_times WHERE to_char(date::date,'DD Mon ') = ?);
$row7-bind_param(1,$adj_date);
$row7-execute();
while (($adj_date1)=$row7-fetchrow_array()) {
$adj_date2=$adj_date1;
}
$date;
$date=$times1[0];
$ti1=$times1[2];
$to2=$times1[5];
$to1=$times1[3];
$ti2=$times1[4
DBI query
Anyone got any any idea what is happening here
$dbh=DBI-connect(dbi:Pg:dbname=data_cc,$user,$pw);
$dump_dir='/home/data_cc/dump';
@names=$dbh-tables();
#$dbh-execute;
#print @names;
foreach $names(@names){
if (substr($names,0,9) eq public.tb)
{
$file1= $dump_dir\/$names;
$dbh-prepare(COPY $names TO ? WITH DELIMITER AS #);
$dbh-bind_param(1,$file1);
$dbh-execute();
}
}
results in output
[Mon Mar 14 17:30:10 2005] [error] [client 127.0.0.1] Can't locate
object method bind_param via package DBI::db at /home/www/cgi-
bin/dump_all.pl line 25.
confused - it seems to be losing the connection to the db
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
DBI query
Anyone got any any idea what is happening here
$dbh=DBI-connect(dbi:Pg:dbname=data_cc,$user,$pw);
$dump_dir='/home/data_cc/dump';
@names=$dbh-tables();
#$dbh-execute;
#print @names;
foreach $names(@names){
if (substr($names,0,9) eq public.tb)
{
$file1= $dump_dir\/$names;
$dbh-prepare(COPY $names TO ? WITH DELIMITER AS #);
$dbh-bind_param(1,$file1);
$dbh-execute();
}
}
results in output
[Mon Mar 14 17:30:10 2005] [error] [client 127.0.0.1] Can't locate
object method bind_param via package DBI::db at /home/www/cgi-
bin/dump_all.pl line 25.
confused - it seems to be losing the connection to the db
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
Problem with DBD-Pg
Since upgrading to FC4-test3 which has version 1.4.1 of DBD-Pg
installed, placeholders no longer work for example the following code
$cat='1';
#$cat=param('Category');
print $cat;
print start_multipart_form (POST,'con_upd.pl');
$row=$dbh-prepare(SELECT type_code FROM lk_sort_of_contact WHERE description
= ?);
$row-bind_param(1,$cat);
$row-execute();
results in
DBD::Pg::st execute failed: ERROR: syntax error at or near $1 at character 1
DBD::Pg::st fetchrow_array failed: no statement executing
Use of uninitialized value in print at /home/www/cgi-bin/con_by_role_sel2.pl
line 22.
anyone any ideas what is happening here?
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
Help with a perl script to parse and email
I'm a perl newbie and need help with writing a script to do the
following:
1) Open a file that is delimited. The file is in this format:
name;email address1;user1;user2;userX;
The delimiters can be changed. This is a manually created file.
Email and user may be more than one item.
2) Send an email to email address using the file from #1. The
email should be like
To name
Please verify that the following users are still under your
supervision by date:
user1
user2
userX
Thank you.
3) For calculating the date, I've used the below and added 14 days
(1209600 seconds):
@Weekdays = ('Sunday', 'Monday', 'Tuesday', 'Wednesday', 'Thursday',
'Friday', 'Saturday');
@Months = ('January', 'February', 'March', 'April', 'May', 'June',
'July', 'August', 'September', 'October', 'November', 'December');
@Now = localtime(time + 1209600); # adding the number of seconds in a
day (86400) and multiplying for 14 days
$Month = $Months[$Now[4]];
$Weekday = $Weekdays[$Now[6]];
$Hour = $Now[2];
if ($Hour 12) {
$Hour = $Hour - 12;
$AMPM = PM;
} else {
$Hour = 12 if $Hour == 0;
$AMPM =AM;
}
$Minute = $Now[1];
$Minute = 0$Minute if $Minute 10;
$Year = $Now[5]+1900;
$Expire = $Weekday, $Month $Now[3], $Year;
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/
Re: [NEWBIE-Question] Processing Menus
I am using cgi-lib.pl this is the script that I am using.
#!/usr/bin/perl
#location to your log file.
$logfile = /usr/local/apache/cgi-bin/log/logfile.log;
#location of our sendmail program.
$mailprog = /usr/sbin/sendmail;
#path to cgi-lib.pl.
$library = /usr/local/apache/cgi-bin;
require $library/cgi-lib.pl;
ReadParse;
# Print the http header
print Content-type: text/html\n\n;
# Send the user a thank you
print html\n;
print head\n;
print titleThank you!/title\n;
print /head\n;
print body\n;
print pThanks $in{'email'}br\n;
print Category $in{'category'}\n;
print URL: $in{'url'}\n;
print Description: $in{'description'}\n;
print I'll inform you when your link has been added\n;
print /p/body/html\n;
# Open the log file and write the data
open(FILE, $logfile) || die I can't open $logfile\n;
print FILE Someone requested a link addition\n;
print FILE Category $in{'category'}\n;
print FILE E-mail $in{'email'}\n;
print FILE URL $in{'url'}\n;
print FILE Description $in{'description'}\n;
print FILE \n;
close(FILE);
# Open the sendmail program and pipe the data
open(MAIL, | $mailprog -t) || die I can't open $mailprog\n;
print MAIL To: webmster webmaster\@yourname.com\n;
print MAIL From: $in{'email'}\n;
print MAIL Subject: Link Request\n;
print MAIL Someone requests a link addition\n;
print MAIL Category: $in{'category'}\n;
print MAIL URL: $in{'url'}\n;
print MAIL Description: $in{'description'}\n;
close(MAIL);
Thanks again
Mike
Etienne Marcotte wrote:
The CGI (or other parsing sub) reads the data selected from the drop
down, which is in the value part of each option tag.
select name=dropdown
option value=1option 1/option
option value=2option 2/option
option value=3option 3/option
/select
then in your param{'dropdown'}you should have 1, 2 or 3 depending on the
option that he choose.
What are you using to parse the data? CGI.pm ? That is probably causing
the problem because your html seems right
Etienne
Bogus email wrote:
Sorry bout that... I do mean select drop-downs from HTML. What I
want to
do is have it email me all the info, which it does email me.
Everything but
the dropdown menu information. see attached.
Thanks again...
Mike
Curtis Poe [EMAIL PROTECTED] wrote in message
[EMAIL PROTECTED]">news:[EMAIL PROTECTED]...
--- [EMAIL PROTECTED] wrote:
Hello all,
I am trying to process a menu option but for some reason perl
causes the
value to come up blank can anyone help? This is only hapening on
the
menu
items.
Is there a trick to sending drop down menus?
TNX,
Mike
Mike,
What do you mean by menu? Are you referring to Perl::Tk menus?
Win32::Gui? Perhaps you mean
select drop-downs from HTML? Can you post some sample code? We
need a
lot more information
before we can help you.
Show us what you have. Tell us what you expect. Tell us what you
are
actually getting. That's
usually a good start.
Cheers,
Curtis Ovid Poe
=
Senior Programmer
Onsite! Technology (http://www.onsitetech.com/)
Ovid on http://www.perlmonks.org/
__
Do You Yahoo!?
Make a great connection at Yahoo! Personals.
http://personals.yahoo.com
[Add your link]
[ Home ] [ Up ]
--
Category: URL:
Email:
(Note: Your email will only be used to notify you when your link
has been added.)
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: [NEWBIE-Question] Processing Menus
I am using cgi-lib.pl this is the script that I am using.
#!/usr/bin/perl
#location to your log file.
$logfile = /usr/local/apache/cgi-bin/log/logfile.log;
#location of our sendmail program.
$mailprog = /usr/sbin/sendmail;
#path to cgi-lib.pl.
$library = /usr/local/apache/cgi-bin;
require $library/cgi-lib.pl;
ReadParse;
# Print the http header
print Content-type: text/html\n\n;
# Send the user a thank you
print html\n;
print head\n;
print titleThank you!/title\n;
print /head\n;
print body\n;
print pThanks $in{'email'}br\n;
print Category $in{'category'}\n;
print URL: $in{'url'}\n;
print Description: $in{'description'}\n;
print I'll inform you when your link has been added\n;
print /p/body/html\n;
# Open the log file and write the data
open(FILE, $logfile) || die I can't open $logfile\n;
print FILE Someone requested a link addition\n;
print FILE Category $in{'category'}\n;
print FILE E-mail $in{'email'}\n;
print FILE URL $in{'url'}\n;
print FILE Description $in{'description'}\n;
print FILE \n;
close(FILE);
# Open the sendmail program and pipe the data
open(MAIL, | $mailprog -t) || die I can't open $mailprog\n;
print MAIL To: webmster webmaster\@yourname.com\n;
print MAIL From: $in{'email'}\n;
print MAIL Subject: Link Request\n;
print MAIL Someone requests a link addition\n;
print MAIL Category: $in{'category'}\n;
print MAIL URL: $in{'url'}\n;
print MAIL Description: $in{'description'}\n;
close(MAIL);
Thanks again
Mike
Etienne Marcotte wrote:
The CGI (or other parsing sub) reads the data selected from the drop
down, which is in the value part of each option tag.
select name=dropdown
option value=1option 1/option
option value=2option 2/option
option value=3option 3/option
/select
then in your param{'dropdown'}you should have 1, 2 or 3 depending on the
option that he choose.
What are you using to parse the data? CGI.pm ? That is probably causing
the problem because your html seems right
Etienne
Bogus email wrote:
Sorry bout that... I do mean select drop-downs from HTML. What I
want to
do is have it email me all the info, which it does email me.
Everything but
the dropdown menu information. see attached.
Thanks again...
Mike
Curtis Poe [EMAIL PROTECTED] wrote in message
[EMAIL PROTECTED]">news:[EMAIL PROTECTED]...
--- [EMAIL PROTECTED] wrote:
Hello all,
I am trying to process a menu option but for some reason perl
causes the
value to come up blank can anyone help? This is only hapening on
the
menu
items.
Is there a trick to sending drop down menus?
TNX,
Mike
Mike,
What do you mean by menu? Are you referring to Perl::Tk menus?
Win32::Gui? Perhaps you mean
select drop-downs from HTML? Can you post some sample code? We
need a
lot more information
before we can help you.
Show us what you have. Tell us what you expect. Tell us what you
are
actually getting. That's
usually a good start.
Cheers,
Curtis Ovid Poe
=
Senior Programmer
Onsite! Technology (http://www.onsitetech.com/)
Ovid on http://www.perlmonks.org/
__
Do You Yahoo!?
Make a great connection at Yahoo! Personals.
http://personals.yahoo.com
[Add your link]
[ Home ] [ Up ]
--
Category: URL:
Email:
(Note: Your email will only be used to notify you when your link
has been added.)
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: [NEWBIE-Question] Processing Menus
I am using cgi-lib.pl this is the script that I am using.
#!/usr/bin/perl
#location to your log file.
$logfile = /usr/local/apache/cgi-bin/log/logfile.log;
#location of our sendmail program.
$mailprog = /usr/sbin/sendmail;
#path to cgi-lib.pl.
$library = /usr/local/apache/cgi-bin;
require $library/cgi-lib.pl;
ReadParse;
# Print the http header
print Content-type: text/html\n\n;
# Send the user a thank you
print html\n;
print head\n;
print titleThank you!/title\n;
print /head\n;
print body\n;
print pThanks $in{'email'}br\n;
print Category $in{'category'}\n;
print URL: $in{'url'}\n;
print Description: $in{'description'}\n;
print I'll inform you when your link has been added\n;
print /p/body/html\n;
# Open the log file and write the data
open(FILE, $logfile) || die I can't open $logfile\n;
print FILE Someone requested a link addition\n;
print FILE Category $in{'category'}\n;
print FILE E-mail $in{'email'}\n;
print FILE URL $in{'url'}\n;
print FILE Description $in{'description'}\n;
print FILE \n;
close(FILE);
# Open the sendmail program and pipe the data
open(MAIL, | $mailprog -t) || die I can't open $mailprog\n;
print MAIL To: webmster webmaster\@yourname.com\n;
print MAIL From: $in{'email'}\n;
print MAIL Subject: Link Request\n;
print MAIL Someone requests a link addition\n;
print MAIL Category: $in{'category'}\n;
print MAIL URL: $in{'url'}\n;
print MAIL Description: $in{'description'}\n;
close(MAIL);
Thanks again
Mike
Etienne Marcotte wrote:
The CGI (or other parsing sub) reads the data selected from the drop
down, which is in the value part of each option tag.
select name=dropdown
option value=1option 1/option
option value=2option 2/option
option value=3option 3/option
/select
then in your param{'dropdown'}you should have 1, 2 or 3 depending on the
option that he choose.
What are you using to parse the data? CGI.pm ? That is probably causing
the problem because your html seems right
Etienne
Bogus email wrote:
Sorry bout that... I do mean select drop-downs from HTML. What I
want to
do is have it email me all the info, which it does email me.
Everything but
the dropdown menu information. see attached.
Thanks again...
Mike
Curtis Poe [EMAIL PROTECTED] wrote in message
[EMAIL PROTECTED]">news:[EMAIL PROTECTED]...
--- [EMAIL PROTECTED] wrote:
Hello all,
I am trying to process a menu option but for some reason perl
causes the
value to come up blank can anyone help? This is only hapening on
the
menu
items.
Is there a trick to sending drop down menus?
TNX,
Mike
Mike,
What do you mean by menu? Are you referring to Perl::Tk menus?
Win32::Gui? Perhaps you mean
select drop-downs from HTML? Can you post some sample code? We
need a
lot more information
before we can help you.
Show us what you have. Tell us what you expect. Tell us what you
are
actually getting. That's
usually a good start.
Cheers,
Curtis Ovid Poe
=
Senior Programmer
Onsite! Technology (http://www.onsitetech.com/)
Ovid on http://www.perlmonks.org/
__
Do You Yahoo!?
Make a great connection at Yahoo! Personals.
http://personals.yahoo.com
[Add your link]
[ Home ] [ Up ]
--
Category: URL:
Email:
(Note: Your email will only be used to notify you when your link
has been added.)
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: me@me.com mail error
How is that? Etienne Marcotte [EMAIL PROTECTED] wrote in message [EMAIL PROTECTED]">news:[EMAIL PROTECTED]... From: Mail Delivery Subsystem [EMAIL PROTECTED] Subject: Returned mail: Host unknown (Name server: me.com: no data known) To: [EMAIL PROTECTED] The original message was received at Thu, 1 Nov 2001 13:06:15 -0500 (EST) from uucp@localhost - The following addresses had permanent fatal errors - [EMAIL PROTECTED] - Transcript of session follows - 550 [EMAIL PROTECTED]... Host unknown (Name server: me.com: no data known) Reporting-MTA: dns; itlf10.itl.ca Arrival-Date: Thu, 1 Nov 2001 13:06:15 -0500 (EST) Final-Recipient: rfc822; [EMAIL PROTECTED] Action: failed Status: 5.1.2 Remote-MTA: dns; me.com Last-Attempt-Date: Thu, 1 Nov 2001 13:06:15 -0500 (EST) Can you correct this? Etienne -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
NET::FTP
Is there a way to use NET::FTP to only download files if they are current day? If not can it be done another way? Thanks! Mike -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: :FTP
THANKS! John Edwards wrote: Take a look at the Net::FTP docs. There's a function in the module called mdtm which returns the modified timestamp of the remote file. Query that, then download if it matches your criteria. HTH John -Original Message- From: Mike [mailto:[EMAIL PROTECTED]] Sent: 17 December 2001 13:39 To: [EMAIL PROTECTED] Subject: NET::FTP Is there a way to use NET::FTP to only download files if they are current day? If not can it be done another way? Thanks! Mike -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] --Confidentiality--. This E-mail is confidential. It should not be read, copied, disclosed or used by any person other than the intended recipient. Unauthorised use, disclosure or copying by whatever medium is strictly prohibited and may be unlawful. If you have received this E-mail in error please contact the sender immediately and delete the E-mail from your system. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Get the first 10 characters.
How do I get the first 10 characters of a string? Mike -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
problem with Multipart module
I am trying to use the Net::SMTP::Multipart to send attachments (word
doc) and the encoding is getting mangled on non-linux machines
If I send it to myself everything is fine (either external or via my
mail server)
this appears to the relevant part of the modules
sub FileAttach {
my $self = shift;
foreach my $file (@_) {
unless (-f $file) {
carp 'Net::SMTP::Multipart:FileAttach: unable to find file
$file';
next;
}
my($bytesread,$buffer,$data,$total);
open(FH,$file) || carp Net::SMTP::Multipart:FileAttach: failed
to open $file\n;
binmode(FH);
while ( ($bytesread=sysread(FH,$buffer, 1024))==1024 ){
$total += $bytesread;
# 500K Limit on Upload Images to prevent buffer overflow
#if (($total/1024) 500){
# printf TooBig %s\n,$total/1024;
# $toobig = 1;
# last;
#}
$data .= $buffer;
}
if ($bytesread) {
$data .= $buffer;
$total += $bytesread ;
}
#print File Size: $total bytes\n;
close FH;
if ($data){
$self-datasend(--$b\n);
$self-datasend(Content-Type: ; name=\$file\\n);
$self-datasend(Content-Transfer-Encoding: base64\n);
$self-datasend(Content-Disposition: attachment; =filename=
\$file\\n\n);
$self-datasend(encode_base64($data));
$self-datasend(--$b\n);
}
}
}
and this my script
$smtp-Header(
To = $mailing1[2],
Subj = Management Meeting,
From = [EMAIL PROTECTED],
From = [EMAIL PROTECTED]);
$smtp-Text(text);
$smtp-FileAttach (doc_file.doc);
$smtp-End();
any help appreciated
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
Dufus question about form-fields and colour
Does anyone know if it is possible to give a color attribute to form field? -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
nested while loops using DBI
I am trying to get the detail records to appear on a form underneath the
header records with a db lookup
Code
$row=$dbh-prepare(SELECT contact_id,first_name,last_name,organisation
FROM tb_contacts WHERE organisation ILIKE ?);
my $cat1=%$category%;
$row-bind_param(1,$cat1);
$row-execute();
print start_multipart_form (POST);
while(($id,$first_name,$last_name,$organisation) = $row-fetchrow_array
()) {
print Id,textfield('id'.$id,$id);
print firstname, textfield('first_name'.$id,$first_name);
print last_name,textfield('last_name'.$id,$last_name);
print organisation,textfield('organisation'.$id,$organisation);
print br /;
print br /;
[EMAIL PROTECTED]();
#print @par1;
#foreach $par1(@par1){
#print $par1;
#}
print start_multipart_form (POST);
$row=$dbh-prepare(SELECT id,contact_id,type_of_contact,priority FROM
tb_contact_role WHERE contact_id ILIKE ?);
my $idsel=$id;
#print $id;
$row-bind_param(1,$idsel);
$row-execute();
while(($id1,$contact_id1,$type,$priority) = $row-fetchrow_array()) {
#print $id1,$contact_id1,$type,$priority;
print Id,textfield('id1'.$id1,$id1);
print firstname, textfield('contact_id'.$id1,$contact_id1);
print last_name,textfield('type'.$id1,$type);
print organisation,textfield('priority'.$id1,$priority);}
}
print Choose Id,textfield('id2','0');
print br /;
print BR /;
print submit;
print end_form;
This only produces on record at the top-level, if I dont have the select
inside the loop, then all matching records appear
Anyone any idea where I am going wrong
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
RE: nested while loops using DBI
On Mon, 2004-03-22 at 18:04, Guay Jean-Sbastien wrote:
Hello Mike,
$row=$dbh-prepare(SELECT contact_id,first_name,last_name,organisation
FROM tb_contacts WHERE organisation ILIKE ?);
[...]
while(($id,$first_name,$last_name,$organisation) = $row-fetchrow_array())
{
[...]
$row=$dbh-prepare(SELECT id,contact_id,type_of_contact,priority FROM
tb_contact_role WHERE contact_id ILIKE ?);
[...]
}
[...]
This only produces on record at the top-level, if I dont have the select
inside the loop, then all matching records appear
Anyone any idea where I am going wrong
You are using the same variable as the statement handle for both queries
($row). In effect, since your second SELECT probably returns only one row
(probably the detail of the contact you got in the first SELECT), the
enclosing while ends afterwards because there are no more rows to get from
that statement handle (the second SELECT).
Yeah I worked this out just after I posted.
I would suggest you declare a new variable inside your while, say $contact.
Something like this:
my $contact = $dbh-prepare(qq[SELECT id, contact_id, type_of_contact,
priority
FROM tb_contact_role
WHERE contact_id ILIKE ?]);
I also suggest better indentation and whitespace usage in your code. That
will get very hard to read very fast...
Hope that helps,
J-S
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
Confused
I am trying to get rid of a blank line at the start of a text file, and
I dont understand why this does not work
open(UPD1,tem);# this file exists
my @update1=UPD1;
foreach $update1(@update1){
$update1=~s/^(\n)//;
$update1=~chomp;
my @update2=split /#/,$update1;# this bit works
But I still get a blank line at the start
ie
print $contact_id,br;# name give to first field
gives
blank line
233
234
235
236
237
238
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
Question about cgi forms (slightly OT)
I am developing a cgi/DBI app which is nearly finished I have this one question The scenario I have a cgi generated form on a web-page, it consists of several records defined by a DB lookup. When I do Search in the web-browser, is there any way to get it to search the values in the fileds of the form? Currently all the values show up, but they dont seem to appear to be in scope for searching thanks for any tips (and apologies for vaguely OT) -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] http://learn.perl.org/ http://learn.perl.org/first-response
Re: Confused
On Wed, 2004-03-24 at 14:19, James Edward Gray II wrote:
On Mar 24, 2004, at 7:59 AM, WC -Sx- Jones wrote:
while(UPD1) {
chomp; s/^\s+//; s/\s+$//; next unless length;
There's probably not much reason to chomp() and s/\s+$//, since the
later handles both.
James
Thanks for all assistance
This worked
s/\s+$/;
One question will this only take out blank lines?
eg: if I have this line
anytext tabe space newline
will the non-printing characters be removed and the text be added to the
beginning of the next line?
thanks
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
Re: Question about cgi forms (slightly OT)
On Thu, 2004-03-25 at 13:18, WC -Sx- Jones wrote:
mike wrote:
When I do Search in the web-browser, is there any way to get it to
search the values in the fileds of the form?
Currently all the values show up, but they dont seem to appear to be in
scope for searching
Show some code -- likely your logic is wrong -- if using CGI module
then capture all params in a single arrary, or hash, then walk
thru the data.
If you normalize the CGI input to a sane value (IE, make string zero
numeric 0 and undefined input as empty strings) you can control
the order they are placed into the array then you can use array
index to make sure you are looking at the right array to CGI
input values.
HTH
dont think I was clear enough
this creates the form
print start_multipart_form (POST,'con_role_upd.pl');
print Choose Id,textfield('id2','0');
print br /;
print BR /;
[EMAIL PROTECTED]();
#print @value;
$row1=$dbh-prepare(SELECT
tb_contact_role.id,contact_id,type_of_contact,description,priority FROM
tb_contact_role LEFT JOIN lk_sort_of_contact ON
type_of_contact=type_code WHERE contact_id ILIKE ?);
my $idsel=$id;
$row1-bind_param(1,$idsel);
$row1-execute();
while(($id1,$contact_id1,$type_id,$type,$priority) =
$row1-fetchrow_array()) {
#print $id1,$contact_id1,$type,$priority;
print font {-style='background-color: #F8FC8C;color: blue'};
print Roles for Contact;
print end_font;
print p;
print font {-style='background-color: white;color: blue'};
print Role
ID,textfield(-name='id1'.$id1,-value=$id1,-style='background-color:
#C59E65;color: white');
print Role
ID,textfield(-name='type_id1'.$id1,-value=$type_id,-style='background-color:
#C59E65;color: white');
print Type of
Contact,textfield(-name='type'.$id1,-value=$type,-style='background-color:
#C59E65;color: white');
print
priority,textfield(-name='priority'.$id1,-value=$priority,-style='background-color:
#C59E65;color: white')};
print br;
print br;
print br;
}
print submit;
print end_form;
This results in a html page of forms which is populated, I can tab
through the fields, edit etc, but if I do a control F for instance, the
values in the fields are not found.
What I would like is for users to be able to search for a value and then
go tothat record
--
_Sx_ http://youve-reached-the.endoftheinternet.org/ _
perldoc -qa.a | perl -lpe '($_)=m((.*))' | grep Martian
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/ http://learn.perl.org/first-response
passing a hash via cookie and dereferencing it
Hello everyone:
I am trying to pass a hash of hashes from one script to another via a
cookie. I can get the cookie to pass, but when I try to get the inner
hash keys and values using what I think is the correct method, I
cannot get them. Here are two scripts which should do it, but don't:
#1: pretest.cgi
#!/usr/bin/perl -wT
use CGI ':standard';
my $xx = new CGI;
%KK = (a=A,b=B);
open (SCRATCH,/tmp/scratch) or die Couldn't open scratch for
writing: $!\n;
chmod 0755,tmp/scratch;
print SCRATCH In pretest.cgi.\n;
for (keys %{KK}) {
print SCRATCH Key: ,$_,\t,
Value from reference: ,${KK}{$_},\n;
}
print SCRATCH \n\n;
my $kk=\%KK;
print $xx-redirect(-COOKIE=$kk,-URL=test.cgi);
#2 test.cgi:
#!/usr/bin/perl -wT
use CGI::Carp qw(fatalsToBrowser);
use CGI ':standard';
use diagnostics;
$xx = new CGI;
%cookhash=cookie('bigcook');
$KK=$cookhash{'KK'};
open (SCRATCH,/tmp/scratch) or die Couldn't open scratch for
appending: $!\n;
chmod 0775,tmp/scratch;
print $xx-header;
print $xx-start_html(-title=test,-bgcolor=silver,-
vlink=blue),
$xx-hr, $xx-p,$xx-br;
print $xx-center( $xx-h2(In test.cgi!\n) );
print $xx-center( $xx-h2(\$KK is $KK\n) );
print SCRATCH In test.cgi!\n;
print SCRATCH \$KK is $KK\n;
for (keys %{$KK}) {
print SCRATCH Key: ,$_,\t;
print SCRATCH Value from reference: ,${$KK}{$_},\n;
}
for (keys %{$KK}) {
print $xx-center($xx-h2(Key: ,$_,\n),
$xx-h2(value from reference: ,${$KK}{$_},\n));
}
print $xx-end_html;
As you can see if you run these two scripts, the dereferencing step
didn't give me back my hash %KK. I used the same synax to dereference
$KK in both programs, but it didn't work for the passed one. Can
anybody help? Thanks in advance.
Mike
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Introduction and Perl 5 References
Hello everyone. I just wanted to introduce myself to the list. Been following for a little while, first time posting. My name is Mike Dunaway and I am 25 years old. I was curious if there were any other members in the 804 area? I'm looking to meet some other programmers in my area as I only know of one other. While I'm posting, I may as well ask a question related to Perl. Would anyone mind explaining references to me like I was five years old? I read about them in Beginning Perl, but I can't quite grasp them very well. Thanks! -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: jsFiddle
On 1/15/2013 2:35 PM, Bill Stephenson wrote: Check out this web app: http://jsfiddle.net/ (Google jsfiddle.net example for examples of use) It would be nice to have something like that for fiddling with perl. I haven't really thought it through, but it might not take much to create something simple for personal use. -- Bill Stephenson Check out IDEOne: http://ideone.com/ and CodePad (mentioned earlier) http://codepad.org - CodePad, in my experience, suffers from a lot of downtime, however. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: parsing website
On 2/26/2013 1:46 PM, Noah wrote: Hi there, I want to parse text from a website. what are some good methods and modules to do this? Any tutorial links? Cheers WWW::Mechanize http://search.cpan.org/dist/WWW-Mechanize/lib/WWW/Mechanize.pm -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: CPAN unavailable
I would recommend using http://metacpan.org And for installing modules, you could try cpanminus: curl -L http://cpanmin.us | perl - --sudo App::cpanminu On 5/20/14, 8:22 PM, Yonghua Peng wrote: Hello, Do you know why these days cpan.org has been unavailable? I always got: 503 Service Unavailable No server is available to handle this request. Thanks.
Re: converting ip regex to iprange
Maybe this module here? http://search.cpan.org/~mrsam/Net-CIDR-0.11/CIDR.pm On 5/28/14, 3:08 AM, Agnello George wrote: Hi I have about 300 + ip regex in my apache file like this 11\.45\.3[2-9]\..*$ ^11\.45\.4[0-9]\..*$ ^11\.45\.5[0-9]\..*$ I have to convert like this into CIDR . ·11.45.32.0/21 http://11.45.32.0/21 ·11.45.40.0/21 http://11.45.40.0/21 ·11.45.48.0/23 http://11.45.48.0/23 ·11.45.50.0/21 http://11.45.50.0/21 11.45.58.0/23 http://11.45.58.0/23 is there a module that can help me convert ip regex to ip range . thanks Agnello
Grabbing HTML fields, return them as hash
Hello everyone. Can anyone point me in the direction of a module that will allow me to grab HTML fields and return them as a hash? Thanks. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: script to match a valid email id
That's a lot of regex. On 7/10/14, 2:25 PM, Ron Bergin wrote: Sunita Pradhan wrote: I do not want to use Cpan modules . -Sunita What do you have against using a cpan module? If you don't want to use the module, then why not simply copy/use the regex that it uses to do the validation? $RFC822PAT = 'EOF'; [\040\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\ xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xf f\n\015()]*)*\)[\040\t]*)*(?:(?:[^(\040)@,;:.\\\[\]\000-\037\x80-\x ff]+(?![^(\040)@,;:.\\\[\]\000-\037\x80-\xff])|[^\\\x80-\xff\n\015 ]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015]*)*)[\040\t]*(?:\([^\\\x80-\ xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x80 -\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040\t]* )*(?:\.[\040\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\ \\x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\ x80-\xff\n\015()]*)*\)[\040\t]*)*(?:[^(\040)@,;:.\\\[\]\000-\037\x8 0-\xff]+(?![^(\040)@,;:.\\\[\]\000-\037\x80-\xff])|[^\\\x80-\xff\n \015]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015]*)*)[\040\t]*(?:\([^\\\x 80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^ \x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040 \t]*)*)*@[\040\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([ ^\\\x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\ \\x80-\xff\n\015()]*)*\)[\040\t]*)*(?:[^(\040)@,;:.\\\[\]\000-\037\ x80-\xff]+(?![^(\040)@,;:.\\\[\]\000-\037\x80-\xff])|\[(?:[^\\\x80- \xff\n\015\[\]]|\\[^\x80-\xff])*\])[\040\t]*(?:\([^\\\x80-\xff\n\015() ]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\ x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040\t]*)*(?:\.[\04 0\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\ n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\ 015()]*)*\)[\040\t]*)*(?:[^(\040)@,;:.\\\[\]\000-\037\x80-\xff]+(?! [^(\040)@,;:.\\\[\]\000-\037\x80-\xff])|\[(?:[^\\\x80-\xff\n\015\[\ ]]|\\[^\x80-\xff])*\])[\040\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\ x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\01 5()]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040\t]*)*)*|(?:[^(\040)@,;:. \\\[\]\000-\037\x80-\xff]+(?![^(\040)@,;:.\\\[\]\000-\037\x80-\xff] )|[^\\\x80-\xff\n\015]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015]*)*)[^ ()@,;:.\\\[\]\x80-\xff\000-\010\012-\037]*(?:(?:\([^\\\x80-\xff\n\0 15()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x80-\xff][ ^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015()]*)*\)|[^\\\x80-\xff\ n\015]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015]*)*)[^()@,;:.\\\[\]\ x80-\xff\000-\010\012-\037]*)*[\040\t]*(?:\([^\\\x80-\xff\n\015()]*(? :(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80- \xff\n\015()]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040\t]*)*(?:@[\040\t]* (?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015 ()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015() ]*)*\)[\040\t]*)*(?:[^(\040)@,;:.\\\[\]\000-\037\x80-\xff]+(?![^(\0 40)@,;:.\\\[\]\000-\037\x80-\xff])|\[(?:[^\\\x80-\xff\n\015\[\]]|\\ [^\x80-\xff])*\])[\040\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\ xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]* )*\))[^\\\x80-\xff\n\015()]*)*\)[\040\t]*)*(?:\.[\040\t]*(?:\([^\\\x80 -\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x 80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040\t ]*)*(?:[^(\040)@,;:.\\\[\]\000-\037\x80-\xff]+(?![^(\040)@,;:.\\ \[\]\000-\037\x80-\xff])|\[(?:[^\\\x80-\xff\n\015\[\]]|\\[^\x80-\xff]) *\])[\040\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x 80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80 -\xff\n\015()]*)*\)[\040\t]*)*)*(?:,[\040\t]*(?:\([^\\\x80-\xff\n\015( )]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\ \x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040\t]*)*@[\040\t ]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\0 15()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015 ()]*)*\)[\040\t]*)*(?:[^(\040)@,;:.\\\[\]\000-\037\x80-\xff]+(?![^( \040)@,;:.\\\[\]\000-\037\x80-\xff])|\[(?:[^\\\x80-\xff\n\015\[\]]| \\[^\x80-\xff])*\])[\040\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80 -\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015() ]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040\t]*)*(?:\.[\040\t]*(?:\([^\\\x 80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\\x80-\xff\n\015()]*(?:\\[^ \x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x80-\xff\n\015()]*)*\)[\040 \t]*)*(?:[^(\040)@,;:.\\\[\]\000-\037\x80-\xff]+(?![^(\040)@,;:. \\\[\]\000-\037\x80-\xff])|\[(?:[^\\\x80-\xff\n\015\[\]]|\\[^\x80-\xff ])*\])[\040\t]*(?:\([^\\\x80-\xff\n\015()]*(?:(?:\\[^\x80-\xff]|\([^\\ \x80-\xff\n\015()]*(?:\\[^\x80-\xff][^\\\x80-\xff\n\015()]*)*\))[^\\\x 80-\xff\n\015()]*)*\)[\040\t]*)*)*)*:[\040\t]*(?:\([^\\\x80-\xff\n\015
Re: Best way to install perl modules
Use cpanminus. To install: sudo curl -L http://cpanmin.us | perl - --sudo App::cpanminus To use: sudo cpanm module to install Here's the official documentation: http://search.cpan.org/~miyagawa/App-cpanminus-1.7012/lib/App/cpanminus.pm On 10/4/14, 8:32 PM, Benjamin Fernandis wrote: Hi, Many times I face problem with module installation and then have to go to google and apply trial and error to resolve this permanently, could u please suggest me best and correct method to get resolved it? i mean if i installed centos 7 freshly then what are pre-requisites from OS side to get perl module installation successfully. What steps require to follow? Previously i tried cpanm and cpan console but some times faced installation faild error. Is there any specific guideline to resolve this problem? I am using centos based distro. Regards Ben
Re: Best way to install perl modules
Please provide us with any errors from the installation log you've received when using cpanm. On 10/06/2014 08:58 PM, Benjamin Fernandis wrote: Hi, Today I face same previous problem to install package with cpanm. This time i have already installed Development Tools as suggested by Sam. For testing it more, i was trying to install dancer by cpanm. First trial, i got failed and then looked into build log and found some dependent modules are not there so then i tried to first install them and those also have some more dependencies and then i have to resolve first from those and then step by step do install manually and lastly dancer installation works for me. Below is my manually package installation. Please suggest me to resolve this installation problem. Also suggest me if I am missing anything at OS level. OS : cenots 7 Regards Ben cpanm Dancer 334 335 vim /root/.cpanm/work/1412646550.26687/build.log 336 337 cpanm HTTP::Server::Simple 338 vim /root/.cpanm/work/1412646612.26849/build.log 339 cpanm Test::Pod 340 cpanm HTTP::Server::Simple 341 vim /root/.cpanm/work/1412646658.27040/build.log 342 cpanm Test::Pod::Coverage 343 cpanm HTTP::Server::Simple 344 vim /root/.cpanm/work/1412646703.27571/build.log 345 cpanm HTTP::Server 346 cpanm Env 347 cpanm HTTP::Server::Simple 348 cpanm Dancer 349 instmodsh 350 history On Sun, Oct 5, 2014 at 6:17 PM, Benjamin Fernandis benjo11...@gmail.com mailto:benjo11...@gmail.com wrote: Hi, Sam, Thanks, After installing development tools group, it works. Regards Ben On Sun, Oct 5, 2014 at 6:02 PM, Sam p...@net153.net mailto:p...@net153.net wrote: You probably need to give us more info as both cpan and cpanm will auto resolve and install needed dependencies. The dependency installs could be failing because a compiler or something similar is missing. If you are on a redhat based system, trying running: yum groupinstall Development Tools If you are on a debian based system try running: aptitude install build-essential --Sam On 10/04/2014 11:39 PM, Benjamin Fernandis wrote: Hi Mike, Thanks for your kind response. I tried cpanm instead of cpan, but many times, it does not install require dependencies for module. For example, when i was trying to install cpanm XML::SAX - it failed and said no Fatal.pm module , then i manually first installed that module and then i tried to install XML::SAX and it works. It happens many times while installing different modules. I mean cpanm does not automatically fetch require dependencies for module. like yum in centos to install packages. Is there any tool or something like yum for perl module installations. Or Is there , I am missing anything ? Regards Ben On Sun, Oct 5, 2014 at 2:51 PM, Mike ekimduna...@gmail.com mailto:ekimduna...@gmail.com mailto:ekimduna...@gmail.com mailto:ekimduna...@gmail.com wrote: Use cpanminus. To install: sudo curl -L http://cpanmin.us | perl - --sudo App::cpanminus To use: sudo cpanm module to install Here's the official documentation: http://search.cpan.org/~miyagawa/App-cpanminus-1.7012/lib/App/cpanminus.pm http://search.cpan.org/%7Emiyagawa/App-cpanminus-1.7012/lib/App/cpanminus.pm On 10/4/14, 8:32 PM, Benjamin Fernandis wrote: Hi, Many times I face problem with module installation and then have to go to google and apply trial and error to resolve this permanently, could u please suggest me best and correct method to get resolved it? i mean if i installed centos 7 freshly then what are pre-requisites from OS side to get perl module installation successfully. What steps require to follow? Previously i tried cpanm and cpan console but some times faced installation faild error. Is there any specific guideline to resolve this problem? I am using centos based distro. Regards Ben -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org mailto:beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org mailto:beginners-h...@perl.org http
IO::Socket
Can anyone point me in the direction of more thorough documentation for the IO::Socket module? Seems like the documentation on perl.org is pretty limited. At least, it doesn't feel very thorough to me. http://perldoc.perl.org/IO/Socket.html For example, what exactly does timeout affect? This documentation also doesn't explain what values the methods accept or how to use them. Thanks. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: Script for auto conf
I have a feeling this could easier be accomplished with bash. On 12/29/14 9:47 PM, Alan Glait wrote: Hi ! I have the Idea to make a perl script (better than in bash) to make some configuration on linux. I think to have some files like param.txt with some lines like: param_one = ZZZ XX VV param_two = Z param_three = X so need to check if param_one is in some_file.conf and if it is there test the value .. if it is not .. add to some_file.conf ... I think it should be easy ... right ?? Thanks for any help .. ;) -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: Parsing multi column files
Thanks for quick lesson and pro-tips. I'll be sure to implement some of
these.
In case you were wondering, I am indeed using strict and warnings.
diagnostics, too.
Thanks again.
On 1/18/15 9:05 PM, Brandon McCaig wrote:
Mike:
On Sun, Jan 18, 2015 at 07:00:05PM -0500, Mike wrote:
So I've got a text file in a multi column format (three
columns), each column is separated by a single space. Here is a
snippet for reference:
artless base-court apple-john
bawdy bat-fowling baggage
beslubbering beef-witted barnacle
I want to be able to randomly select a word from the first
column, then from the second column, then from the third
column, and concatenate them to together into a single string.
Here's the code I currently have, but I'm stuck:
First a little code review.
Be sure to always use strict and warnings to help identify bugs.
Add this to the top of your programs.
use strict;
use warnings;
Perhaps you're already using it. At the very least, your snippet
is strict and warnings approved. :) That said, it is best to
include a full example of what you'e trying, including pragmas.
It saves us the trouble of emphasizing best practices that you're
already following and omitting them might also alter the behavior
of code and confuse us and you. So hopefully you're already using
strict and warnings, but next time include them in your post too!
:)
sub gen_ins {
open(FH, '', 'insults2.txt') or die [-] ERROR: Can't find
insult list.;
It is better to use lexical file handles.
open(my $fh, '', 'insults2.txt') or
die [-] ERROR: Can't find insult list.;
Good job using 3-arg open and handling failure. Often you should
include the output of $! in your error message because it will
contain information about what exactly went wrong. For example,
perhaps insults2.txt exists, but the user doesn't have the
necessary permissions to read it. Take that into account also
when you're writing your error messages to avoid confusing the
user (which may be yourself).
open(my $fh, '', 'insults2.txt') or
die [-] ERROR opening insults list: $!;
my @cols = split ( , FH);
print $cols[0];
close FH;
}
gen_ins();
When currently run, gen_ins() will print out the first word of
the given column: $cols[0], $cols[1], or $cols[2]. How can I
access the rest of the words below the first?
Others have demonstrated good solutions to this problem already.
Here's an alternative take emphasizing modularity and reuse.
use strict;
use warnings;
use Readonly;
exit(main(@ARGV));
sub main {
Readonly::Scalar my $Filename = 'insults2.txt';
my ($max) = (@_, 1);
my $insults = load_insults($Filename);
for (1..$max) {
my @chain = random_insult_chain($insults);
local $, = ' ';
print @chain, \n;
}
return 0;
}
sub get_random_index($) {
my ($length) = @_;
# Note: rand() is not meant to be particular good at picking
# randomly. Look to CPAN for alternative options if you need
# something *good*.
return int rand $length;
}
sub load_insults {
my ($filename) = @_;
open my $fh, '', $filename or die open $filename: $!;
my @insults;
# Load the insults into an array of arrays.
while ($fh) {
my ($first, $second, $third) = split;
push @{$insults[0]}, $first;
push @{$insults[1]}, $second;
push @{$insults[2]}, $third;
}
close $fh or warn close $filename: $!;
return \@insults;
}
sub random_insult_chain {
my ($insults) = @_;
my @words = map random_insult_word($_), @$insults;
return @words;
}
sub random_insult_word {
my ($insult_column) = @_;
my $i = get_random_index @$insult_column;
my $word = $insult_column-[$i];
return $word;
}
__END__
Regards,
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Parsing multi column files
Thanks. I'll give this a shot.
On 1/18/15 7:44 PM, Brandon McCaig wrote:
On Sun, Jan 18, 2015 at 07:24:21PM -0500, Shawn H Corey wrote:
You would need an array for each column:
my $MAX = 10;
my @first = ();
my @second = ();
my @third = ();
sub get_columns {
my $file = shift @_;
open my $fh, '', $file or die could not open $file: $!\n;
while( $fh ){
my @items = split;
push @first, $items[0];
push @second, $items[0];
push @third, $items[0];
Minor typo there. I believe that Shawn meant:
push @first, $items[0];
push @second, $items[1];
push @third, $items[2];
Alternatively, eliminate the @items array entirely and assign to
a list of 3 lexical variables. For example:
my ($first, $second, $third) = split;
push @first, $first;
push @second, $second;
push @third, $third;
}
close $fh or die could not close $file: $!\n;
}
get_columns( 'insults2.txt' );
for ( 1 .. $MAX ){
my @line = (
@first[rand(@first)],
@second[rand(@second)],
@third[rand(@third)],
);
print @line\n;
}
Regards,
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Using regular expressions to populate a variable?
I was able to find match extraction in the perldoc. Here is a snippet of what I have. my $insult = ( $mech-text =~ m/Insulter\ (.*)\ Taken/ ); print $insult\n; But $insult is being populated with: 1 It should be populated with text. Can anyone tell me what I'm doing wrong here? Thanks. On 1/18/15 11:49 AM, Mike wrote: Hey everyone, I'm trying to find information on how I can use regular expressions to populate a variable. I want to pull text between one set of characters and another set of characters and use that to populate my variable. Can anyone point me in the right direction? Thanks. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Using regular expressions to populate a variable?
Hey everyone, I'm trying to find information on how I can use regular expressions to populate a variable. I want to pull text between one set of characters and another set of characters and use that to populate my variable. Can anyone point me in the right direction? Thanks. -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: Using regular expressions to populate a variable?
Thanks. This worked.
On 1/18/15 12:28 PM, Jim Gibson wrote:
On Jan 18, 2015, at 9:03 AM, Mike ekimduna...@gmail.com wrote:
I was able to find match extraction in the perldoc.
Here is a snippet of what I have.
my $insult = ( $mech-text =~ m/Insulter\ (.*)\ Taken/ );
print $insult\n;
But $insult is being populated with: 1
It should be populated with text. Can anyone tell me what I'm doing wrong here?
Your error is assigning the return value of the regular expression in a scalar
context. In scalar context, a regular expression returns true or false
indicating a match (or not). In array context, however, it returns the captured
subexpressions as a list.
Try forcing the assignment into array context:
my( $insult ) = ( $mech-text =~ m/Insulter\ (.*)\ Taken/ );
You can also use the capture variables $1, $2, $3, etc., which will contain the
captured subexpressions:
my $insult;
if( $mech-text =~ m/Insulter\ (.*)\ Taken/ ) ) {
$insult = $1;
}
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Parsing multi column files
So I've got a text file in a multi column format (three columns), each
column is separated by a single space. Here is a snippet for reference:
artless base-court apple-john
bawdy bat-fowling baggage
beslubbering beef-witted barnacle
I want to be able to randomly select a word from the first column, then
from the second column, then from the third column, and concatenate them
to together into a single string. Here's the code I currently have, but
I'm stuck:
sub gen_ins {
open(FH, '', 'insults2.txt') or die [-] ERROR: Can't find insult
list.;
my @cols = split ( , FH);
print $cols[0];
close FH;
}
gen_ins();
When currently run, gen_ins() will print out the first word of the given
column: $cols[0], $cols[1], or $cols[2]. How can I access the rest of
the words below the first?
Thanks.
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Submitting a form with Mechanize -- Can't find form
Hey everyone, I'm trying to submit a form with WWW::Mechanize to post a
new thread on a forum from the command line. The forum also requires an
image to be uploaded with it. Anyway...here is my snippet:
$mech-submit_form(
form_name = 'post',
fields = { body = $text, file = $file_location },
button = 'post'
);
When I run the code, I'm getting this error:
Uncaught exception from user code:
There is no form named post at
/usr/share/perl5/site_perl/WWW/Mechanize.pm line 1938.
But the HTML source code on the site shows that the form name IS indeed
post:
form name=post onsubmit=return dopost(this);
enctype=multipart/form-data action=/post.php method=post
Can anyone tell me why I'm receiving this error?
Thanks.
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Best practice for executing system commands?
Which is generally considered the best practice way of executing system commands from within a Perl program? Should I use backticks or qx//, system(), or exec()? Or is there no best way and it's just a matter of what you want to return? -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: sftp code to use
One way to unzip with Perl is this method: use warnings; use strict; use Archive::Zip qw( :ERROR_CODES :CONSTANTS ); my $zipfile = 'zipped.zip'; my $zip = Archive::Zip->new(); die "Error reading $zipfile:$!" unless $zip->read($zipfile) == AZ_OK; $zip->extractMember($zipfile) for $zip->members; __END__ On Oct 21, 2018, at 10:56 AM, Asad wrote: Hi All , I need to accomplish the following task . i was trying in python using subprocess and adive how to proceed will be helpful sftp u...@xyx.com 1212 pasword:xxx cd /patch1 get patch1.zip unzip patch1.zip sqlplus / as sysdba ===> connect to oracle database sql>startup Thanks, -- Asad Hasan +91 9582111698 Jim Gibson
PAUSE
I understand that to upload a module to CPAN is need to obtain a PAUSE account. I have tried twice to get that, but I don't receive an e-mail with a password. http://www.mflan.com/temp/pause.jpg If anybody can notify the PAUSE people that the PAUSE program appears to be broke, please do. Mike -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: PAUSE
I never did receive the e-mails to my AT e-mail, but a person in Demmark, or someplace like that, gave me some personal attention and I believe all is good now. Thanks so much to Shlomi, Andreas and everybody else. I first applied to PAUSE on 6/9/2019. Mike On 6/30/2019 7:07 PM, pengyong...@virgilio.it wrote: He will be waiting for more days to get a response from PAUSE. I once tried to apply for that, after a few days I got the verification mail. On June 30, 2019 at 2:23 PM Shlomi Fish wrote: Hi all, can someone try to help Mike here? On Sun, 30 Jun 2019 05:10:19 -0500 Mike wrote: I understand that to upload a module to CPAN is need to obtain a PAUSE account. I have tried twice to get that, but I don't receive an e-mail with a password. http://www.mflan.com/temp/pause.jpg If anybody can notify the PAUSE people that the PAUSE program appears to be broke, please do. Mike -- - Shlomi Fish http://www.shlomifish.org/ Understand what Open Source is - http://shlom.in/oss-fs “Did you sleep well?” “No, I made a couple of mistakes.” — https://en.wikiquote.org/wiki/Steven_Wright via Nadav Har’El Please reply to list if it's a mailing list post - http://shlom.in/reply . -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/ -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: Google Sheets API Data Structure
Please state the exact module name.
Is it this one:
https://metacpan.org/pod/Net::Google::Spreadsheets::V4
My guess is no.
Mike
On 8/15/2019 10:18 AM, James Kerwin wrote:
Hi All,
I managed to get the Google Sheets API Perl module working.
I'm currently investigating a data structure that it gives me to see
what values I can get from it. Through random experimentation I've
managed to find that it had "title" and "id".
I wrote this to get the data structure containing the worksheets:
my @ws = $spreadsheet->worksheets;
Now if I do:
print $ws[1]->id;
print $ws[1]->title;
I get the value in the id and the title for the specific item in the
array. I want to know what other information is in there.
If I do this:
for my $href (@ws) {
print "{ ";
for my $role (keys %{ $href }) {
print "$role=$href->{$role} ";
}
print "}\n";
}
I get:
{ atom=XML::Atom::Entry=HASH(0x1b81928)
container=Net::Google::Spreadsheets::Spreadsheet=HASH(0x1bbdb80)
}
{ atom=XML::Atom::Entry=HASH(0x1bbbe98)
container=Net::Google::Spreadsheets::Spreadsheet=HASH(0x1bbdb80)
}
{
container=Net::Google::Spreadsheets::Spreadsheet=HASH(0x1bbdb80)
atom=XML::Atom::Entry=HASH(0x1b86ca0) }
{
container=Net::Google::Spreadsheets::Spreadsheet=HASH(0x1bbdb80)
atom=XML::Atom::Entry=HASH(0x1b86988) }
{
container=Net::Google::Spreadsheets::Spreadsheet=HASH(0x1bbdb80)
atom=XML::Atom::Entry=HASH(0x1b8c958) }
If I use Dumper it just seems to output SO MUCH information that I
can't see the wood for the trees. Maybe I'm just tired after a
dramatic day in Perl land.
Can anyone help me untangle this? My spreadsheet has five worksheets
and there are five lines in my output so my assumption is that each
line represents a sheet.
Any advice/help/guidance would be greatly appreciated.
Thanks,
James
Re: Problem executing command via ssh
Wow, a complicated question that I know very little
about. But since nobody else has jumped in, I will
show my ignorance by suggesting this:
Perhaps change $command to @command.
or
use something like
local $/;
These beginners questions are getting
pretty complicated :-)
Mike
On 8/23/2019 11:16 AM, Mario Galindez wrote:
Folks,
I need to execute a program in a remote machine, that takes its input
from STDIN.
I created a user in such remote machine, and set my program as the
shell for that account (so I don't need to provide shell access).
On my local node, I have this program:
#!/usr/bin/perl
use IPC::Open3;
use POSIX;
$inputfile= $ARGV[0];
open(FILE, '<', "$ARGV[0]") or die $!;
$command= "ssh user\@remotehost.com <http://remotehost.com>";
$pid = open3('<', '>', '>', $command);
waitpid( $pid, 0 );
What I expect is that I pass the name of the file as arguments of this
program ($ARGV[0]), and the contents of this file is fed as STDIN of
the child I've spawn with open3. This should be received as STDIN of
my remote program, and the results of the remote program would be
printed on STDOUT.
This works well. However, my program only reads the first line, and
then terminates.
If I do a manual test, and do ssh u...@remotehost.com
<mailto:u...@remotehost.com>, and type multiple lines of input, then
things work as expected.
Any clues?
Thanks!
-m
Geo::WebService::Elevation::USGS
If there is anybody on Strawberry Perl, would
you please go to CPAN and install Geo::WebService::Elevation::USGS
Then run this program:
#!/usr/bin/perl
use strict;
use warnings;
use Geo::WebService::Elevation::USGS;
my $latd = '38.72360';
my $longd = '-90.76983';
my $getelev = Geo::WebService::Elevation::USGS->new();
my $elev = $getelev->elevation($latd, $longd)->{Elevation};
print "All done. Elevation = $elev ft.\n\n";
__END__
I expect you will get this error:
500 Can't connect to ned.usgs.gov:443 (Bad address) at .pl line 12.
If instead you get the elevation, please let me know.
Then go to USGS.pm, take it off Read Only, and change line 133 from
use constant USGS_URL => 'https://ned.usgs.gov/epqs/pqs.php';
to
use constant USGS_URL => 'https://nationalmap.gov/epqs/pqs.php';
Then run the program and I expect you will get this error:
500 Can't connect to nationalmap.gov:443 (Bad address) at .pl line 12.
If you get either to run correctly, see if you have
Geo::WebService in your environment variables.
Thank you.
Mike
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Geo::WebService::Elevation::USGS
Thank you all for the responses.
I now think this has nothing to do with
Geo::WebService::Elevation::USGS. See
the script below for other web links that
LWP::Simple cannot reach and parse. I have
not figured out why, but the problem is not
with USGS.pm,.
#!/usr/bin/perl
use strict;
use warnings;
use LWP::Simple;
chdir 'C:/Copy';
# Works
#my $test = get('http://osgeo-org.1560.x6.nabble.com/') or die 'Unable
to get page'; # Works
#my $test = get('https://www.chron.com/neighborhood/bayarea/') or die
'Unable to get page'; # Works
#my $test = get('http://history.house.gov/Map/Mapping-Congress/') or die
'Unable to get page'; # Works
#my $test = get('http://hint.fm/wind/') or die 'Unable to get page'; # Works
#my $test = get('http://antwrp.gsfc.nasa.gov/apod/astropix.html') or die
'Unable to get page'; # Works
# Does not work
my $test = get('https://nationalmap.gov/epqs/') or die 'Unable to get
page'; # Does not work
#my $test = get('http://www.wrh.noaa.gov/zoa/mwmap3.php?map=usa') or die
'Unable to get page'; # Does not work
#my $test = get('http://www.glorecords.blm.gov/') or die 'Unable to get
page'; # Does not work
#my $test = get('https://glorecords.blm.gov/default.aspx') or die
'Unable to get page'; # Does not work
print "\nAll done.\n\n\$test = $test\n\n";
__END__
There is stuff posted about this problem. I have
been through using UserAgent, declaring the browser,
environment variables, and other things and it
still doesn't work. Good thing I don't need this
or it would be driving me crazy. I will probably
move on to other things now.
use strict;
use warnings;
use LWP::UserAgent;
$ENV{PERL_LWP_SSL_VERIFY_HOSTNAME} = 0;
my $url = "https://nationalmap.gov/epqs/pqs.php;;
my $ua = LWP::UserAgent->new( ssl_opts => { verify_hostname => 0, } );
$ua->env_proxy;
$ua->agent("Mozilla/5.0 (Windows)");
my $response = $ua->get($url);
if ($response->is_success) {
print $response->content;
} else {
die $response->status_line;
}
print "All done.\n\n";
__END__
Mike
On 8/26/2019 10:26 PM, Uri Guttman wrote:
On 8/26/19 8:00 PM, Mike wrote:
use constant USGS_URL => 'https://ned.usgs.gov/epqs/pqs.php';
to
use constant USGS_URL => 'https://nationalmap.gov/epqs/pqs.php';
have you tried to just telnet to those hosts?
telnet nationalmap.gov:443
telnet: could not resolve nationalmap.gov:443/telnet: Name or service
not known
telnet ned.usgs.gov:443
telnet: could not resolve ned.usgs.gov:443/telnet: Name or service not
known
so there is something wrong with the urls and not the code (or the
code has bad urls).
and just getting the web pages is also failing
GET https://ned.usgs.gov/epqs/pqs.php
General failure: Invalid Coordinates
GET https://nationalmap.gov/epqs/pqs.php
General failure: Invalid Coordinates
i dunno the module but it seems that you may not be passing in any
coordinates or something else is needed.
uri
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Geo::WebService::Elevation::USGS
Yes. Both of these work fine:
my $test = get('http://google.com/') or die 'Unable to get page'; # Works
my $test = get('https://google.com/') or die 'Unable to get page'; # Works
On 8/29/2019 9:33 PM, Olivier wrote:
Mike writes:
Sorry Mike, but I have hard time to get a clear picture of what you are
saying.
Did you manage to use LWP::Simple to load google.com?
Yes. Both of these work:
my $test = get('http://google.com/') or die 'Unable to get page'; # Works
my $test = get('https://google.com/') or die 'Unable to get page'; # Works
This is really the first question, the first step to build the
diagnostic.
So far, I cannot even decide whether the version of LWP::Simple
installed on your machine is properly working or not. So I cannot decide
whether it is a network problem or a software problem.
Best regards,
Olivier
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Geo::WebService::Elevation::USGS
This one gives:
Unable to get page at httpfetch.pl line 35.
I wonder if all of these are redirects:
# Does not work
my $test = get('https://nationalmap.gov/epqs/') or die 'Unable to get
page'; # Does not work
#my $test = get('https://nationalmap.gov/epqs/pqs.php') or die 'Unable
to get page'; # Does not work
#my $test = get('http://www.wrh.noaa.gov/zoa/mwmap3.php?map=usa') or die
'Unable to get page'; # Does not work
#my $test = get('http://www.glorecords.blm.gov/') or die 'Unable to get
page'; # Does not work
#my $test = get('https://glorecords.blm.gov/default.aspx') or die
'Unable to get page'; # Does not work
Mike
On 9/2/2019 12:31 AM, Olivier wrote:
Mike writes:
Yes. Both of these work fine:
my $test = get('http://google.com/') or die 'Unable to get page'; # Works
my $test = get('https://google.com/') or die 'Unable to get page'; # Works
Good, do we know two things:
- your LWP::Simple is correctly installed
- you have no proxy
Next step is to see what is the result of https://nationalmap.gov/epqs/
So you should try with (note the / at the end):
my $test = get('https://nationalmap.gov/epqs/') or die...
Problem is that it is going through redirections and beacuase it is
encrypted, it is almost impossible to debug by hand.
Olivier
On 8/29/2019 9:33 PM, Olivier wrote:
Mike writes:
Sorry Mike, but I have hard time to get a clear picture of what you are
saying.
Did you manage to use LWP::Simple to load google.com?
Yes. Both of these work:
my $test = get('http://google.com/') or die 'Unable to get page'; # Works
my $test = get('https://google.com/') or die 'Unable to get page'; # Works
This is really the first question, the first step to build the
diagnostic.
So far, I cannot even decide whether the version of LWP::Simple
installed on your machine is properly working or not. So I cannot decide
whether it is a network problem or a software problem.
Best regards,
Olivier
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Geo::WebService::Elevation::USGS
Thanks for the response.
I agree with everything you say.
I just want my LWP::Simple to access every
web link that my browser can access.
I now know that some of you can run the
code below and get all 4 of the websites
I have listed to return the website info.
All 4 of those web links gives:
"Unable to get page at httpfetch.pl line 21."
I can see I am not alone in having this problem.
Others have had the same problem with only a few
web links.
#!/usr/bin/perl
use strict;
use warnings;
use LWP::Simple;
# Does not work
my $test = get('https://nationalmap.gov/epqs/pqs.php') or die 'Unable to
get page'; # Does not work
#my $test = get('http://www.wrh.noaa.gov/zoa/mwmap3.php?map=usa') or die
'Unable to get page'; # Does not work
#my $test = get('http://www.glorecords.blm.gov/') or die 'Unable to get
page'; # Does not work
#my $test = get('https://glorecords.blm.gov/default.aspx') or die
'Unable to get page'; # Does not work
print "\nAll done.\n\n\$test = $test\n\n";
__END__
On 8/28/2019 10:00 PM, Olivier wrote:
Mike writes:
Thanks for the response.
Yeah, I don't understand why
https://nationalmap.gov/epqs/pqs.php
won't open in a browser, but
In fact, it does open in a browser and the result is "General failure:
Invalid Coordinates".
This URL runs the PHP script pqs.php, this script needs input
coordinates, if there is no coordinates supplied, this script returns
the message about invalid coordinates.
This message is not a message from your browser, it is not a message
from the web server, it is a message from pqs.php. Your browser and the
web server are just fine.
And frankly speaking, what result are you expecting? pqs.php is a script
that returns some data depending on the input data you give. You give no
input, you get no output.
https://nationalmap.gov/epqs/
will. I imagine this may have something
to do with redirects, but who knows.
This URL is missing the filename part (after the last /), in that case,
the web server uses a default file (depending on the configuration of
the web server) and the default file is presenting a page that asks for
coordinates.
So you are asking 2 differents URL, that corresponds to two different
pages, each page giving the correct result.
When I put
https://nationalmap.gov/epqs/pqs.php
into a web browser it says:
General failure: Invalid Coordinates
When I put
http://ned.usgs.gov/epqs/pqs.php
into a web browser it says the same exact thing.
And it is expected that the URL with http and with https give the same
correct result.
When I go to
https://nationalmap.gov/epqs/
and put -90.76983 for X
and put 38.72360 for Y
and hit "Get Elevation"
it gives:
3DEP 1/3 arc-second
583.54
Feet
When I go to:
https://nationalmap.gov/epqs/pqs.php?x=-90.76983=38.72360=feet=xml
it gives:
3DEP 1/3 arc-second
583.54
Feet
So that works.
It works because you are providing correct input.
Best regards,
Olivier
Mike
On 8/26/2019 10:26 PM, Uri Guttman wrote:
have you tried to just telnet to those hosts?
telnet nationalmap.gov:443
telnet: could not resolve nationalmap.gov:443/telnet: Name or service
not known
telnet ned.usgs.gov:443
telnet: could not resolve ned.usgs.gov:443/telnet: Name or service not
known
so there is something wrong with the urls and not the code (or the
code has bad urls).
and just getting the web pages is also failing
GET https://ned.usgs.gov/epqs/pqs.php
General failure: Invalid Coordinates
GET https://nationalmap.gov/epqs/pqs.php
General failure: Invalid Coordinates
i dunno the module but it seems that you may not be passing in any
coordinates or something else is needed.
uri
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Geo::WebService::Elevation::USGS
Thanks for the response. Yeah, I don't understand why https://nationalmap.gov/epqs/pqs.php won't open in a browser, but https://nationalmap.gov/epqs/ will. I imagine this may have something to do with redirects, but who knows. When I put https://nationalmap.gov/epqs/pqs.php into a web browser it says: General failure: Invalid Coordinates When I put http://ned.usgs.gov/epqs/pqs.php into a web browser it says the same exact thing. When I go to https://nationalmap.gov/epqs/ and put -90.76983 for X and put 38.72360 for Y and hit "Get Elevation" it gives: 3DEP 1/3 arc-second 583.54 Feet When I go to: https://nationalmap.gov/epqs/pqs.php?x=-90.76983=38.72360=feet=xml it gives: 3DEP 1/3 arc-second 583.54 Feet So that works. Mike On 8/26/2019 10:26 PM, Uri Guttman wrote: have you tried to just telnet to those hosts? telnet nationalmap.gov:443 telnet: could not resolve nationalmap.gov:443/telnet: Name or service not known telnet ned.usgs.gov:443 telnet: could not resolve ned.usgs.gov:443/telnet: Name or service not known so there is something wrong with the urls and not the code (or the code has bad urls). and just getting the web pages is also failing GET https://ned.usgs.gov/epqs/pqs.php General failure: Invalid Coordinates GET https://nationalmap.gov/epqs/pqs.php General failure: Invalid Coordinates i dunno the module but it seems that you may not be passing in any coordinates or something else is needed. uri -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: Geo::WebService::Elevation::USGS
In my Firefox it is set at:
"Use system proxy settings"
I turned it off briefly, but didn't really see
any changes.
I do not implement a proxy in LWP::Simple.
I don't think I use a system Proxy:
http://www.mflan.com/temp/proxy.jpg
Mike
On 8/29/2019 5:52 AM, Olivier wrote:
And another question... Are you using any proxy in your broswer? If you
do, how did you implemented that proxy in LWP::Simple? Olivier Olivier
writes:
Mike writes:
Thanks for the response.
I agree with everything you say.
I just want my LWP::Simple to access every
web link that my browser can access.
I now know that some of you can run the
code below and get all 4 of the websites
I have listed to return the website info.
All 4 of those web links gives:
"Unable to get page at httpfetch.pl line 21."
I can see I am not alone in having this problem.
Others have had the same problem with only a few
web links.
I don't see why you have a 'die at line 21' while your script has way
less than 21 lines. Also, the script comes all mangled by the mail, so
one cannot say if the error is yours or the mailer.
Make your script simple first, so you can confirm your environment is
working:
#!/usr/bin/perl
use LWP::Simple;
$test=get('https://google.com');
print $test;
When that is working, start changing things one at a time and check at
each stage that it is still working.
You may also explore the documentation of LWP::Simple to get an error
message that makes sense, because what you get so far is only 'it does
not work', one cannot make a diagnostic with that only.
Good luck,
Olivier
Re: Geo::WebService::Elevation::USGS
I sure appreciate your help.
I have done quite a few things listed on the internet
with both Simple and UserAgent.
We see that many of the failing sites are govt
sites. One guy can access all my Not Working sites,
but he says that glorecords and nationalmap.gov react
very slow, even when UserAgent uses the FireFox
identity.
I know I can use Mechanize and really dive into this.
And I might do that someday. But for the moment I'm
thinking this is unlikely to get fixed in the next week.
Good thing I don't need this.
Mike
On 8/29/2019 5:35 AM, Olivier wrote:
I don't see why you have a 'die at line 21' while your script has way
less than 21 lines. Also, the script comes all mangled by the mail, so
one cannot say if the error is yours or the mailer.
Make your script simple first, so you can confirm your environment is
working:
#!/usr/bin/perl
use LWP::Simple;
$test=get('https://google.com');
print $test;
When that is working, start changing things one at a time and check at
each stage that it is still working.
You may also explore the documentation of LWP::Simple to get an error
message that makes sense, because what you get so far is only 'it does
not work', one cannot make a diagnostic with that only.
Good luck,
Olivier
#!/usr/bin/perl
use strict;
use warnings;
use LWP::Simple;
# Does not work
my $test = get('https://nationalmap.gov/epqs/pqs.php') or die 'Unable to get
page'; # Does not work
#my $test = get('http://www.wrh.noaa.gov/zoa/mwmap3.php?map=usa') or die
'Unable to get page'; # Does not work
#my $test = get('http://www.glorecords.blm.gov/') or die 'Unable to get page';
# Does not work
#my $test = get('https://glorecords.blm.gov/default.aspx') or die 'Unable to
get page'; # Does not work
print "\nAll done.\n\n\$test = $test\n\n";
__END__
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Geo::WebService::Elevation::USGS
I was thinking it might give the fill in form that you get when you go here: https://nationalmap.gov/epqs/ I think you are right. It is acting as intended when visited with a browser. Mike On 8/28/2019 10:00 PM, Olivier wrote: Mike writes: Thanks for the response. Yeah, I don't understand why https://nationalmap.gov/epqs/pqs.php won't open in a browser, but In fact, it does open in a browser and the result is "General failure: Invalid Coordinates". This URL runs the PHP script pqs.php, this script needs input coordinates, if there is no coordinates supplied, this script returns the message about invalid coordinates. This message is not a message from your browser, it is not a message from the web server, it is a message from pqs.php. Your browser and the web server are just fine. And frankly speaking, what result are you expecting? pqs.php is a script that returns some data depending on the input data you give. You give no input, you get no output. https://nationalmap.gov/epqs/ will. I imagine this may have something to do with redirects, but who knows. This URL is missing the filename part (after the last /), in that case, the web server uses a default file (depending on the configuration of the web server) and the default file is presenting a page that asks for coordinates. So you are asking 2 differents URL, that corresponds to two different pages, each page giving the correct result. When I put https://nationalmap.gov/epqs/pqs.php into a web browser it says: General failure: Invalid Coordinates When I put http://ned.usgs.gov/epqs/pqs.php into a web browser it says the same exact thing. And it is expected that the URL with http and with https give the same correct result. When I go to https://nationalmap.gov/epqs/ and put -90.76983 for X and put 38.72360 for Y and hit "Get Elevation" it gives: 3DEP 1/3 arc-second 583.54 Feet When I go to: https://nationalmap.gov/epqs/pqs.php?x=-90.76983=38.72360=feet=xml it gives: 3DEP 1/3 arc-second 583.54 Feet So that works. It works because you are providing correct input. Best regards, Olivier Mike On 8/26/2019 10:26 PM, Uri Guttman wrote: have you tried to just telnet to those hosts? telnet nationalmap.gov:443 telnet: could not resolve nationalmap.gov:443/telnet: Name or service not known telnet ned.usgs.gov:443 telnet: could not resolve ned.usgs.gov:443/telnet: Name or service not known so there is something wrong with the urls and not the code (or the code has bad urls). and just getting the web pages is also failing GET https://ned.usgs.gov/epqs/pqs.php General failure: Invalid Coordinates GET https://nationalmap.gov/epqs/pqs.php General failure: Invalid Coordinates i dunno the module but it seems that you may not be passing in any coordinates or something else is needed. uri -- To unsubscribe, e-mail: beginners-unsubscr...@perl.org For additional commands, e-mail: beginners-h...@perl.org http://learn.perl.org/
Re: Geo::WebService::Elevation::USGS
Thank you. That helps me a lot to know that it works for you.
Your code, exactly as you sent it, still does not work for me.
It gives:
500 Can't connect to nationalmap.gov:443 (Bad address) at trash.pl line 19.
I'm going to try to assign an environment variable to my
system. I doubt that will fix it, but I am trying just
about everything.
I still can't figure out why it works on some URL's,
and not others. It's probably going to take me a
long time to figure this out.
Mike
On 8/28/2019 6:26 PM, $Bill wrote:
This seems fine on my Win10:
use strict;
use warnings;
use LWP::UserAgent;
my $url;
if (0) { # set to 1 or 0 to flop urls
$url = 'https://nationalmap.gov/epqs';
} else {
$url =
'https://nationalmap.gov/epqs/pqs.php?y=34.0=-118.0=Feet=xml';
}
my $ua = LWP::UserAgent->new(); # ssl_opts => { verify_hostname => 0,
} );
$ua->agent("Mozilla/5.0 (Windows)");
my $response = $ua->get($url);
if ($response->is_success) {
print $response->content;
} else {
die $response->status_line;
}
print "All done.\n\n";
__END__
Dumps the page or elevation depending on url:
perl test.pl
?>y="34.0">3DEP 1/3
arc-second916.71FeetAll
done.
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: Hi Folks : I'm trying to create a regular expression for finding a # wishing a dataset for only a number that is a multiple of 5
It's probably best if you write a short script
that reads a __DATA__ section of data.
Then tell us what it does and what you expected
it to do.
Off hand I don't see anything wrong with your regex,
but I don't know what you expect it to do.
Mike
On 9/8/2019 4:34 PM, Jim Gibson wrote:
On Sep 8, 2019, at 1:30 PM, Gautam Desai wrote:
Do you guys have any pointers ?
$t =~ m{
( # capture matched number in $1
\d* # match zero or more decimal digits
[05] # followed by a '0' or '5'
) # end of capture
(?: # followed by either:
\D# a non-digit
| # or
$ # the end of the string
)
}x
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
regular expression
You are not doing anything with $t to test whether
it works. Also you are not telling us what data you
might test it with.
Mike
On 9/8/2019 6:41 PM, Jim Gibson wrote:
On Sep 8, 2019, at 3:39 PM, Mike wrote:
I expect it to return a positive value if $t contains a number anywhere within
it and put that number in the $1 capture variable.
On 9/8/2019 4:34 PM, Jim Gibson wrote:
On Sep 8, 2019, at 1:30 PM, Gautam Desai wrote:
Do you guys have any pointers ?
$t =~ m{
( # capture matched number in $1
\d* # match zero or more decimal digits
[05] # followed by a '0' or '5'
) # end of capture
(?: # followed by either:
\D# a non-digit
| # or
$ # the end of the string
)
}x
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Jim Gibson
j...@gibson.org
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
Re: symlink to "pack"
Maybe you should simplify to:
#!/usr/bin/perl
use strict;
use warnings;
symlink('ab', "foo") || die $!;
If that doesn't work try it after changing
'symlink'
to
'link'
Printing your $target gives a space and this symbol:
https://www.fileformat.info/info/unicode/char/2640/index.htm
I am on Strawberry Perl, so I can't really
help debug this.
Mike
On 9/7/2019 3:25 PM, Jorge Almeida wrote:
Sorry about the title, it's the best I can do...
#!/usr/bin/perl
use strict;
use warnings;
my $num=12;
my $target=pack('n', $num);
symlink($target, "foo") || die $!;
It dies with "No such file or directory"
No symlink is created. What I want is a symlink named "foo" pointing
to a 2-byte string. Yes, it would be a broken symlink. (Yes, this is
how I want it).
Symlink() can create broken links, the problem is the target. What to
do? (And why doesn't it work?)
TIA
Jorge Almeida
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
