a second page.
\setupxtable[width=4cm,option={stretch,width}]
\setupxtable[split=yes]
\starttext
\placetable[here]{}
\startxtable
\startxrow
\startxcell cell one \stopxcell
\startxcell cell two \stopxcell
\startxcell cell three\stopxcell
\stopxrow
... and so on and so forth for twenty or so
I cannot understand why my xtable setup does not split to the next page.
As far as I can see I have it set up correctly... though obviously not!
What might be wrong? Below is a sample. In the real case the number of
rows would demand a second page.
\setupxtable[width=4cm,option={stretch,width
right.
You're joking right? SInce when can one not set up something in some
context subsystem? Why would I make a table mechanism with no presets?
\starttext
\setupxtable[suffix][align=middle,foregroundcolor=red]
\setupxtable[blabla][foregroundstyle=slanted]
\setupxtable[crap] [foregroundcolor
>
> > My first try with extreme tables looked like this:
> >
> > == Example
> ========
> > \definecolor[tablebackground][r=.8,g=.8,b=.8]
> > \setupxtable[background=color,frame=off]
> > \setupxtable[row][odd][backgroundcolor=tablebackground]
>
with extreme tables looked like this:
== Example
\definecolor[tablebackground][r=.8,g=.8,b=.8]
\setupxtable[background=color,frame=off]
\setupxtable[row][odd][backgroundcolor=tablebackground]
== End of Example
e effect with extreme tables?
>
> My first try with extreme tables looked like this:
>
> == Example
>
> \definecolor[tablebackground][r=.8,g=.8,b=.8]
> \setupxtable[background=color,frame=off]
> \setupxta
this:
== Example
\definecolor[tablebackground][r=.8,g=.8,b=.8]
\setupxtable[background=color,frame=off]
\setupxtable[row][odd][backgroundcolor=tablebackground]
== End of Example =
That didn't
t always run into "runaway error: end of file encountered"
whenever the xtable-commands are in there.
\definextable[icbtable]
\setupxtable[icbtable]
[frame=off,
top=\vskip7mm]
\long\def\iconblock[#1]#2{%
\ignorespaces
a \setups)
> but always run into "runaway error: end of file encountered"
> whenever the xtable-commands are in there.
>
> \definextable[icbtable]
> \setupxtable[icbtable]
> [frame=off,
> top=\vskip7mm]
> \long\def\iconblock[#1]#2{%
> \ignorespaces
> \startxtabl
Hello everyone,
I'm trying to create an xtable from within a \def (or within a \setups)
but always run into "runaway error: end of file encountered"
whenever the xtable-commands are in there.
\definextable[icbtable]
\setupxtable[icbtable]
[frame=off,
top=\vskip7mm]
o any header,
floats or the like - and I don't see yet how I can get this working in
my situation. Any help is highly appreciated, here is a MWE of my problem:
\definextable[mytable]
\setupxtable[mytable]
[
option=max,
split=repeat,
%split=yes,
header=repeat,
width=\textwidth
]
\definextable[mytable:
; prefix=no,
> align={flushleft,nothyphenated},
> way=bytext]
> \setupcaption[table][location=top]
>
> \setupthinrules[width=15em] % width of horizontal rules
>
> \setupxtable[frame=off,option=stretch,bodyfont=small,foregroundstyle=
~}]
\setupcaptions[style={\sans\small},
width=max,
prefix=no,
align={flushleft,nothyphenated},
way=bytext]
\setupcaption[table][location=top]
\setupthinrules[width=15em] % width of horizontal rules
\setupxtable[frame=off,option=stretch,bodyfont=small
in the \startxtablefoot
...\stopxtablefoot, i.e., I need one command for the last element, and
one for the rest (Or is there a better way?). What would be the
everything but the last?
What am I missing?
Thanks again,
Denis
==
\setupxtable[frame=off,split=yes]
\setupxtable[head][topframe
e can put the table in a float
environment and disable the caption and counter.
\startplacetable[location={force,none}]
\startembeddedxtable
...
\stopembeddedxtable
\stopplacetable
Many thanks for your reply, Wolfgang.
These are my defaults for tables in the document:
\setupxtable
[f
environment and disable the caption and counter.
>
> \startplacetable[location={force,none}]
> \startembeddedxtable
> ...
> \stopembeddedxtable
> \stopplacetable
Many thanks for your reply, Wolfgang.
These are my defaults for tables in the document:
\setupxtable
eing typeset in a horizontal context,
> based on the error message (at least, if we assume that the error
> message was triggered by a table).
I think it is easy to trigger the error:
\setupxtable[split=yes]
\starttext
\ifvmode yes\else no\fi
\startxtable[align={middle,
On 8/13/20 1:16 PM, Taco Hoekwater wrote:
>> On 13 Aug 2020, at 13:07, Pablo Rodriguez wrote:
>> [...]
>> I get the following error message (that breaks compilation) when I add
>> \setupxtable[split=yes]:
>>
>> You can't use '\prevdepth' in restricted hori
> On 13 Aug 2020, at 13:07, Pablo Rodriguez wrote:
>
> Dear list,
>
> in order to avoid a problem already reported
> (https://mailman.ntg.nl/pipermail/dev-context/2020/003694.html), I added
> to an indiviual table \startxtable[split=yes] (being the default in the
> doc
Dear list,
in order to avoid a problem already reported
(https://mailman.ntg.nl/pipermail/dev-context/2020/003694.html), I added
to an indiviual table \startxtable[split=yes] (being the default in the
document \setupxtable[split=repeat, header=repeat]).
But I’m experiencing a weird issue
edtext[width=6cm,style=mono]
>> \sethyphenationfeatures[dna]
>> \setuphyphenation[method=traditional]
>> GATTGCTTACTCCTGGTTGG%
>> TCTTACATTCTGTCGCCTC%
>> CTACTAGAGCCGGCATATT%
>> CTAG
\define[1]\DNAspacer{#1\hskip 2.3pt plus .1pt}
\define[2]\mycommandc{
\startxrow
\startxcell o#1 \stopxcell
\startxcell {\tt\WORD{\DNA{5'-#2}}}\stopxcell
\stopxrow
}
\starttext
\setupxtable[width=5cm]
\startxtable
\my
\setupxtable[width=5cm]
\startxtable
\mycommandc{C}{GATTGCTTACTCCTGGTTGGTCTTACATTCTGTCGCCTCCTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGGCCTAGGGCACCATCGCGTACGAGGGCAATGAGTTTACCGCTGCGAAGTCTCTACGTCACGGCCAACCACAGTCCTGCTCCCAACGAAATTTAGACGCTGTCGTGAAACCTGAATTCGAGGATAAGCCGCGTCATGAAGAGTCTACTG}
\stopxtable
\stopxrow
}
\define[2]\mycommandc{
\startxrow
\startxcell o#1 \stopxcell
\startxcell 5'-\tt\WORD #2 \stopxcell
\stopxrow
}
\definebreakpoint[mybreaks][][nright=12,nleft=12,type=1]
\setbreakpoints[mybreaks]
\starttext
\setupxtabl
> the
> >>> rounded corners to put the key corner = round, but it does not work.
> >>
> >> 1. To create a new framed-instance you need \defineframe, \setupframed
> isn't
> >> enough to set the values.
> >>
> >> I guess you assumed th
, but it does not work.
1. To create a new framed-instance you need \defineframe, \setupframed isn't
enough to set the values.
I guess you assumed this works similar to xtables but this mechanism sets
a few values to assure \setupxtable is enough in certain cases but even here
you need \definextable
rk.
>
> 1. To create a new framed-instance you need \defineframe, \setupframed isn't
> enough to set the values.
>
>I guess you assumed this works similar to xtables but this mechanism sets
> a few values to assure \setupxtable is enough in certain cases but even here
&g
the values.
I guess you assumed this works similar to xtables but this mechanism
sets a few values to assure \setupxtable is enough in certain cases but
even here you need \definextable in certain cases.
When you create a new instance you have to use the name of the new
instance as command
ting "split" in the setupfloat and
"header=repeat" in the setupxtable gives me a table with repeated
headers that starts exactly where I want it to start. Apparently in this
case, the "headers=repeat" is necessary. Unfortunately, I need a company
logo up in the page header, whic
header by a normal text
suddenly solves the problem: putting "split" in the setupfloat and
"header=repeat" in the setupxtable gives me a table with repeated
headers that starts exactly where I want it to start. Apparently in this
case, the "headers=repeat" is necess
to "split=repeat" in the setupxtable gives me
repeating headers, but the table starts at the second page, leaving the
first page with only the text line and all the rest as blank spaces.
- Placing the table in a float by activating the 3 commented lines gives
me an error ("extr
is is the standard and intended behavior (documented on page 10 from
xtables-mkiv.pdf).
> - Changing "split=yes" to "split=repeat" in the setupxtable gives me
> repeating headers, but the table starts at the second page, leaving the
> first page with only the text line and
Hello,
Code below shows some behaviour I cannot explain (csv file attached):
- If I run the code below as is, I get what I want, except that the
header line of the table does not repeat at the top of each page.
- Changing "split=yes" to "split=repeat" in the setupxtabl
ll[left] \cC \stopxcell
>> \startxcell[left] \cD \stopxcell
>> \startxcell \cE \stopxcell
>> \startxcell[left] \cF \stopxcell
>> \startxcell \cG \stopxcell
>> \startxcell \cH \stopxcell
>> \doifdefined{cI}{\startxcell \cI \stopxcell}
>> \doifdefined{cJ}
\cF \stopxcell
\startxcell \cG \stopxcell
\startxcell \cH \stopxcell
\doifdefined{cI}{\startxcell \cI \stopxcell}
\doifdefined{cJ}{\startxcell \cJ \stopxcell}
\doifdefined{cK}{\startxcell [left] \cK \stopxcell}
\stopxrow
\stopbuffer
\setupxtable[offset=0cm,
frame=off,
bottomframe=on,
framecolor=gray
cH \stopxcell
\doifdefined{cI}{\startxcell \cI \stopxcell}
\doifdefined{cJ}{\startxcell \cJ \stopxcell}
\doifdefined{cK}{\startxcell [left] \cK \stopxcell}
\stopxrow
\stopbuffer
\setupxtable[offset=0cm,
frame=off,
bottomframe=on,
framecolor=gray,
option=stretch,
align=middle]
\setu
[rulethickness=...]
\setupparagraphs[rulethickness=...]
\setupsidebar[rulethickness=...]
\setuptables[rulethickness=...]
\setuptabulation[rulethickness=...]
\setuptextbackground[rulethickness=...]
\setuptextrules[rulethickness=...]
\setupthinrules[rulethickness=...]
\setupxtable[rulethickness
\startxcell xxx \stopxcell
\startxcell xxx \stopxcell
\stopxrow
\stopxtable
\stopframedtext
\stoptext
2. Why do you try to split a table in a makup environment (which will
never work)?
\setupxtable[split=yes] is a general setup for the whole document.
I mean
ehmode is required to center the table when
\startmakeup[standard][align=center].
> 2. Why do you try to split a table in a makup environment (which will
> never work)?
\setupxtable[split=yes] is a general setup for the whole document.
I mean, I don’t want a table in the document to be st
Pablo Rodriguez schrieb am 18.10.2019 um 16:23:
Dear list,
I have another issue related to extreme tables.
\setupxtable[split=yes]
\starttext
\startmakeup[standard]
\dontleavehmode
\startxtable[align={middle,lohi},columndistance=0em]
\startxrow
Dear list,
I have another issue related to extreme tables.
\setupxtable[split=yes]
\starttext
\startmakeup[standard]
\dontleavehmode
\startxtable[align={middle,lohi},columndistance=0em]
\startxrow
\startxcell
Fabrice Couvreur schrieb am 23.09.2019 um 16:12:
Hello,
I can not change the font size of my figures in the table.
\startxcell[foregroundstyle={\switchtobodyfont[...]}]
or
\setupxtable[smallbodyfont][foregroundstyle={\switchtobodyfont[...]}]
\startxcell[smallbodyfont]
Wolfgang
ven more than two passes
I guess to be handy to implement both \setupTABLE[c][...] and
\setupxtable[c][...] in a similar way, especially when there is a simple
mechanism which allows TABLE/xtable switching (ntb-to-xtb module).
it would
th) specification(s), if provided, and keep on reading xcell
specification(s), considering xcell width, if provided.
I guess to be handy to implement both \setupTABLE[c][...] and
\setupxtable[c][...] in a similar way, especially when there is a simple
mechanism which allows TABLE/xtable swi
xtablerow,j=\currentxtablecolumn}]
14
15 \setupxtable[background=tablebackground]
16
17 \starttext
18 \startluacode
19 local letters_1 = { "A", "B", "C", "D", "E", "F", "G", "H", "I", "
background]
[\useMPgraphic{tablebackground}{i=\currentxtablerow,j=\currentxtablecolumn}]
\setupxtable[background=tablebackground]
>
> \definecolor[fondpaille][c=0,m=0,y=0.2,k=0]
>
> \startuseMPgraphic {tablebackground}
> fill OverlayBox withcolor \MPcolor{fondpaille}
layBox withcolor \MPcolor{fondpaille} ;
\stopuseMPgraphic
\defineoverlay
[tablebackground]
[\ifnum\currentxtablerow=1
\useMPgraphic{tablebackground}%
\else\ifnum\currentxtablecolumn=1
\useMPgraphic{tablebackground}%
\fi\fi]
\setupxtable[background=tablebackground]
\sta
Am 2018-10-12 um 17:20 schrieb Tomas Hala :
# >#
# ># > Hi all,
# ># >
# ># > at https://wiki.contextgarden.net/Tables_Overview is mentioned that
# ># > the xtables can be splitted even horizontally (which will just suit
# ># > me very well).
# ># >
# ># &g
t; me very well).
# >
# > The command \setupxtable[myxtable][split=yes] will do it only
# > vertically. I would like to ask what is the correct option for
# > the horizonal splitting; neither xtables manual, nor i-context.pdf
# > say anything.
# &g
:
#
# > Hi all,
# >
# > at https://wiki.contextgarden.net/Tables_Overview is mentioned that
# > the xtables can be splitted even horizontally (which will just suit
# > me very well).
# >
# > The command \setupxtable[myxtable][split=yes] will do it only
# > vertically.
Tomas Hala :
> Hi all,
>
> at https://wiki.contextgarden.net/Tables_Overview is mentioned that
> the xtables can be splitted even horizontally (which will just suit
> me very well).
>
> The command \setupxtable[myxtable][split=yes] will do it only
> vertically.
Hi all,
at https://wiki.contextgarden.net/Tables_Overview is mentioned that
the xtables can be splitted even horizontally (which will just suit
me very well).
The command \setupxtable[myxtable][split=yes] will do it only
vertically. I would like to ask what is the correct option
The wiki says I should ask again one week later if I did not get an answer.
Could someone please help me with my problem. Thanks.
On 8/26/18 6:03 PM, be ba wrote
> the wiki says for xtables and multipage "yes, even horizontally". How
> can I do that?
>
> Doing this:
>
On 8/29/2018 10:12 PM, Pablo Rodriguez wrote:
Hi Hans,
I have the following sample:
\definefontfeature[default][default]
[protrusion=quality]
\setupxtable[frame=off, option=stretch]
\startbuffer[standard]
¿Cómo?
¡No!
\stopbuffer
\startbuffer
Hi Hans,
I have the following sample:
\definefontfeature[default][default]
[protrusion=quality]
\setupxtable[frame=off, option=stretch]
\startbuffer[standard]
¿Cómo?
¡No!
\stopbuffer
\startbuffer[right]
\hfill¿Cómo?
\hfill¡No!
\stopbuffer
Hi,
the wiki says for xtables and multipage "yes, even horizontally". How
can I do that?
Doing this:
\setupxtable[split=yes]
is not enough since this only gives vertically splitting. Both
http://www.pragma-ade.com/general/manuals/xtables-mkiv.pdf and
http://wiki.contextgarden.net/
e in my example?
>> The commented lines below are wrong. Is there another way?
>
> Hi Hraban,
>
> I never used natural tables.
>
> The right approach would be:
>
>\setupxtable[headtable]
>[bottomframe={\ifnum\currentxtablerow = 6 on\fi},
>
er way?
Hi Hraban,
I never used natural tables.
The right approach would be:
\setupxtable[headtable]
[bottomframe={\ifnum\currentxtablerow = 6 on\fi},
topframe={\ifcase\currentxtablerow\or on\or on\else off\fi}]
I hope it helps,
Pablo
--
h
Hello again,
I’m trying xtables for the first time.
Is it possible to setup defined rows/columns like with natural tables, e.g. for
a header, like in my example?
The commented lines below are wrong. Is there another way?
\definextable[headtable] % table with repeated head
\setupxtable
?
Sincerely,
John Grasty
\setupfloat[table][before={\blank[2*big]}]
\setupxtable[frame=off]
\setupxtable[head][topframe=on,bottomframe=on]
\setupxtable[body][]
\setupxtable[foot][bottomframe=on]
\starttext
\input douglas
\startplacetable[title={Cost Overview}]
\startxtable
\startxtablehead[head
nd I need \ifcase and \ifodd.
I must admit that now I don’t understand what expansion actually is.
Many thanks for your help,
Pablo
>> Pablo Rodriguez 10. April 2018 um 19:18
>> Dear list,
>>
>> thanks to Wolfgang, I learnt to set conditional format in xtables,
In your example the argument for the align key is always empty which results
in the default alignment for a frame which put the content in the middle
of the box.
Wolfgang
Pablo Rodriguez <mailto:oi...@gmx.es>
10. April 2018 um 21:05
Dear list,
I have the following sample:
\setup
format in xtables, such
as in:
\setupxtable
[foregroundcolor={\ifnum\currentxtablecolumn=2 red\else green\fi}]
\starttext
\startxtable
\startxrow
\startxcell one \stopxcell
\startxcell two \stopxcell
\startxcell tree \stopxcell
\startxcell four \stopxcell
\stopxrow
\stopxtable
\stoptext
My qu
Dear list,
I have the following sample:
\setupxtable[mytable]
[option={stretch, height},
align={\ifcase\currentxtablerow\fi}]
\starttext
\startxtable[mytable]
\startxrow
\startxcell 1 \stopxcell
\startxcell 2 \stopxcell
Dear list,
thanks to Wolfgang, I learnt to set conditional format in xtables, such
as in:
\setupxtable
[foregroundcolor={\ifnum\currentxtablecolumn=2 red\else green\fi}]
\starttext
\startxtable
\startxrow
\startxcell one \stopxcell
\startxcell
,stretch}]
how would this translate into \setupxtable?
page 26 of the xtable manual ... you define tagged settings and can use
these tag for cells and rows
-
Hans Hagen | PRAGMA ADE
into \setupxtable?
Thomas
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage : http://www.pragma-ade.nl
.
>
> The description for the \startxcell command was written two years ago
> and nothing
> has changed since then but you have use the \setupxtable command to
> create a named setup.
Context does not "test" and silently ignores errors, unless they are
syntactically incorrect. S
ou have use the \setupxtable command to create
a named setup.
\setupxtable[emphasized][foregroundstyle=italic]
\starttext
\startxtable[width=4cm,height=4cm,align={middle,lohi}]
\startxrow
\startxcell
Default settings
\stopxcell
\startxcell[emphasized]
Nam
2
> \startxcell [...] [..,..=..,..] ... \stopxcell
> OPT OPT
> 1 NAME
> 2 nx=NUMBER
> ny=NUMBER
> nc=NUMBER
> nr=NUMBER
> inherits: \setupxtable
>
>
>
> On Fri, 05 Jan 2018 15:50:51 -0800
> "jdh" <dhen...@gmail.com>
According to i-context.pdf ($CONTEXTHOME/tex/context/interface/mkiv)
1 2
\startxcell [...] [..,..=..,..] ... \stopxcell
OPT OPT
1 NAME
2 nx=NUMBER
ny=NUMBER
nc=NUMBER
nr=NUMBER
inherits: \setupxtable
On Fri, 05 Jan 2018 15:50:51 -0800
"jdh&q
gt; >> \setupTABLE [r] [last] [bottomframe=on]
> > >> \startTABLE
> > >> \NC A \NC A \NC A \NC\NR
> > >> \NC B \NC B \NC B \NC\NR
> > >> \NC C \NC C \NC C \NC\NR
> > >> \NC D \NC D \NC D \NC\NR
> > >> \NC E \NC E
D \NC D \NC D \NC\NR
> >> \NC E \NC E \NC E \NC\NR
> >> \stopTABLE
> >> \stoptext
> >
> > it's also an extremely inefficient method
> >
> >> How can I do such a thing with Extreme Tables? If it is not yet
> >> possible I'd like
E \NC E \NC E \NC\NR
>> \stopTABLE
>> \stoptext
>
> it's also an extremely inefficient method
>
>> How can I do such a thing with Extreme Tables? If it is not yet possible
>> I'd like to request the
>> inclusion of such a mechanism.
> from the manual, name
an extremely inefficient method
How can I do such a thing with Extreme Tables? If it is not yet possible I'd
like to request the
inclusion of such a mechanism.
from the manual, named setups:
\setupxtable[suffix][align=middle,foregroundcolor=red]
\setupxtable[blabla][foregroundstyle=slanted]
\setupxtable
Thank you for your help so far.
Now I am close to what I'd like to achieve.
I want to insert a foot on every pages except on the
last page (at the end of the table). Is it possible?
I have this simple code:
\starttext
\setupxtable[split=repeat,header=repeat,footer=repeat]
\startxtable[frame
e habitant morbi tristique senectus et netus
>> \stopxcell
>> \startxcell Pellentesque \stopxcell
>> \stopxrow
>> \startxrow
>> \startxcell Donec nunc lorem, sollicitudin vel sodales eget
>> \stopxcell
>> \startxcell Donec nunc lor
\stopxcell
\startxcell Donec nunc lorem, sollicitudin vel sodales eget Donec nunc
lorem, sollicitudin vel sodales eget \stopxcell
\startxcell Donec \stopxcell
\stopxrow
\stopxtable
\stoptext
How can I fix this?
\setupxtable[one] [width=4cm]
\setupxtable[two] [width=5cm
Dear list,
I have the following sample:
\setupxtable[option={stretch}]
\setupxtable[beforeafter]
[before={\blank[big]},
after={\blank[big]}]
\starttext
\dorecurse{5}{\startembeddedxtable[beforeafter]
\startxrow
\startxcell first
lus 0.2ex]
\setupxtable[frame=off, boffset=0pt, toffset=0pt, rulethickness=0pt]
\starttext
Good\crlf
\startxtable
\startxrow \startxcell spacing \stopxcell \stopxrow
\startxrow \startxcell here. \stopxcell \stopxrow
\stopxtable
Unwanted\blank[depth]
\startxtable
\startxrow \startxcell
On 02/17/2016 04:22 PM, Wolfgang Schuster wrote:
> [...]
> \setupxtable[align=\ifcase\currentxtablecolumn\or flushright\else middle\fi]
Many thanks for your fast reply, Wolfgang.
This is exactly what I need. I wouldn’t have found out myself in centuries.
Many thanks for your help,
pxcell
\stopxrow
\startxrow
\startxcell[align=left] alpha \stopxcell
\startxcell[align=center] beta \stopxcell
\stopxrow
\stopxtable
\stoptext
I don’t know whether there is something similar to:
\setupxtable[column:first][align=left]
Having to add an identifier to the xcell is something that I woul
\startxcell[align=center] beta \stopxcell
\stopxrow
\stopxtable
\stoptext
I don’t know whether there is something similar to:
\setupxtable[column:first][align=left]
Having to add an identifier to the xcell is something that I would like
to avoid too.
Many than
]
\xmlflush{#1}
\stopxrow
\stopxmlsetups
\startxmlsetups xml:bilingualcell
\startxcell [width=0.4\textwidth,align=normal,ny=\xmlattdef{#1}{ny}{1}]
\xmlflush{#1}
\stopxcell
\stopxmlsetups
\setupxtable [Bilingual]
[option=stretch
into that later)
as i don't upload today you can test
\setupxtable[newtimes][foregroundstyle=\newtimes]
\startxcell[newtimes] ...\stopxcell
Many thanks for your fix, Hans.
It works perfect now.
Pablo
--
http://www.ousia.tk
do it for cells but so far other mechanisms were
less sensitive for this (we'd need an extension to luatex for handling
such cases ... maybe i'll look into that later)
as i don't upload today you can test
\setupxtable[newtimes][foregroundstyle=\newtimes]
\startxcell[newtimes
Dear list,
I have the following sample:
\setupxtable[frame=on, option=stretch]
\setupxtable[name][foregroundstyle=\bfc, ny=3, align=lohi]
\setupxtable[cv][foregroundstyle=\em, ny=2, align=bottom]
\setupxtable[contact][foregroundstyle=\em, align=flushright]
\starttext
\startxtable
\startxrow
to
remove them.
There is something I do not understand and I hope you can explain this. The
table is typeset by the \xmlflush{#1} in the table macro:
\startxmlsetups xmlcommon:table
Z\bgroup
\setupxtable[% Setup defaults
leftmargindistance=0pt,rightmargindistance=0pt,
offset=2pt,height=fit
\setupxtable[% Setup defaults
leftmargindistance=0pt,rightmargindistance=0pt,
offset=2pt,height=fit,width=fit,
align={center,lohi},columndistance=0pt]
\setupxtableparameters{#1}
\startlocationbox{#1}
\removeunwantedspaces
\startembeddedxtable X\xmlflush{#1}Y\stopembeddedxtable
\ignorespaces
\startxmlsetups xmlcommon:table
\bgroup
\setupxtable[% Setup defaults
leftmargindistance=0pt,rightmargindistance=0pt,
offset=2pt,height=fit,width=fit,
align={center,lohi},columndistance=0pt]
\setupxtableparameters{#1}
\startlocationbox{#1}
\startembeddedxtable
\xmlflush{#1}
\removeunwantedspaces
Am 24.05.2015 um 18:01 schrieb Meer, H. van der h.vanderm...@uva.nl:
Defined as follows:
\def\setupxtableparameters#1{% #1 is the node
\setupframeparameters{#1}{\setupxtable}%
\setupToAttribute{#1}{\setupxtable}{foregroundstyle}{style}{style}{\tf}%
\setupToAttribute{#1}{\setupxtable
}{lohi}%
}
% Setups for tables with xtable.
\def\setupxtableparameters#1{%
\setupframeparameters{#1}{\setupxtable}%
\setupToAttribute{#1}{\setupxtable}{foregroundstyle}{style}{style}{\tf}%
\setupToAttribute{#1}{\setupxtable}{offset}{cellpadding}{}{0pt}%
\setupToAttribute{#1}{\setupxtable
Defined as follows:
\def\setupxtableparameters#1{% #1 is the node
\setupframeparameters{#1}{\setupxtable}%
\setupToAttribute{#1}{\setupxtable}{foregroundstyle}{style}{style}{\tf}%
\setupToAttribute{#1}{\setupxtable}{offset}{cellpadding}{}{0pt}%
\setupToAttribute{#1}{\setupxtable}{columndistance
On 11/16/2014 8:53 PM, Idris Samawi Hamid ادريس سماوي حامد wrote:
Dear gang,
In the following, we middle align both \placetable's:
\setupbodyfont[tt]
\definefont[ALM][file:almfixed.otf*arabic at 12pt]
\setupdirections[bidi=global]
\setupxtable[width=1in]
\showframe
don’t know how you could make it work with TABLE, but your macro seems
to work with xtables:
\setupbodyfont[tt]
\definefont[ALM][file:almfixed.otf*arabic at 12pt]
\setupdirections[bidi=global]
\define\NCD{\stopxcell\startxcell\righttoleft}
\setupxtable[width=1in]
\starttext
Dear gang,
In the following, we middle align both \placetable's:
\setupbodyfont[tt]
\definefont[ALM][file:almfixed.otf*arabic at 12pt]
\setupdirections[bidi=global]
\setupxtable[width=1in]
\showframe
\starttext
\startalignment[middle]
\ALM
\placetable[middle,none
to work with xtables:
\setupbodyfont[tt]
\definefont[ALM][file:almfixed.otf*arabic at 12pt]
\setupdirections[bidi=global]
\define\NCD{\stopxcell\startxcell\righttoleft}
\setupxtable[width=1in]
\starttext
\ALM
\placetable[right,none]{}
{\startxtable
in test-style.tex)
\setupxtable [split=yes,
spaceinbetween=medium]
for the xtable environment, I get an error:
tex errorerror on line 22 in file
/mnt/shared/context/tex/texmf-context/tex/context/base/cont-yes.mkiv: !
You can't use `\prevdepth' in horizontal mode
Hello everyone,
I'm using ConTeXt to write a technical manual and I'm facing with some
strange behavior I don't know how to overcome.
I need a multipage table and I'm using the xtables. This is a (stripped
down) version of a part of my document:
\mainlanguage [en]
\setupxtable
[externaldocs
, how can I make that the first column are aligned to the right?
\setupxtable[xcell][1][align=right] doesn't seem to work.
Many thanks for your help,
Pablo
--
http://www.ousia.tk
___
If your question is of interest
1 - 100 of 115 matches
Mail list logo
