Yes, I would like to congratulate all these authors for getting this out. Many of them are friends and colleagues, and it is great to see them doing well, and getting this kind of work in front of as many eyes as possible.  The nice thing about this particular assay is that it is linear with time, and therefore much more quantitative than PCR. Makes it easier to measure viral load.  Great progress!

True, 488 nm laser diodes are not "cheap", but that is paying retail.  Ostensibly, there is no reason why mass production couldn't be ramped up. The question is not how much it costs to build the first one, but how much it will cost to make the billionth one. We scientists are usually far more concerned with the first device than the 2nd or the last, but if we want to get ahead of this pandemic we need to start thinking on this scale. How many factories can make the parts you need?  What is the actual per-unit incremental cost of manufacture?  Are there critical materials or components that are or will be in short supply.  If you need toilet paper, for example, forget about it.

In my spare time, I've been thinking a lot about how to get to a billion tests/day. Why that many?  Because (IMHO) that is the most cost-effective way to end a pandemic. It is interesting to note that the graph of cost/benefit vs testing rate has a maximum, and it currently lies between us and the minimum. The minimum is when you test the entire population at the same time. That is, if we all take a test before going to bed and get the result the following morning, then everyone who has the virus will know to stay home.  Everyone else can go to work, school, brunch, etc.  If the test is 99% accurate you only need to do this ~5 times, perhaps once a week, until the number of undetected cases on Earth is less than one (7e9*(1-0.99)^5 < 1). I.E. the virus is extinct. That is, you could end the pandemic in 5 weeks with only 35 billion tests and potentially no need for quarantine (R << 1). Even if the test is only 50% accurate, or if compliance with quarantine is only 50%, then you need to test the world 33 times, or 2.3e11 test. The problem is that at current prices of $150/test, the cost of doing that would be $35e12.  This is most of the Gross World Product. Too much.

The trick is achieving this scale at a cost the human race can afford. If we can achieve the billion test/day scale with only $1/test, then ending the pandemic in a month for only $35e9 would be a real bargain.

So, how do we do that?  Shipping alone will be a nightmare.  Amazon delivers about 1 billion packages every year, so delivering that many tests from a central factory in less than a year is intractable. This means that not just distribution but manufacturing must be de-centralized as much as possible. The test kits, or their critical components will have to be robust enough to be dropped en masse from airplanes. The advantages of "pre-deployed" materials and equipment cannot be understated. Ideally, you'd like the test to be performed by anyone watching a YouTube video (on their smartphone) using things they already have in their kitchen. Now, not everyone has the same things in their kitchen, and that means just one test design won't do. We need a DIVERSITY of designs.

What I've been trying to do is break down this problem into the most critical barriers.  As we collectively find ways to remove these barriers, we get closer to this lofty goal.

For example, if someone is lucky enough to own a sous vide, then they can maintain the 63 C +/- 3 C for 2 hours required to perform a LAMP assay. Problem is: not everyone owns a sous vide, including me.  I could order one, but if a billion other people do the same it will be a while before all those orders are filled.  So, I need to use what I have. My oven can't be set for less than 77 C (that will inactivate the polymerase), hot water out of the tap is only 50 C (too cold), and boiling water in a coffee mug cools off too fast (65->60 C in 5 min). A few things I have found around the house that can do a LAMP assay are: a candle-fired fondue set, a slow cooker ("crock pot") set on "keep warm", solidifying candle wax in a foam box (melting point is ~62 C), and (I think) the dishwasher.

Now, I haven't actually been doing LAMP assays in my kitchen.  What I've been doing is cooking eggs.  A "63 degree egg" has a particular mayonaise-like consistency that is hard to achieve any other way. That was my assay for the above.

I suppose I could buy some Bst polymerase, but then my price/test will definitely be > $1. There also won't be enough to go around. 7 billion units of Bst polymerase is about 1 kg of pure enzyme. That will take a while to make.  Enzymes in general are a pain. They are expensive, delicate, must be kept sterile, refrigerated, and are complicated to ship.  It would be great if we had a testing strategy that didn't need any enzymes. Oligonucleotides are much hardier, cheaper, more predictable, and faster to make. Manufacturing can be distributed over a fairly large number of locations, and the amount you need per test is tiny.

The main hurdle to an enzyme-free test is sensitivity. You can get decent signal boost by labeling hundreds of different sites in the 30 kb genome (as I described earlier) but you're not going to get the billion-fold amplification you can get from PCR.  Even at the peak of an active infection the concentration of virus in sputum could still be as low as 1e6 copies/mL. This is ~2e-15 M.  A tall order, but not unprecedented for detection by a smartphone CMOS sensor. Truth be told, however, that detection limit was 1 million bioluminescent particles/mL.  That means zero background. Fluorescence detection is limited by background, and most of that background comes from excess probes. Even "black-hole" quenchers aren't completely black. They give you a factor of 50 or so, nothing more. It is tempting to only use an equimolar amount of probe, but at 2e-15 M target the on-rate will be very low.  On the other hand, unless the probes are removed post-annealing, anything more than a 10:1 ratio of probe to target will have unacceptably high background.

What is important to remember here, however, is that you can always get more signal by using more sample.  How much material a swab picks up is variable, but I guess it is not more than tens of microliters. This is then diluted >100x by the "dip and spin" transfer into a solution you can put in a PCR tube.  Saliva-based tests usually collect ~500 uL or so, but can be hampered by contamination. Yes, people are told not to eat before providing saliva samples, but at least some of them always do. Then again, it may be a foregone conclusion that any test done in the home by billions of people is going to have to be robust to contamination. Perhaps we should embrace it rather than fight it?

The extreme case of high sample volume and high contaminant levels is sewage.  I have been immensely impressed by how successful this has been!  Arizona State University detected two asymptomatic cases in a dorm full of 330 students by doing just one test: sampling the effluent from the building. How much virus is available by this route is not clear, as literature on recovery and complications from contaminants are sparse. However, since PCR false negatives become unacceptably high after pooling 5 or so patient samples, but 2 patient samples were pooled with >300 others at ASU, I'd say you should get at least 30x more virus from a stool sample than you would from a swab. Coronaviruses in general are enteric pathogens, making this kind of shedding their usual route. This is a stark contrast to flu, Ebola and other serious pathogens we have seen in recent memory.  I personally wonder how many "asymptomatic" cases simply had diarrhea and didn't want to talk about it.  As a result, I am now much more afraid of public lavatories than ever before.

Typical effluent samples are ~ 50 mL.  A concentration step is required. As biochemists we immediately think of centrifugation, but the closest thing in my kitchen to a centrifuge is our salad spinner, and it only gets up to about 15 g (according to my previous phone's accelerometer).  That's not even enough to pellet yeast, let alone nucleic acids.  Manu Prakash invented a very clever whirlygig centrifuge (the PaperFuge), but it is not really compatible with large volumes.  In fact, large volumes and high g-forces mean quite a lot of stored energy, and therefore a dangerous device.

These factors turned my attention to electrophoretic concentrators. Yes, they do exist, but they are slow:
https://doi.org/10.1016/0003-2697(81)90375-4
Convection will keep re-mixing the sample, and therefore must be avoided.  That means, among other things, gas production at the electrodes must be kept low enough to dissipate by diffusion (no bubbles). However, for an at-home test it is OK if this takes overnight. Lower voltages are safer anyway. By proper selection of the pore size in the gel or membrane used to capture the RNA, it could also serve to remove any unhybridized primers, which will have much lower molecular weight than the viral genome.

The trick here will be keeping the RNA genome intact long enough to do the whole assay. Good thing about not using any enzymes is that you can have tons of denaturant around. Oligos of sufficient length can still hybridize in 3-5 M urea, and perhaps higher.  The literature on that is a bit sparse.  The other thing that kills RNAse but not RNA is heat.  Once the sample cools down the RNAses can re-fold and start digesting the RNA again, but if you keep it hot, and at neutral pH, the RNA has a pretty good chance.  Have I done this experiment?  No. I need a way to detect the RNA in my kitchen.

The make-or-break here comes down to the at-home fluorometer.  Key question is: how many dye molecules can be detected by a device costing $1 (+ smartphone) made of parts that can scale to 1 billion units? I've looked into this a bit. One very important thing I have learned is that Schott glass sucks. I had hoped that by using colored glass filters I could avoid the need for any lenses. The "flash" LED on a smartphone is very bright, but also highly divergent. The theoretically best combination of filters and dyes to use are a Hoya B-370 excitation filter, ATTO-465 dye and and Scott OG-515 emission filter. However, the OG-515 glass is itself fluorescent.  Degree of fluorescence varies from batch to batch, but it is bright enough to see by eye, and therefore useless. Maybe I can make some jewelry out of it.

Since colored glass filters are out, that leaves interference filters. These need parallel light, and that means lenses.  I have found, however, that ball lenses could do the trick. Spheres are easy to manufacture.  A ~1 cm ball lens held in contact with the window of the "flash" LED of a smartphone renders the light parallel enough for an interference filter to work.  A second ball lens then focuses the filtered blue light onto a ~1 mm wide sample ~2.5 mm from the ball's surface. A third ball lens after the sample picks up the fluorescent light and parallelizes it through the emission filter.  A final, forth ball lens focuses the fluorescent photons into the smartphone camera. Now, scientific-grade ball lenses and interference filters are not the cheapest optical components, but then again, neither is anything else when you buy it from a scientific supply company.  A 1 cm N-BK7 glass ball lens set me back $44, but I also got a bag of one thousand 3/8" acrylic ball bearings for $10. Both lens types work equally well in my hands. I'm still learning about how interference filters are manufactured, but all they really are is a glass plate with some coating on it.  Lots of places can do optical coatings, I think.  A billion test kits will require a total of 1 km^2, but it doesn't have to ever be all one sheet.

Then you need something to hold the optics together.  My favorite right now is black rubber hose. It is light tight, the matte finish minimizes specular reflections, and with a little pressure the rubber forms good light-tight seals all by itself. You can also align the optics peristaltically. What's been a little difficult is finding the right way to cut a rubber tube and get a nice, smooth edge. Freezing in liquid nitrogen would do it, but I don't have any of that in my kitchen. Ordinary tubing cutters are OK, but not great. Anyone got a favorite trick for this?

And in general, any suggestions or comments, or best of all home experiment results would be great to hear.  I believe that if we collectively work the problem we will inspire more breakthroughs like the Fozouni et al. paper below, and that will have a strong positive impact on all of us.

-James Holton
MAD Scientist


On 12/5/2020 8:05 AM, Eugene Osipov wrote:
Hi everyone,
I wanted to revive this discussion with a fresh paper from Cell journal: https://www.cell.com/cell/fulltext/S0092-8674(20)31623-8 <https://www.cell.com/cell/fulltext/S0092-8674(20)31623-8> So one could use a smartphone camera for SARS-CoV-2 detection but you still need some extra tools, like 488 nm laser.

пт, 10 апр. 2020 г. в 20:14, James Holton <[email protected] <mailto:[email protected]>>:


    It looks to me that in this norovirus test the phone is acting as
    nothing more than a camara attached to a conventional microscope. 
    Light source is 3rd party, and the microscope body is 3D printed. 
    3D printing is cool and all, but it does not scale well. 
    Antibodies are also expensive to make.  You will go through a lot
    of rabbits to make the 1 kg needed for a billion tests. This isn't
    quite the price point I had in mind.

    I agree that agglomeration of fluorescent beads is very
    sensitive.  However, my experience with beads and other small
    objects is that they love to stick together for all kinds of
    reasons. And once they do it is hard to get them to separate. 
    Assaying for virus particles in otherwise pure water is one thing,
    it is quite another when there is other stuff around.

    Personally, I've tried several different phone-based microscopes
    and the hardest thing about them is aligning the camera.  I'm a
    beamline scientist, so aligning things is second nature, but your
    average person might have a hard time. The most annoying part is
    if you bump it you have to start over.  Image quality is also
    never all that great, I expect because the optics of a smartphone
    camera are wide-angle, and you are fighting against that. 
    Eventually I bought a self-contained wifi microscope for $50, and
    that works MUCH better.  In fact, I'd say its competitive with the
    $5k microscope we use to look at crystals. However, $50 is a lot
    in the third world. I've heard that drugs that cost more than
    $1/pill are essentially unobtainable in many countries.

    I'm still thinking that using the camera as nothing more than a
    big photodiode is the right way to go. By positioning the sample
    right in front of the camera lens you will get maximum
    light-collection efficiency. In fact, one might be able to get
    excellent time resolution out of the rolling-shutter mode.  That
    is, unlike the CCD or PAD detectors we are used to these CMOS
    sensors read out one row of pixels while the others are still
    exposing.  This means that the whole image is acutally one big
    time series with individual pixels only a few nanoseconds apart. 
    It should be possible to differentiate the light from a long-lived
    fluorophore from background. However, I don't think anyone has
    tried that yet.

    -James Holton
    MAD Scientist


    On 4/4/2020 5:48 PM, Jurgen Bosch wrote:
    Here’s another link I found that should make this project feasible:

    https://physicsworld.com/a/smartphone-based-device-detects-norovirus/
    <https://physicsworld.com/a/smartphone-based-device-detects-norovirus/>

    Jürgen

    On Apr 2, 2020, at 3:52 PM, Patrick Shaw Stewart
    <[email protected] <mailto:[email protected]>> wrote:

    Jurgen, that /was /interesting. (Strange how your hair came and
    went during the talk, leaving you bald sometimes - but of course
    that didn't matter !  ;)

    Did you know that coronavirus was first isolated at 33C and that
    this temperature may be required for isolation?
    https://www.bmj.com/content/3/5568/767
    <https://www.bmj.com/content/3/5568/767>
    https://www.sciencedirect.com/science/article/pii/S019665531730901X
    <https://www.sciencedirect.com/science/article/pii/S019665531730901X>

    We don't know why the virus stays in the throat in many people,
    but at other times it goes to the lungs.  ACE2 is predicted to
    be highly expressed in the mouth and nose as well as the lungs.
    https://www.researchsquare.com/article/rs-16992/v1
    <https://www.researchsquare.com/article/rs-16992/v1>

    A recent Nature paper noted that "sequence-distinct virus
    populations were consistently detected in throat and lung
    samples from the same patient, proving independent replication"
    https://www.nature.com/articles/s41586-020-2196-x
    <https://www.nature.com/articles/s41586-020-2196-x>

    It would be very interesting to know whether the lung samples
    were less temperature-sensitive than the throat ones, and
    whether this could explain the observed divergent tropism -
    (which you also noted).
    https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/
    <https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/>

    Thx and stay warm (see my blog)

    Patrick



    On Thu, Apr 2, 2020 at 4:57 PM Jurgen Bosch <[email protected]
    <mailto:[email protected]>> wrote:

        I’m sharing a laymen’s talk I recently gave on some aspects
        of Corona. I’m not claiming to be an expert, but there is
        useful information in the presentation. I skipped the intro
        and zoomed directly to the start of my presentation.

        https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204
        <https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204>

        I can make the slides available if anybody wants them.

        Jürgen

        On Apr 2, 2020, at 11:27 AM, James Holton <[email protected]
        <mailto:[email protected]>> wrote:

        Personally, if I were infected with SARS-CoV-1 instead of
        SARS-CoV-2 I'd still like to know that.

        It is most certainly true that the primer design must be
        done right: checking for self-annealing, low genomic
        variability, cross-reactivity to potential contaminants
        etc. Fortunately, we have tools for this that can be used
        at home.

        I agree the CRISPR-based tests are very exciting, as are
        many of the other new tests being rolled out. Assay times
        of 15 minutes, 5 minutes, and now 2 minutes have been
        claimed.  The problem I see is they all rely on specialized
        equipment, skilled technicians and expensive reagents. 
        Ramping up production to the billion-test scale may not be
        feasible.  Even if it were, all the PPE needed to extract
        those samples safely would be prohibitive, as would be the
        sample-tracking logistics.

        For reasons such as this, I am curious to see if an at-home
        do-it-yourself test is possible.  It may serve no purpose
        other than to satisfy indiviual curiosity, but I think it
        would go a long way to defusing the fear that comes from
        not knowing.  This would not just be for sputum, but
        possibly doorknobs, packages, and, yes, mobile phones.

        And for those wondering about those nasal swabs: I've done
        a little research on them and I think the reason for going
        full "Total Recall" and sticking it way up inside your head
        is not because the virus is more concentrated there (we
        don't even know what the concentration is), but rather
        because potential contaminants are minimized. Think about
        it: PCR is a very sensitive technique, and you want to make
        sure the sample came from the intended patient, not the
        other patient who walked through the door just before you
        did after sneezing in their hand and touching the
        doorknob.  If you touched that same doorknob and then
        <ahem> "scratched" your nose, then a swab of your nostrils
        might pick up a virus or two.  That would be a false positive.

        I expect there are many aspects of current test that don't
        have to be the way they are, but nonetheless are "required"
        because they were inherited from previous tests.  I expect
        we all have learned the hard way that in biological science
        when you are handed a protocol you follow that protocol to
        the letter.  How many times have you had to teach a student
        that?  It is not a bad policy, but eventually there comes a
        time for "assay development".  This is when you start
        asking "why do we do it that way, again?"

         For example, swabs with calcium alginate are not allowed
        becuase they can "kill the virus".  If all we want is
        genomic RNA, then why do we care?  Possibly because the
        traditional method of identifying most pathogens is to
        culture them.  The CDC protocol also recommends against
        cotton swabs with wood handles. Why?  Perhaps because they
        contain DNA, and for PCR you always worry about
        contamination.  Is there any chance the probes will anneal
        to something in the cotton or pine genomes?  I doubt it,
        but I also doubt that anyone has checked.

        Thank you for the suggestions so far!  Very interesting and
        helpful!

        -James Holton
        MAD Scientist


        On 3/31/2020 11:46 PM, Sahil Batra wrote:
        Dear Prof. Holton,

        An innovative idea; however all of the 30 kb genome may
        not be useful for specific detection - SARS-CoV1 and
        SARS-CoV2 share 80% identity.

        A similar fluorescent detection approach for SARS Cov2 --
        using the indiscriminate collateral activity of Cas12
        nuclease -- has been reported here:
        https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf
        <https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf>
        Although not tested on samples from patients.

        Regards,
        Sahil Batra
        PhD candidate, IIT Kanpur

        On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch
        <[email protected] <mailto:[email protected]>> wrote:

            One problem I see is the sputum, there’s a reason why
            swabs are made to get sufficient viral material.

            Since stool samples test PCR positive that might be an
            easier approach to get sufficient viral material. As a
            side note, these are not infectious anymore, or at
            least one has not been able to infect tissue cultures
            from stool samples.

            It’s worth a thought, I’ll need to read those papers
            you referenced.

            I believe I read a suitable preprint for viral load,
            will search for it tomorrow.

            Jürgen




            __________________________________________
            Jürgen Bosch, Ph.D.
            Division of Pediatric Pulmonology and Allergy/Immunology
            Case Western Reserve University
            2109 Adelbert Rd, BRB 835
            Cleveland, OH 44106
            Phone: 216.368.7565 <tel:216.368.7565>
            Fax: 216.368.4223 <tel:216.368.4223>

            CEO & Co-Founder at InterRayBio, LLC

            Johns Hopkins University
            Bloomberg School of Public Health
            Department of Biochemistry & Molecular Biology

            On Apr 1, 2020, at 00:50, James Holton
            <[email protected] <mailto:[email protected]>> wrote:

            In order to do global survelinace of this new virus
            I figure we're going
            to need billions of tests.  The biggest barriers I
            believe are
            logistical. Shipping back and forth to a central labs
            isn't going to
            cut it, and neither are test kits that cost $800 each.

            I think I may have a plausible way forward to a
            low-cost and easily
            mass-produced test for the SARS-CoV-2 virus using
            mostly items people
            already have, such as smartphones. The most expensive
            reagent required
            will be labeled oligos, but those scale very well.

            The key observation is that smartphones can detect as
            few as 1e6
            particles/mL if they do long exposures (180s).  This
            was using
            bioluminescence. Reported here:
            https://www.nature.com/articles/srep40203.pdf
            <https://www.nature.com/articles/srep40203.pdf>

            The other side of that coin is the expected titer of
            the virus in
            sputum. I don't know of any reports for SARS-CoV-2
            itself, but for four
            other respiratory viruses, including one coronavirus,
            it ranges from 1e6
            to 1e8 particles/mL :
            https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/
            <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/>

            This is encouraging! The challenge will be to detect
            viral genomes in
            "the field" without sophisticated lab equipment like
            a PCR machine,
            lasers, 3D printers, etc.  The concentration will be
            1e-15 M, a
            challenge, but then again we can detect single
            molecules using
            fluorescence. The questions are:
            1) can we get the background low enough so that the
            dark current of the
            camera dominates
            2) can we make the signal high enough to overcome the
            dark current.

            1) will depend on the availability of mass-produced
            filter technology.
            However, the best filter may simply be time. Provided
            the fluorophore
            lifetime is long enough and the camera
            synchronization tight enough one
            could simply measure the "afterglow" after the camera
            flash has turned
            off.  An interesting candidate is europium. Most
            fluorophores decay in
            nanoseconds, but lanthanides can be microseconds to
            milliseconds. In
            fact, "glow-in-the-dark" toys usually use
            europium-doped ZnS or SrAl04.
            Those decay over minutes to hours.  What I'm not sure
            about is using
            them for FRET. I would appreciate input on experience
            with this.

            2) I believe signal could be enhanced by using very
            luminous tags (such
            as quantum dots), and/or by using multiple tags per
            genome. This virus
            has the largest RNA genome known to date at 30
            kbases. That means there
            is room for up to 2000 15-mer tags, each with its own
            label. The set-up
            cost for doing ~2000 oligo synthesis reactions will
            be high, but it can
            be done at scale.  You only need ~2 fmol of each
            oligo, 10 umol
            synthesis is about $1k, so I estimate about $1 per
            test using 1000
            different oligos. This price point will be important
            if we want to make
            billions of tests to be used all over the world.  In
            some countries $1
            is a lot.

            The detection strategy I am focusing on is FRET. 
            That is, oligos would
            be made in pairs, recognizing abutting sections of
            the viral genome.
            Like this:
            5' atttcgctgattttggggtc-ATTO465
            ATTO550-cattatcagacattttagt  3'
            which would anneal to one of the current CDC test
            primer sites:
            3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5'
            The result in this case would be maximum FRET
            efficiency only when both
            oligos are bound. From what I can tell, the ATTO465
            dye is one that is
            most sensitive to the blue peak in the iPhone "flash"
            LED spectrum, and
            ATTO550 should give maximum contrast between the
            green and red channels
            of the iPhone camera. That way you would discriminate
            presence/absence
            by color. Red=virus, Green=clear. That is just an
            example. Other tags
            might work better. Maybe quantum dots.

            Additional aparatus would be required, of course, and
            at least a few
            reagents to crack open the capsids (DTT and
            guanidine). These could be
            shipped dry in foil packs.  The end user would simply
            tear it open and
            spit into it.  If the intersted party is performing
            the test on
            themselves, then there is no biohazard. Heating to
            70C (cup of coffee?)
            should kill the virus, and these reagents will make
            it even more dead.
            I'm not sure how much purification would be
            required.  The assay volume
            in the Nature paper above was 1 mL.  I expect signal
            would be improved
            by concentrating the RNA as close to the camera as
            possible.  It may
            even be possible to absorb the nucleic acid directly
            onto the cover
            glass of the smartphone camera.  RNA sticks to glass
            at pH < 7.5, and
            not much else does. Quiagen EZ1 nucleic acid
            purificaiton columns are
            nothing but silica glass beads after all.

            There are still details to work out, but I am
            intruiged by the fact that
            this seems physically possible and the potential of
            being very cheap,
            rugged, portable and scaled up rapidly.  It would be
            nice to be able to
            leverage a device that is in already in the hand of
            half the people on
            the planet.

            Comments? Insights?

            -James Holton
            MAD Scientist

            
########################################################################

            To unsubscribe from the CCP4BB list, click the
            following link:
            https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
            <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>

            
------------------------------------------------------------------------

            To unsubscribe from the CCP4BB list, click the
            following link:
            https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
            <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>



        ------------------------------------------------------------------------

        To unsubscribe from the CCP4BB list, click the following link:
        https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
        <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>




        ------------------------------------------------------------------------

        To unsubscribe from the CCP4BB list, click the following link:
        https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
        <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>




        ------------------------------------------------------------------------

        To unsubscribe from the CCP4BB list, click the following link:
        https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
        <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>



-- [email protected] <mailto:[email protected]>   Douglas
    Instruments Ltd.
     Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
     Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

    http://www.douglas.co.uk <http://www.douglas.co.uk/>
     Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
     Regd. England 2177994, VAT Reg. GB 480 7371 36


    ------------------------------------------------------------------------

    To unsubscribe from the CCP4BB list, click the following link:
    https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
    <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>



    ------------------------------------------------------------------------

    To unsubscribe from the CCP4BB list, click the following link:
    https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
    <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>



--
Evgenii Osipov
Laboratory for Biocrystallography,
Department of Pharmaceutical Sciences,
KU Leuven O&N2

------------------------------------------------------------------------

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1 <https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1>



########################################################################

To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Reply via email to