rtparagraphs
Command/ startparallel
Command/ startplacefloat
Command/ startplacepairedbox
Command/ startsection
Command/ startsectionblock
Command/ startstartstop
Command/ startstop
Command/ startstyle
Command/ starttabulate
Command/ starttextbackground
Command/ starttyping
Command/ startviewerlayer
{...} or \bgoup ...\egroup as second
mandatory argument, in your case you has been lucky because \startxtable
has an \bgroup in its definition but you shouldn't rely on this.
Wolfgang
___
If your question
a second page.
\setupxtable[width=4cm,option={stretch,width}]
\setupxtable[split=yes]
\starttext
\placetable[here]{}
\startxtable
\startxrow
\startxcell cell one \stopxcell
\startxcell cell two \stopxcell
\startxcell cell three\stopxcell
\stopxrow
... and so on and so forth for twenty or so
}]
\setupxtable[split=yes]
\starttext
\placetable[here]{}
\startxtable
\startxrow
\startxcell cell one \stopxcell
\startxcell cell two \stopxcell
\startxcell cell three\stopxcell
\stopxrow
... and so on and so forth for twenty or so rows, but certainly enough
to require a second page
Math Modus?
Ursula Hermann via ntg-context mailto:ntg-context@ntg.nl>>
于2023年3月21日周二 20:45写道：
I’d like to do a Table lik this one
[enter image description here]
I have no example. How can I do that?
You can use xtable, e.g.
\startxtable[frame=off,width=1cm,align=center]
\startxrow[botto
Ursula Hermann via ntg-context 于2023年3月21日周二 20:45写道：
>
>
> I’d like to do a Table lik this one
>
> [image: enter image description here]
>
> I have no example. How can I do that?
>
>
>
You can use xtable, e.g.
\startxtable[frame=off,width=1cm,align=center]
\startx
\eTR
\bTR \bTD One \eTD \bTD two \eTD \eTR
\eTABLE
\stopplacetable
% \startpostponingnotes
\startplacetable
\startxtable
\startxrow
\startxcell a\footnote{5}\stopxcell
\startxcell b\footnote{6}\stopxcell
\stopxrow
\stopxtable
\stopplacetable
% \stoppostponingnotes
\stoptext
\NC\NR
\stoptabulate
\stopplacetable
\startplacetable
\bTABLE
\bTR \bTD One\footnote{4} \eTD \bTD two \eTD \eTR
\bTR \bTD One \eTD \bTD two \eTD \eTR
\eTABLE
\stopplacetable
% \startpostponingnotes
\startplacetable
\startxtable
\startxrow
\startxcell a\footnote{5}\stopxcell
\startxcell b\footnote
On 12/22/2022 9:14 PM, Rik Kabel via ntg-context wrote:
With the latest (2022-12-21) LMTX I see a regression in xtables. The
following code:
\starttext
\startxtable
\startxrow
\startxcell
This is a line of text.
\stopxcell
\startxcell
With the latest (2022-12-21) LMTX I see a regression in xtables. The
following code:
\starttext
\startxtable
\startxrow
\startxcell
This is a line of text.
\stopxcell
\startxcell
\contextversion
\stopxcell
\stopxrow
txcell {"width=1.5cm","align=flushright"}
context(Eleve[note])
context("/")
context(notemax)
context.stopxcell ()
end
\stopluacode
\startbuffer [grille]
\startxtable
\startxrow
\startxcell
\ct
context(Eleve[note])
context("/")
context(notemax)
context.stopxcell ()
end
\stopluacode
\startbuffer [grille]
\startxtable
\startxrow
\startxcell
\ctxlua {userdata.Critere ("structure","NoteStructure"
lly so the text is vertically centered just in
> specific rows?
Hi Joel,
I have no experience with tabulates, but I wouldn’t be surprised if they
didn’t support vertical alignment.
You can achieve that with xtables:
\starttext
\startxtable[frame=off, option={stretch, width}]
\startxrow[topfra
one marked row. By
default, they seem to place each cell aligned to the top, but how can I
adjust them vertically so the text is vertically centered just in
specific rows?
Use natural or extreme tables.
\starttext
\startxtable[frame=off,topframe=on,bottomframe=on]
\startx
starttext
\showframe
\startbuffer
row\currentxtablerow--col\currentxtablecolumn
\stopbuffer
\startbuffer[table]
\startxtable[option={stretch, height}, align={lohi, middle}]
\startxrow
\dorecurse{5}
{\startxcell[width=.115\textwidth]\inlinebuffer\
wframe
\startbuffer
row\currentxtablerow--col\currentxtablecolumn
\stopbuffer
\startbuffer[table]
\startxtable[option={stretch, height}, align={lohi, middle}]
\startxrow
\startxcell[width=3cm, option=fixed]\inlinebuffer\stopxcell
\dorecurse{5}
{\star
=blue]
\setupxtable[bold] [crap][foregroundstyle=bold]
\startxtable[frame=off]
\startxtablehead
\startxrow[bold]
\startxcell[suffix] a 0 \stopxcell
\startxcell[blabla] a 1 \stopxcell
\startxcell a 2 \stopxcell
\stopxrow
Am 30.06.22 um 08:40 schrieb Angel M Alganza via ntg-context:
Hello, Hans,
On Thu, Jun 30, 2022 at 08:16:53AM +0200, Hans Hagen via ntg-context wrote:
\startxtable[option=stretch]
\startxrow
\startxcell[width=3cm,option=fixed] one \stopxcell
Thank you very much, that does part
Hello, Hans,
On Thu, Jun 30, 2022 at 08:16:53AM +0200, Hans Hagen via ntg-context wrote:
\startxtable[option=stretch]
\startxrow
\startxcell[width=3cm,option=fixed] one \stopxcell
Thank you very much, that does part of the trick (the column width).
Is there a way to do the same
t possible to have ConTeXt do all those calculations for me?
I haven't been able to figure it out from the manuals and the wiki.
\starttext
\startxtable[option=stretch]
\startxrow
\startxcell[width=3cm,option=fixed] one \stopxcell
\startxcell two \stopxcell
\startxcell three
extgarden.net/Command/_starttyping>) says there are
> > some dedicated commands, e.g. \startXML and \startPARSEDXML. How do
> > they differ?
>
> Hi Denis,
>
> yesterday I had to start using xml instead of parsed-xml.
>
> See the difference:
>
> \setu
\startPARSEDXML. How do they
> differ?
Hi Denis,
yesterday I had to start using xml instead of parsed-xml.
See the difference:
\setuppapersize[A4, landscape]
\setupbodyfont[dejavu]
\starttext
\startxtable[option=stretch]
\startxrow[offset=1ex]
\startxcell
\startXML
; \starttext
> \startitemize
> \item
> Determine la {\sc an} de cada objetivo del microscopio, con los ángulos
> de la tabla y teniendo en cuenta lo siguiente: $n_{\text{aire}} = 1$ y
> $n_{\text{aceite de inmersión}} = 1.515$:
> \blank
> \startxtable[align=middle,option=stretch]
}} = 1$ y
$n_{\text{aceite de inmersión}} = 1.515$:
\blank
\startxtable[align=middle,option=stretch]
\startxtablebody[body]
\startxrow
\startxcell Objetivo 4x \stopxcell
\startxcell $n=1$ \stopxcell
\startxcell $\alpha=5.8$ \stopxcell
\startxcell {\sc an}$=$ \stopxcell
\stopxrow
> fill OverlayBox withcolor "gray";
> \stopuseMPgraphic
>
> \defineoverlay
>[xtablerow]
>[\ifodd\currentxtablerow
> \useMPgraphic{xtablerow}%
> \fi]
>
> \starttext
>
>
[\ifodd\currentxtablerow
\useMPgraphic{xtablerow}%
\fi]
\starttext
\startxtable[frame=off,background=xtablerow]
\dorecurse{20}
{\startxrow
\startxcell Column 1 \stopxcell
\startxcell Column 2 \stopxcell
\stopxrow}
\stopxtable
\stoptext
xtables :
\startxtable[split=repeat,header=repeat]
\startxtablehead
...
\stopxtablehead
\startxtablebody
.
.
.
\stopxtablebody
the table rows get split into different pages, but the columns get
cut at the right edge of the page.
Is there a way to split the columns as well (repeating
Hi,
I have a table with around 120 rows and 120 columns which fits an A0 paper. I
want it to be split so that it fits A4 sized papers.
When I tried using xtables :
\startxtable[split=repeat,header=repeat]
\startxtablehead
...
\stopxtablehead
\startxtablebody
.
.
.
\stopxtablebody
Hi,
I have a table with around 120 rows and 120 columns which fits an A0
paper. I want it to be split so that it fits A4 sized papers.
When I tried using xtables :
\startxtable[split=repeat,header=repeat]
\startxtablehead
...
\stopxtablehead
\startxtablebody
.
.
.
\stopxtablebody
On 6/8/2021 9:11 AM, Ajith R wrote:
Hi,
I have a table with around 120 rows and 120 columns which fits an A0 paper. I
want it to be split so that it fits A4 sized papers.
When I tried using xtables :
\startxtable[split=repeat,header=repeat]
\startxtablehead
...
\stopxtablehead
Hi,
I have a table with around 120 rows and 120 columns which fits an A0
paper. I want it to be split so that it fits A4 sized papers.
When I tried using xtables :
\startxtable[split=repeat,header=repeat]
\startxtablehead
...
\stopxtablehead
\startxtablebody
.
.
.
\stopxtablebody
t always run into "runaway error: end of file encountered"
whenever the xtable-commands are in there.
\definextable[icbtable]
\setupxtable[icbtable]
[frame=off,
top=\vskip7mm]
\long\def\iconblock[#1]#2{%
\ignorespaces
a \setups)
> but always run into "runaway error: end of file encountered"
> whenever the xtable-commands are in there.
>
> \definextable[icbtable]
> \setupxtable[icbtable]
> [frame=off,
> top=\vskip7mm]
> \long\def\iconblock[#1]#2{%
> \ignorespaces
> \startxtabl
\long\def\iconblock[#1]#2{%
\ignorespaces
\startxtable[icbtable]
\startxrow
\startxcell[width=17mm]
\externalfigure[img/#1.svg][height=15mm,width=15mm]
\stopxcell
\startxcell #2 \stopxcell
\stopxrow
\stopxtable
\removeunwantedspaces
}
Is this simply not possible or
header]
\setupxtable[mytable:header]
[
foregroundstyle=\bf,
foregroundcolor=darkred,
]
% ==
\startdocument
\dorecurse{2} {
\input tufte
\vskip7mm
}
\startxtable[mytable]
\startxtablehead
\startxrow[mytable:header]
\startxcell Some Header \stopxcell
\st
arrowed so much as to
break a line of 4 or 5 words. MWE:
%
\startplacetable[location=none]
%\startxtable[align={middle,lohi},option=tight] % This makes the first
column too narrow. Lines are not that long
\startxtable[align={middle,lohi}]
\startxtablehead[head]
\startxrow
\startx
Hi,
I seem to have seen a method for hatching the cell of a table, but maybe
it's my imagination. The following code does not work.
Thanks for your help.
Fabrice
## hatching.tex #
\setupcolors[state=start]
\usemodule[xwi]
\starttext
\startxtable
[align={lohi
all]\emph{Fuente:}~#1\par\stop}
>
> \starttext
> \reference[tbl:t03]{}%
> \startplacetable[title={Composición química y valor energético de recursos
> forrajeros de corte en el área de influencia del Subproyecto Carne Bovina
> (trópico de altura).}]
> \startxtable[option=tight,bodyfo
On Tue, 10 Nov 2020, Sylvain Hubert wrote:
> Indeed. Thanks for the information!
>
> For the record, this is how the problem is finally solved:
>
> \setuphead[section][after={\blank[sampage]}]
> \begingroup\setupindenting[no]\dontleavehmode\startxtable …
> \stopxt
\par\stop}
\starttext
\reference[tbl:t03]{}%
\startplacetable[title={Composición química y valor energético de recursos
forrajeros de corte en el área de influencia del Subproyecto Carne Bovina
(trópico de altura).}]
\startxtable[option=tight,bodyfont=7pt]
\startxtablehead[head]
\startxrow
amepage]\hskip 0pt}]
> > \starttext
> > \showframe
> > \dorecurse{50}{a }
> > \startsection[title=spec]
> > \startxtable
>
>
> What happens when you \hskip is that you switch to horizontal
> mode and the preferred to do this is to use
Sylvain Hubert schrieb am 10.11.2020 um 19:11:
Weirdly enough, "\hskip 0pt" solves the problem.
\setuphead[section][after={\blank[samepage]\hskip 0pt}]
\starttext
\showframe
\dorecurse{50}{a }
\startsection[title=spec]
\startxtable
What happens when
gt; because the optional argument is for userdata (values like author etc.)
>
> > \startxtable
> > \startxrow
> > \startxcell[ny=30]a\stopxcell\startxcell 1\stopxcell
> > \stopxrow
> > \dorecurse{29}{\startxrow\startxcell 2\stopxcell\s
,big]},
after={\blank[samepage,big]}]
Your settings in the second argument of \startsection make no sense
because the optional argument is for userdata (values like author etc.)
\startxtable
\startxrow
\startxcell[ny=30]a\stopxcell\startxcell 1\stopxcell
\stopxrow
testpage[4]\blank[2*big]}]
>
> Wolfgang
>
Hi Wolfgang,
Thanks for the suggestion, but as illustrated by the second example, copied
here, where the section title is at the top of the page:
\starttext
\showframe
\dorecurse{50}{a }
\startsection[title=spec][before={\blank[preferenc
dorecurse{50}{a }
> > \startsection[title=spec]
> > \startxtable
> Hi Sylvain,
>
> no fix is required when you allow the table to be split:
>
> \startxtable[split=yes]
>
> Pablo
>
Hi Pablo,
Thanks for the suggestion, but unlike the MWE, in
On 11/10/20 5:23 PM, Sylvain Hubert wrote:
> My mistake, but the problem survives the fix:
>
> \setuphead[section][after={\blank[samepage,big]}]
> \starttext
> \showframe
> \dorecurse{50}{a }
> \startsection[title=spec]
> \startxtable
Hi Sylvain,
My mistake, but the problem survives the fix:
\setuphead[section][after={\blank[samepage,big]}]
\starttext
\showframe
\dorecurse{50}{a }
\startsection[title=spec]
\startxtable
\startxrow
\startxcell[ny=30]a\stopxcell\startxcell 1\stopxcell
\stopxrow
\starttext
\showframe
\dorecurse{50}{a }
\startsection[title=spec][before={\blank[preference,big]},
after={\blank[samepage,big]}]
\startxtable
\startxrow
\startxcell[ny=30]a\stopxcell\startxcell 1\stopxcell
\stopxrow
\dorecurse{29}{\startxrow\startxcell 2\stopxcell\
c }
\section{title}
\startxtable
\startxrow
\startxcell[ny=10]a\stopxcell\startxcell 1\stopxcell
\stopxrow
\dorecurse{9}{\startxrow\startxcell 2\stopxcell\stopxrow}
\stopxtable
\stoptext
Does anyone know where to adjust the penalty in this case, so that the
section
xtable()
context.startxrow()
context.startxcell()
context.starttyping()
context('1')
context.stoptyping()
context.stopxcell()
context.stopxrow()
context.stopxtable()
\stopluacode
% this does not
\startxtable
\startxrow
\startxcell
\starttyping
Sylvain Hubert schrieb am 08.11.2020 um 04:54:
Dear List,
Could anyone manage to typeset the following example? Here [] causes an
error "Extra }, or forgotten \endgroup".
\starttext
\define\sample{
\startxtable[]
\startxtablehead
\startxrow
\star
Dear List,
Could anyone manage to typeset the following example? Here [] causes an
error "Extra }, or forgotten \endgroup".
\starttext
\define\sample{
\startxtable[]
\startxtablehead
\startxrow
\startxcell 123\stopxcell
\stopxrow
\stopxtablehead
\
]
\starttext
\startxtable
\startxrow
\startxcell
\incrementcounter[rownum]
\rawcounter[rownum]
\stopxcell
\stopxrow
\startxrow
\startxcell
\incrementcounter[rownum]
\rawcounter[rownum
xt,prefix=no]
> > \setcounter[rownum][0]
> >
> > \starttext
> > \startxtable
> > \startxrow
> > \startxcell
> > \incrementcounter[rownum]
> > \rawcounter[rownum]
> > \stopxcell
> >
Oleg schrieb am 25.10.2020 um 14:51:
Hi, all.
I try to place a row number into the first column of my table.
I tried:
\definecounter[rownum][way=bytext,prefix=no]
\setcounter[rownum][0]
\starttext
\startxtable
\startxrow
\startxcell
\incrementcounter[rownum
Hi, all.
I try to place a row number into the first column of my table.
I tried:
\definecounter[rownum][way=bytext,prefix=no]
\setcounter[rownum][0]
\starttext
\startxtable
\startxrow
\startxcell
\incrementcounter[rownum]
\rawcounter[rownum
f5-d4d5c22e7...@mailbox.org>
> Content-Type: text/plain; charset=utf-8; format=flowed
>
> Hi,
>
> I'm trying to typeset a parallel text that should appear in columns. The
> sources are XML, and there I have to use tables for this. So, I thought
> the easiest way is t
On 9/21/2020 4:38 PM, Denis Maier wrote:
Hi,
I'm a bit confused, but this here won't compile:
\startxmlsetups xml:table
\startxtable
\startxrow
\startxcell one \stopxcell
\startxcell two \stopxcell
\stopxrow
\stopxtable
\stopxmlsetups
when used this way you
!='parallel']}{xml:table}
\stopxmlsetups
\xmlregistersetup{xml:test}
\startxmlsetups xml:article
\starttext
\xmlflush{#1}
\stoptext
\stopxmlsetups
\startxmlsetups xml:table
\startxtable
\startxrow
\startxcell one \stopxcell
\startxcell two \stopxcell
\stopxrow
\stopxtable
> On 21 Sep 2020, at 16:38, Denis Maier wrote:
>
> Hi,
>
> I'm a bit confused, but this here won't compile:
>
> =
>
> \startxmlsetups xml:table
> \startxtable
> \startxrow
> \startxcell one \stopxcell
> \st
Hi Dalyoung,
I don't know why \recurselevel returns 0 inside a tabulate environment, but the
following works fine:
\starttext
\startxtable[frame=off,bottomframe=on,width=1cm,align={middle,lohi}]
\startxrow\startxcell \stopxcell\stopxrow % just to have a line on the top of
the first row
d
>
> Hi,
>
> I'm trying to typeset a parallel text that should appear in columns. The
> sources are XML, and there I have to use tables for this. So, I thought
> the easiest way is to use extreme tables for this:
>
> =
> \starttext
>
&
\xmlregistersetup{xml:test}
\startxmlsetups xml:article
\starttext
\xmlflush{#1}
\stoptext
\stopxmlsetups
\startxmlsetups xml:table
\startxtable
\startxrow
\startxcell one \stopxcell
\startxcell two \stopxcell
\stopxrow
\stopxtable
\stopxmlsetups
\xmlprocessbuffer{test}{test
Hi,
I'm trying to typeset a parallel text that should appear in columns. The
sources are XML, and there I have to use tables for this. So, I thought
the easiest way is to use extreme tables for this:
=
\starttext
\dorecurse{3}{\input knuth}
\startxtable[split=yes
eing typeset in a horizontal context,
> based on the error message (at least, if we assume that the error
> message was triggered by a table).
I think it is easy to trigger the error:
\setupxtable[split=yes]
\starttext
\ifvmode yes\else no\fi
\startxtable[align={middle,
zontal mode
>> [...]
>> My questions are: what is the restricted horizontal mode (as different
>> from the horizontal mode)? Why might it be triggered with
>> \startxtable[split=yes] in the huge source, but not in the single file?
>
> At a wild guess, as I had a simi
> On 13 Aug 2020, at 13:07, Pablo Rodriguez wrote:
>
> Dear list,
>
> in order to avoid a problem already reported
> (https://mailman.ntg.nl/pipermail/dev-context/2020/003694.html), I added
> to an indiviual table \startxtable[split=yes] (being the default in the
> doc
Dear list,
in order to avoid a problem already reported
(https://mailman.ntg.nl/pipermail/dev-context/2020/003694.html), I added
to an indiviual table \startxtable[split=yes] (being the default in the
document \setupxtable[split=repeat, header=repeat]).
But I’m experiencing a weird issue
Hello,
With the latest version of lmtx, the background color of cells does not
work.
Thank you.
Fabrice
\starttext
\startxtable
[align={middle,lohi}, offset=0.8ex,background=color,
backgroundcolor=red,frame=off]
\startxrow
\startxcell
\m{\displaystyle
old,
>width=broad]
>
> \defineenumeration
>[definition]
>[text=Définition,
> number=yes,
> headcommand=\groupedcommand{}{.},
> style=italic]
>
> \starttext
>
> \startdefinition
> \blank
> \startxtable[align={lohi,middle},w
yes,
> headcommand=\groupedcommand{}{.},
> style=italic]
>
> \starttext
>
> \startdefinition
> \blank
> \startxtable[align={lohi,middle},width=2cm,offset=0.8ex]
> \startxrow
> \startxcell
> 1
> \stopxcell
> \startxcell
> 2
=,
titleright=,
prefix=yes,
prefixsegments=chapter,
way=bychapter,
titlestyle=bold,
width=broad]
\defineenumeration
[definition]
[text=Définition,
number=yes,
headcommand=\groupedcommand{}{.},
style=italic]
\starttext
\startdefinition
\blank
\startxtable[align
.
What's the 'official' way to align top and bottom in an xrow?
MWE
\setuppapersize [A4] [A4]
\starttext
\startxtable[width=\textwidth]
\startxrow[height=150mm]
\startxcell[align=middle]
Top
\vfill
Bottom
\stopxcell
\stopxrow
\stopxtable
\stoptext
It's
in an xrow?
MWE
\setuppapersize [A4] [A4]
\starttext
\startxtable[width=\textwidth]
\startxrow[height=150mm]
\startxcell[align=middle]
Top
\vfill
Bottom
\stopxcell
\stopxrow
\stopxtable
\stoptext
It's not a real fix but you can you exclude the \vfi
\starttext
\startxtable[width=\textwidth]
\startxrow[height=150mm]
\startxcell[align=middle]
Top
\vfill
Bottom
\stopxcell
\stopxrow
\stopxtable
\stoptext
The error message is:
> tex error > tex error on line 4 in file virtual://buffer.x_table_1
± \stopxcell
\startxcell \digits{#2} \stopxcell
}{
\startxcell[align=left] \digits{#1} \stopxcell
\startxcell \stopxcell
\startxcell \digits{#2} \stopxcell
}
}
\startxtable[split=repeat, aligncharacter=yes, alignmentcharacter
ve a lot of typing, if I wouldn’t have
>> to specify the padding manually and I vaguely recall that there is somewhere
>> a ConTeXt solution that can make such alignments, but I simply can’t find it
>> any more …
>
> You can align number on the decimal point (comma) but this works o
on the decimal point (comma) but this works only
when you have only one number in a cell.
\starttext
\startxtable[aligncharacter=yes,alignmentcharacter=±]
\startxrow
\startxcell
\digits {14.0} ± \digits {1.5}
\stopxcell
\stopxrow
\startxrow
\startxcell
Okay, I found the solution myself: Need to specify \startxtable[split=repeat]
or else.
It’s actually a bit surprising that the value of the “outer” enivornment
(placetable) depends on the settings in the inner one (xtable). I speculate
this might be because the order of the tables might
edtext[width=6cm,style=mono]
>> \sethyphenationfeatures[dna]
>> \setuphyphenation[method=traditional]
>> GATTGCTTACTCCTGGTTGG%
>> TCTTACATTCTGTCGCCTC%
>> CTACTAGAGCCGGCATATT%
>> CTAG
\define[1]\DNAspacer{#1\hskip 2.3pt plus .1pt}
\define[2]\mycommandc{
\startxrow
\startxcell o#1 \stopxcell
\startxcell {\tt\WORD{\DNA{5'-#2}}}\stopxcell
\stopxrow
}
\starttext
\setupxtable[width=5cm]
\startxtable
\my
\setupxtable[width=5cm]
\startxtable
\mycommandc{C}{GATTGCTTACTCCTGGTTGGTCTTACATTCTGTCGCCTCCTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGGCCTAGGGCACCATCGCGTACGAGGGCAATGAGTTTACCGCTGCGAAGTCTCTACGTCACGGCCAACCACAGTCCTGCTCCCAACGAAATTTAGACGCTGTCGTGAAACCTGAATTCGAGGATAAGCCGCGTCATGAAGAGTCTACTG}
\stopxtable
Hi,
I would like to reference a table of the following structure.
\starttext
\startplacetable[reference=tab1,title={A table},location=split]
\startxtable
\startxrow
\startxcell hi \stopxcell
\stopxrow
\stopxtable
\stopplacetable
In Table \in[tab1]
\stoptext
It has [location=split], which I
\startframedtext
[frame=off,width=\textwidth,
background=color,backgroundcolor=fondpaille]
\input tufte
\startlinecorrection[blank]
\startmidaligned
\startxtable
[align={lohi,middle}, option={stretch},framecolor=cyan,
offset=0.8ex,background=color,backgroundcolor
\setupheadertexts[\directsetup{header}]
\startbuffer[tablerow]
\startxrow
\startxcell first \stopxcell
\startxcell second \stopxcell
\stopxrow
\stopbuffer
\startbuffer[table]
\startxtable
\startxtablehead[head]
\getbuffer[tablerow]
\stopxt
tartxcell first \stopxcell
\startxcell second \stopxcell
\startxcell third \stopxcell
\startxcell fourth \stopxcell
\startxcell fifth \stopxcell
\startxcell sixth \stopxcell
\stopxrow}
%\startplacetable
\startxtable
\startxtablehead[head]
\onerow
\stopxtablehead
\startxtablebody
\
d{cI}{\startxcell \cI \stopxcell}
\doifdefined{cJ}{\startxcell \cJ \stopxcell}
\doifdefined{cK}{\startxcell [left] \cK \stopxcell}
\stopxrow
\stopbuffer
%\startplacetable[]
\startxtable
\startxtablehead[head]
\doloopif{\lineno}{<}{2}{\getbuffer[loop]}
\stopxtablehead
\startxtablebody
\doloo
le from a CSV file and want to typeset it via \xtable.
>>
>> The xtable as defined below works, it splits over several pages, but
>> the header does not repeat. I have seen examples in the mailing list
>> where people put the "\startxtable.\stopxtable" within a
>&g
gt; data. I cannot guess why a second loop might be required.
> Hi Geert,
>
> this approach is simpler:
>
> \starttext
> \startxtable
> \startxtablehead[head]
> \doloopif{\lineno}{<}{2}{\getbuffer[loop]}
> \stopxtablehead
> \start
is a way to read the number of lines in
>> the csv file to use the exact number of lines, instead of guessing.
>
> If \numrows doesn’t fit your needs, please provide a CSV file with fake
> data. I cannot guess why a second loop might be required.
Hi Geert,
this approach is
; header does not repeat. I have seen examples in the mailing list where
> people put the "\startxtable.\stopxtable" within a \placefigure, but
> as soon as I try this, I get an error message: "missing } or endgroup",
> although I doublechecked the "}"
have seen examples in the mailing list where
people put the "\startxtable.\stopxtable" within a \placefigure, but
as soon as I try this, I get an error message: "missing } or endgroup",
although I doublechecked the "}" and I see no error.
The other issue I
put the "\startxtable.\stopxtable" within a \placefigure, but
as soon as I try this, I get an error message: "missing } or endgroup",
although I doublechecked the "}" and I see no error.
The other issue I have: Since xtable requires me to read the header l
]
[\metahashoverlay{ -45}]
\defineoverlay[meta:hash:horizontal][\metahashoverlay{+180}]
\defineoverlay[meta:hash:vertical] [\metahashoverlay{ -90}]
\starttext
\startmidaligned
\startxtable
[align={lohi,middle}, width=1.5cm, background=color
his problem in my current ConTeXt
> installation for
> this project. That is now nearly 4 years old, but the same bug is still
> happens with
> a new beta of mkiv.
>
> I cannot switch to \startxtable because I would need \startembeddedxtable,
> and that
> has way too many limitatio
for
this project. That is now nearly 4 years old, but the same bug is still happens
with
a new beta of mkiv.
I cannot switch to \startxtable because I would need \startembeddedxtable, and
that
has way too many limitations to be useful in this project.
Best wishes,
Taco
test.pdf
Description: Adobe
inbetween and/or columndistance
> the cells of the xtable will not properly size when spanning over rows
> and/or columns.
>
> e.g.
>
> \starttext
>
> \startxtable[spaceinbetween=2mm, columndistance=2mm, corner=round]
> \startxtablebody
> \startxrow
>
On 1/31/20 12:13 AM, Floris van Manen wrote:
> Does anyone knows a hint to get the stacked boxes to the correct size?
> [...]
> \startxtable[spaceinbetween=2mm, columndistance=2mm, corner=round]
> \startxtablebody
> \startxrow
> \startxcell[ny=3] a1\stopxcell
>
Does anyone knows a hint to get the stacked boxes to the correct size?
When usinig non-zero values for the options
spaceinbetween and/or columndistance
the cells of the xtable will not properly size when spanning over rows
and/or columns.
e.g.
\starttext
\startxtable[spaceinbetween=2mm
1 - 100 of 334 matches
Mail list logo
