Re: [galaxy-dev] generate dynamic select list based on other input dataset
Hi Jeremy, I understood the filter tags help if you want to filter input data based on options in a .loc file, right? My aim is to extract the column names of an input dataset, present them in a selection box or dropdown list, let the user choose one, and process the input set (with two inputs, the input set itself and the selection made based on the input set). Do you think that something like this is possible at all? I attach the source of my dummy module and the python library which I use via code file= The Syntax error I get is SyntaxError: invalid syntax (string, line 1) The complete traceback is below. The thread I was referring to in my mail can be found here: http://www.mail-archive.com/galaxy-dev@lists.bx.psu.edu/msg03666.html (Dec 12, 2011; Dynamic Tool Parameter Lists). Cheers, Holger Module weberror.evalexception.middleware:364 in respond view app_iter = self.application(environ, detect_start_response) Module paste.debug.prints:98 in __call__ view environ, self.app) Module paste.wsgilib:539 in intercept_output view app_iter = application(environ, replacement_start_response) Module paste.recursive:80 in __call__ view return self.application(environ, start_response) Module paste.httpexceptions:632 in __call__ view return self.application(environ, start_response) Module galaxy.web.framework.base:160 in __call__ view body = method( trans, **kwargs ) Module galaxy.web.controllers.tool_runner:68 in index view template, vars = tool.handle_input( trans, params.__dict__ ) Module galaxy.tools:1147 in handle_input view state = self.new_state( trans ) Module galaxy.tools:1075 in new_state view self.fill_in_new_state( trans, inputs, state.inputs ) Module galaxy.tools:1084 in fill_in_new_state view state[ input.name ] = input.get_initial_value( trans, context ) Module galaxy.tools.parameters.basic:788 in get_initial_value view options = list( self.get_options( trans, context ) ) Module galaxy.tools.parameters.basic:641 in get_options view return eval( self.dynamic_options, self.tool.code_namespace, other_values ) SyntaxError: invalid syntax (string, line 1) On 02/13/2012 03:04 PM, Jeremy Goecks wrote: Holger, Have you looked at how dynamic options work and whether they would be sufficient for your use? See thefilter tag syntax for details: http://wiki.g2.bx.psu.edu/Admin/Tools/Tool%20Config%20Syntax#A.3Cfilter.3E_tag_set http://wiki.g2.bx.psu.edu/Admin/Tools/Tool Config Syntax#A.3Cfilter.3E_tag_set To specifically address your problem: can you determine the particular place where the syntax error is appearing? And can you provide a link to the thread that you're using as a starting point? Thanks, J. On Feb 10, 2012, at 3:43 PM, Holger Klein wrote: Dear all, I'm still stuck with the problem to dynamically generate an option list extracted from a user-selectable input dataset. Does anybody have experience here, or is this not possible at all? Have a nice weekend, Holger On 02/07/2012 09:58 PM, Holger Klein wrote: Dear all, I have a working module which generates wig files for genomic annotation from a single column of a bigger input data matrix (Input A). In the current state, the user has to input the column name (Input B) from which to calculate the values in the wig file. Now I'd like to modify the xml in such a way, that depending on the input dataset (Input A) a dynamic list for Input B is generated. I found Hans-Rudolf Hotz' hints from some time ago on this list and thought that the following would be a good start: param name = InputB label = InputBName format = data type = select help = Use tickboxes to select model display = radio dynamic_options = getInputBOptions($InputA) / code file=getInputBOptionsFromInputA.py getInputBOptionsFromInputA.py contains a single function def getInputBOptions($InputA): ## parse Input A ## create list InputBOptions return(InputBOptions) Using this approach I get an invalid syntax message when trying to even open the module - in any case I have the feeling that something is still missing here. Did anybody solve a similar problem already and could give me a hint on how to solve that? Cheers, Holger -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 def getDynamicOptions(Outfile): MO = open(Outfile, r) header
Re: [galaxy-dev] generate dynamic select list based on other input dataset
Dear all, I'm still stuck with the problem to dynamically generate an option list extracted from a user-selectable input dataset. Does anybody have experience here, or is this not possible at all? Have a nice weekend, Holger On 02/07/2012 09:58 PM, Holger Klein wrote: Dear all, I have a working module which generates wig files for genomic annotation from a single column of a bigger input data matrix (Input A). In the current state, the user has to input the column name (Input B) from which to calculate the values in the wig file. Now I'd like to modify the xml in such a way, that depending on the input dataset (Input A) a dynamic list for Input B is generated. I found Hans-Rudolf Hotz' hints from some time ago on this list and thought that the following would be a good start: param name = InputB label = InputBName format = data type = select help = Use tickboxes to select model display = radio dynamic_options = getInputBOptions($InputA) / code file=getInputBOptionsFromInputA.py getInputBOptionsFromInputA.py contains a single function def getInputBOptions($InputA): ## parse Input A ## create list InputBOptions return(InputBOptions) Using this approach I get an invalid syntax message when trying to even open the module - in any case I have the feeling that something is still missing here. Did anybody solve a similar problem already and could give me a hint on how to solve that? Cheers, Holger -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] generate dynamic select list based on other input dataset
Dear all, I have a working module which generates wig files for genomic annotation from a single column of a bigger input data matrix (Input A). In the current state, the user has to input the column name (Input B) from which to calculate the values in the wig file. Now I'd like to modify the xml in such a way, that depending on the input dataset (Input A) a dynamic list for Input B is generated. I found Hans-Rudolf Hotz' hints from some time ago on this list and thought that the following would be a good start: param name = InputB label = InputBName format = data type = select help = Use tickboxes to select model display = radio dynamic_options = getInputBOptions($InputA) / code file=getInputBOptionsFromInputA.py getInputBOptionsFromInputA.py contains a single function def getInputBOptions($InputA): ## parse Input A ## create list InputBOptions return(InputBOptions) Using this approach I get an invalid syntax message when trying to even open the module - in any case I have the feeling that something is still missing here. Did anybody solve a similar problem already and could give me a hint on how to solve that? Cheers, Holger -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] xml tool wrapper conditional
Dear all, I'm working on a tool wrapper which for a sequence scoring tool. It's supposed to score sequences either using a library installed to galaxy (tool-data/models.loc) or datasets from the user history. I tried to implement this behavior using the conditional / when value mechanism, simplified code follows below. Using locally installed models (from models.loc) fails with NotFound: cannot find 'models', although in the details view of the failed tool run model database points to the right file. Using the model file from the history works. Defining _only_ locally installed models from models.loc also works (removing the conditional stuff and leaving only the part inside when value='local' /when). The commandline might look a bit strange but is correct. Can anybody spot what is going wrong here? Regards, Holger -- command calcModels --scoreFasta -- --fa $fasta_in --bgFa $fasta_background --models $models $output_table /command inputs param format=fasta name=fasta_in type=data label=Input Fasta File / param format=fasta name=fasta_background type=data label=Background Fasta File / conditional name=ModelSource param name=models type=select label=model source help=History or installed models? value=local option value=localLocally installed models/option option value=historyModels from your history/option /param when value=local param name=models type=select label=model database options from_file=models.loc column name=name index=1/ column name=value index=2/ /options /param /when when value=history param name=models type=data format=tabular label=model database / /when /conditional /inputs -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] postgres user change problem
Dear all,
due to some work on the user management of our servers we had to rename
the user galaxy runs as. Up to now we used ident as postgres
authentication method, meaning that here postgres expects unix username
galaxy to have permissions of galaxy postgres user.
The entry in universe_wsgi.ini is simply:
database_connection = postgres:///galaxy?host=/var/run/postgresql
After the renaming, the new user galaxynew didn't get access at all at
first. Now I tried two things:
- adding a user galaxynew to postgres with permissions for database galaxy
and
- dumping the contents of database galaxy into a file and re-reading
this into database galaxynew, which is owned by the user galaxynew
and of course changing the config file line to
database_connection = postgres:///galaxynew?host=/var/run/postgresql
In both cases I end up with an error during startup of galaxy:
[...]
WARNING 2012-01-20 14:46:55,556 Error closing cursor: current
transaction is aborted, commands ignored until end of transaction block
[...]
ProgrammingError: (ProgrammingError) permission denied for relation
migrate_version
'SELECT migrate_version.repository_id, migrate_version.repository_path,
migrate_version.version \nFROM migrate_version \nWHERE
migrate_version.repository_id = %(repository_id_1)s' {'repository_id_1':
'Galaxy'}
(complete traceback below).
Does anyone have a hint on how I could fix this?
Cheers,
Holger
sqlalchemy.pool.QueuePool.0x...8d10 WARNING 2012-01-20 14:46:55,556
Error closing cursor: current transaction is aborted, commands ignored
until end of transaction block
Traceback (most recent call last):
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/lib/galaxy/web/buildapp.py,
line 82, in app_factory
app = UniverseApplication( global_conf = global_conf, **kwargs )
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/lib/galaxy/app.py, line
39, in __init__
create_or_verify_database( db_url, kwargs.get( 'global_conf', {}
).get( '__file__', None ), self.config.database_engine_options )
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/lib/galaxy/model/migrate/check.py,
line 99, in create_or_verify_database
db_schema = schema.ControlledSchema( engine, migrate_repository )
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/eggs/sqlalchemy_migrate-0.5.4-py2.6.egg/migrate/versioning/schema.py,
line 24, in __init__
self._load()
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/eggs/sqlalchemy_migrate-0.5.4-py2.6.egg/migrate/versioning/schema.py,
line 41, in _load
self.table.c.repository_id == str(self.repository.id)))
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/engine/base.py,
line 1202, in execute
return connection.execute(statement, *multiparams, **params)
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/engine/base.py,
line 824, in execute
return Connection.executors[c](self, object, multiparams, params)
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/engine/base.py,
line 874, in _execute_clauseelement
return self.__execute_context(context)
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/engine/base.py,
line 896, in __execute_context
self._cursor_execute(context.cursor, context.statement,
context.parameters[0], context=context)
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/engine/base.py,
line 950, in _cursor_execute
self._handle_dbapi_exception(e, statement, parameters, cursor, context)
File
/local/data/home/galaxy/galaxy-dist-2011-11-23/eggs/SQLAlchemy-0.5.6_dev_r6498-py2.6.egg/sqlalchemy/engine/base.py,
line 931, in _handle_dbapi_exception
raise exc.DBAPIError.instance(statement, parameters, e,
connection_invalidated=is_disconnect)
ProgrammingError: (ProgrammingError) permission denied for relation
migrate_version
'SELECT migrate_version.repository_id, migrate_version.repository_path,
migrate_version.version \nFROM migrate_version \nWHERE
migrate_version.repository_id = %(repository_id_1)s' {'repository_id_1':
'Galaxy'}
--
Dr. Holger Klein
Core Facility Bioinformatics
Institute of Molecular Biology gGmbH (IMB)
http://www.imb-mainz.de/
Tel: +49(6131) 39 21511
___
Please keep all replies on the list by using reply all
in your mail client. To manage your subscriptions to this
and other Galaxy lists, please use the interface at:
http://lists.bx.psu.edu/
[galaxy-dev] LDAP NGINX
Dear all, I'd like to integrate external user authentication with our local galaxy installation. So far we are running nginx as proxy, but all examples I found for LDAP and galaxy are for apache. Is anybody out there who has a working installation with LDAP and nginx? Cheers, Holger -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-dev] Solved: Re: global configuration of email from possible?
Hi all,
just in case anyone runs into the same problem, a short update with a
solution.
On 08/12/2011 01:59 PM, Enis Afgan wrote:
On Fri, Aug 12, 2011 at 4:37 AM, Holger Klein h.kl...@imb-mainz.de
mailto:h.kl...@imb-mainz.de wrote:
Hi Dannon,
thanks for the info. I'd like to take this a small step further. I added
the variable smtp_from to universe_wsgi.ini. Then I modified the
util.send_mail in ./lib/galaxy/util/__init__.py to check if
config.smtp_from is set:
if config.smtp_from is None:
msg[ 'From' ] = frm
else:
msg[ 'From' ] = config.smtp_from
Still frm is set to the old value (galaxy-no-reply@computeserver). Can
anyone point me to the place where universe_wsgi.ini is actually parsed
and the config dictionary is filled?
The parsing of the config file is done as part of Python's paste and
it's then made available to the rest of Galaxy via lib/galaxy/config.py.
There is only one instance of that class for the entire app but the
send_mail method you were looking at does not have access to that
object. So, you should look higher up in the hierarchy and set frm in
the method that calls send_mail (there seem to be several places where
it's called).
The send_mail method gets config as the last argument, so the
variables from universe_wsgi.ini are accessible within the function.
I did the following:
1) modify universe_wsgi.ini:
add the line
smtp_from = desired_f...@localhost.net
2) modify galaxy-dist/lib/galaxy/config.py:
add the line
self.smtp_from = kwargs.get( 'smtp_from', None )
3) modify function send_mail in galaxy-dist/lib/galaxy/util/__init__.py:
line 550:
## msg[ 'From' ] = frm
if config.smtp_from is None:
msg[ 'From' ] = frm
smtp_frm = frm
else:
msg[ 'From' ] = config.smtp_from
smtp_frm = config.smtp_from
[...]
## end of function send_mail:
## s.sendmail( frm, to, msg.as_string() )
s.sendmail( smtp_frm, to, msg.as_string() )
Now galaxy checks if the variable smtp_from is set; if yes, it adjusts
the from header in all cases the send_mail function is used, otherwise
it uses the old method.
I attach patches, feel free to add if you think this could be useful for
anyone else but me.
Cheers,
Holger
--
Dr. Holger Klein
Core Facility Bioinformatics
Institute of Molecular Biology gGmbH (IMB)
http://www.imb-mainz.de/
Tel: +49(6131) 39 21511
diff -r 720455407d1c lib/galaxy/config.py
--- a/lib/galaxy/config.py Thu Jun 23 11:03:45 2011 -0400
+++ b/lib/galaxy/config.py Mon Aug 15 14:48:32 2011 +0200
@@ -74,16 +74,17 @@ class Configuration( object ):
self.output_size_limit = int( kwargs.get( 'output_size_limit', 0 ) )
self.job_walltime = kwargs.get( 'job_walltime', None )
self.admin_users = kwargs.get( admin_users, )
self.mailing_join_addr =
kwargs.get('mailing_join_addr',galaxy-user-j...@bx.psu.edu)
self.error_email_to = kwargs.get( 'error_email_to', None )
self.smtp_server = kwargs.get( 'smtp_server', None )
self.smtp_username = kwargs.get( 'smtp_username', None )
self.smtp_password = kwargs.get( 'smtp_password', None )
+self.smtp_from = kwargs.get( 'smtp_from', None )
self.start_job_runners = kwargs.get( 'start_job_runners', None )
# External Service types used in sample tracking
self.external_service_type_config_file = resolve_path( kwargs.get(
'external_service_type_config_file', 'external_service_types_conf.xml' ),
self.root )
self.external_service_type_path = resolve_path( kwargs.get(
'external_service_type_path', 'external_service_types' ), self.root )
# Tasked job runner.
self.use_tasked_jobs = string_as_bool( kwargs.get( 'use_tasked_jobs',
False ) )
# The transfer manager and deferred job queue
self.enable_beta_job_managers = string_as_bool( kwargs.get(
'enable_beta_job_managers', 'False' ) )
diff -r 720455407d1c lib/galaxy/util/__init__.py
--- a/lib/galaxy/util/__init__.py Thu Jun 23 11:03:45 2011 -0400
+++ b/lib/galaxy/util/__init__.py Mon Aug 15 14:44:33 2011 +0200
@@ -542,17 +542,26 @@ def nice_size(size):
return '??? bytes'
def send_mail( frm, to, subject, body, config ):
Sends an email.
msg = MIMEText( body )
msg[ 'To' ] = to
-msg[ 'From' ] = frm
+
+log.warning( '1config-from: %s' % config.smtp_from )
+log.warning( '1FROM: %s' % frm )
+log.warning( 'body: %s' % body )
+if config.smtp_from is None:
+msg[ 'From' ] = frm
+smtp_frm = frm
+else:
+msg[ 'From' ] = config.smtp_from
+smtp_frm = config.smtp_from
msg[ 'Subject' ] = subject
if config.smtp_server is None:
log.error( Mail is not configured for this Galaxy instance. )
log.info( msg )
return
s = smtplib.SMTP()
s.connect( config.smtp_server
Re: [galaxy-dev] global configuration of email from possible?
Hi Dannon, thanks for the info. I'd like to take this a small step further. I added the variable smtp_from to universe_wsgi.ini. Then I modified the util.send_mail in ./lib/galaxy/util/__init__.py to check if config.smtp_from is set: if config.smtp_from is None: msg[ 'From' ] = frm else: msg[ 'From' ] = config.smtp_from Still frm is set to the old value (galaxy-no-reply@computeserver). Can anyone point me to the place where universe_wsgi.ini is actually parsed and the config dictionary is filled? Holger On 08/03/2011 02:53 PM, Dannon Baker wrote: Holger, There isn't currently a galaxy-wide configuration for the from header address. Most places use frm = 'galaxy-noreply@%s' % host, where host is the fqdn of the box, as you've seen. I took a quick look, and it does look like everything that sends mail uses util.send_mail, so you could just modify that method to ignore the input frm parameter and immediately set it to frm = 'gal...@imb-mainz.de' and you should be good to go. -Dannon On Aug 3, 2011, at 4:52 AM, Holger Klein wrote: Hi all, for the email functionality of our local galaxy instance I'm forced to use SMTP authentication and to use a specific from, which is different to what galaxy generates automatically. Now galaxy generates a from like gal...@computeserver.imb.uni-mainz.de but I want to set this to gal...@imb-mainz.de. A quick check shows that the send_mail function defined in lib/galaxy/util/__init__.py is called in various places. Is there a way to set the from to a specific value? If not, it send_mail the only galaxy-function used to send mail? Cheers, Holger -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-dev] Bam to fastq
Hi Aaron, On 07/06/2011 04:45 PM, Zschunke, Aaron M. wrote: Is there any way to convert a certain section of a bam file to fastq using the galaxy tools? I just want to convert a certain part of the genome. Thanks. there is the bam_to_fastq tool on the toolshed (http://toolshed.g2.bx.psu.edu/) in the SAM subsection. Regards, Holger -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-dev] picard / srma index .loc
Hi Kelly, On 06/24/2011 08:40 PM, Kelly Vincent wrote: That particular tool uses a different loc file--all_fasta.loc, which is simply a list of fasta files with full path/name. Are your other Picard tools working? Let us know if you run into further issues. thank you. Now the indices show up, moreover the picard tools seem to work (didn't test the modules related to PAIRED data yet). One thing that doesn't work is the sorting in the SAM/BAM Alignment Summary Metrics module. When I turn off Assume the input file is already sorted, galaxy tries to sort the bam file first. Job state ends in green in the history, but the Picard Tool Run Log contains 'Exception in thread main net.sf.picard.PicardException: Cannot read non-existent file: /local/data/galaxy_files/000/dataset_248.dat.sorted at net.sf.picard.io.IoUtil.assertFileIsReadable(IoUtil.java:51)' (full log at the bottom). Looking in the respective directory there is the file dataset_248.dat.sorted.bam though. It looks like the picard wrapper expects that the .bam-suffix is not on the file. Regards, Holger ---%--- INFO:root:## executing samtools sort /local/data/galaxy_files/000/dataset_248.dat /local/data/galaxy_files/000/dataset_248.dat.sorted returned status 0 and nothing on stderr INFO:root:## executing java -Xmx4g -jar /local/data/home/galaxy/galaxy-dist/tool-data/shared/jars/CollectAlignmentSummaryMetrics.jar VALIDATION_STRINGENCY=LENIENT ASSUME_SORTED=false ADAPTER_SEQUENCE= IS_BISULFITE_SEQUENCED=false MAX_INSERT_SIZE=10 OUTPUT=/local/data/home/galaxy/galaxy-dist/database/job_working_directory/220/dataset_254_files/CollectAlignmentSummaryMetrics.metrics.txt R=/local/data/home/galaxy/galaxy-dist/database/job_working_directory/220/dataset_254_files/hg19full.fa_fake.fasta TMP_DIR=/tmp INPUT=/local/data/galaxy_files/000/dataset_248.dat.sorted returned status 1 and stderr: [Mon Jun 27 12:04:54 CEST 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=10 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTCGTATGCCGTCTTCTGCTTG, IS_BISULFITE_SEQUENCED=false] INPUT=/local/data/galaxy_files/000/dataset_248.dat.sorted OUTPUT=/local/data/home/galaxy/galaxy-dist/database/job_working_directory/220/dataset_254_files/CollectAlignmentSummaryMetrics.metrics.txt REFERENCE_SEQUENCE=/local/data/home/galaxy/galaxy-dist/database/job_working_directory/220/dataset_254_files/hg19full.fa_fake.fasta ASSUME_SORTED=false TMP_DIR=/tmp VALIDATION_STRINGENCY=LENIENT IS_BISULFITE_SEQUENCED=false STOP_AFTER=0 VERBOSITY=INFO QUIET=false COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=50 CREATE_INDEX=false CREATE_MD5_FILE=false [Mon Jun 27 12:04:54 CEST 2011] net.sf.picard.analysis.CollectAlignmentSummaryMetrics done. Elapsed time: 0.00 minutes. Runtime.totalMemory()=2058027008 Exception in thread main net.sf.picard.PicardException: Cannot read non-existent file: /local/data/galaxy_files/000/dataset_248.dat.sorted at net.sf.picard.io.IoUtil.assertFileIsReadable(IoUtil.java:51) at net.sf.picard.analysis.SinglePassSamProgram.makeItSo(SinglePassSamProgram.java:65) at net.sf.picard.analysis.SinglePassSamProgram.doWork(SinglePassSamProgram.java:54) at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:158) at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:118) at net.sf.picard.analysis.CollectAlignmentSummaryMetrics.main(CollectAlignmentSummaryMetrics.java:106) ---%--- Thanks, Kelly On Fri Jun 24, at 7:44 AM, Holger Klein wrote: Dear all, I have a problem setting up the reference genomes for picard. They simply do not show up. I used revision 8c11dd28a3cf of galaxy-dist and just today switched to 720455407d1c, problem still exists. My picard_index.loc contains the following lines: hg19fullhg19hg19 Full /home/galaxy/galaxy-data/index_files/hg19/picard_index/hg19full.fa hg18fullhg18hg18 Full /home/galaxy/galaxy-data/index_files/hg18/picard_index/hg18.fa mm9fullmm9mm9 Full /home/galaxy/galaxy-data/index_files/mm9/picard_index/mm9.fa The respective files are also there (fa and fa.fai are links to the respective files in other dirs): /home/galaxy/galaxy-data/index_files/hg19/picard_index/hg19full.dict /home/galaxy/galaxy-data/index_files/hg19/picard_index/hg19full.fa /home/galaxy/galaxy-data/index_files/hg19/picard_index/hg19full.fa.fai Now, using e.g. the SAM/BAM Alignment Summary Metrics module from Picard, I can't choose a reference genome (no matter if it's use assigned ref genome or select a different built-in genome). It doesn't seem to be a problem of formatting or file
[galaxy-dev] SMTP auth in galaxy?
Dear all, for our galaxy setup I have to use an SMTP server which requires authentication. Since I didn't find any documentation about galaxy's capabilities in that regard, I'd like to ask you either for pointers or a hint, if and how this can be handled. For the smtp_server variable in universe_wsgi.ini I saw that people used either a hostname or the path to a sendmail binary. Is something like user:p...@smtpserver.organisation.org possible as well? Cheers, Holger -- Dr. Holger Klein Core Facility Bioinformatics Institute of Molecular Biology gGmbH (IMB) http://www.imb-mainz.de/ Tel: +49(6131) 39 21511 ___ Please keep all replies on the list by using reply all in your mail client. To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
