I’m sharing a laymen’s talk I recently gave on some aspects of Corona. I’m not claiming to be an expert, but there is useful information in the presentation. I skipped the intro and zoomed directly to the start of my presentation.
https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204 <https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204> I can make the slides available if anybody wants them. Jürgen > On Apr 2, 2020, at 11:27 AM, James Holton <jmhol...@lbl.gov> wrote: > > Personally, if I were infected with SARS-CoV-1 instead of SARS-CoV-2 I'd > still like to know that. > > It is most certainly true that the primer design must be done right: checking > for self-annealing, low genomic variability, cross-reactivity to potential > contaminants etc. Fortunately, we have tools for this that can be used at > home. > > I agree the CRISPR-based tests are very exciting, as are many of the other > new tests being rolled out. Assay times of 15 minutes, 5 minutes, and > now 2 minutes have been claimed. The problem I see is they all rely on > specialized equipment, skilled technicians and expensive reagents. Ramping > up production to the billion-test scale may not be feasible. Even if it > were, all the PPE needed to extract those samples safely would be > prohibitive, as would be the sample-tracking logistics. > > For reasons such as this, I am curious to see if an at-home do-it-yourself > test is possible. It may serve no purpose other than to satisfy indiviual > curiosity, but I think it would go a long way to defusing the fear that comes > from not knowing. This would not just be for sputum, but possibly doorknobs, > packages, and, yes, mobile phones. > > And for those wondering about those nasal swabs: I've done a little research > on them and I think the reason for going full "Total Recall" and sticking it > way up inside your head is not because the virus is more concentrated > there (we don't even know what the concentration is), but rather because > potential contaminants are minimized. Think about it: PCR is a very > sensitive technique, and you want to make sure the sample came from the > intended patient, not the other patient who walked through the door just > before you did after sneezing in their hand and touching the doorknob. If > you touched that same doorknob and then <ahem> "scratched" your nose, then a > swab of your nostrils might pick up a virus or two. That would be a false > positive. > > I expect there are many aspects of current test that don't have to be the way > they are, but nonetheless are "required" because they were inherited from > previous tests. I expect we all have learned the hard way that in biological > science when you are handed a protocol you follow that protocol to the > letter. How many times have you had to teach a student that? It is not a > bad policy, but eventually there comes a time for "assay development". This > is when you start asking "why do we do it that way, again?" > > For example, swabs with calcium alginate are not allowed becuase they can > "kill the virus". If all we want is genomic RNA, then why do we care? > Possibly because the traditional method of identifying most pathogens is to > culture them. The CDC protocol also recommends against cotton swabs with > wood handles. Why? Perhaps because they contain DNA, and for PCR you always > worry about contamination. Is there any chance the probes will anneal to > something in the cotton or pine genomes? I doubt it, but I also doubt that > anyone has checked. > > Thank you for the suggestions so far! Very interesting and helpful! > > -James Holton > MAD Scientist > > > On 3/31/2020 11:46 PM, Sahil Batra wrote: >> Dear Prof. Holton, >> >> An innovative idea; however all of the 30 kb genome may not be useful for >> specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity. >> >> A similar fluorescent detection approach for SARS Cov2 -- using the >> indiscriminate collateral activity of Cas12 nuclease -- has been reported >> here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf >> <https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf> >> Although not tested on samples from patients. >> >> Regards, >> Sahil Batra >> PhD candidate, IIT Kanpur >> >> On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <jxb...@case.edu >> <mailto:jxb...@case.edu>> wrote: >> One problem I see is the sputum, there’s a reason why swabs are made to get >> sufficient viral material. >> >> Since stool samples test PCR positive that might be an easier approach to >> get sufficient viral material. As a side note, these are not infectious >> anymore, or at least one has not been able to infect tissue cultures from >> stool samples. >> >> It’s worth a thought, I’ll need to read those papers you referenced. >> >> I believe I read a suitable preprint for viral load, will search for it >> tomorrow. >> >> Jürgen >> >> >> >> >> __________________________________________ >> Jürgen Bosch, Ph.D. >> Division of Pediatric Pulmonology and Allergy/Immunology >> Case Western Reserve University >> 2109 Adelbert Rd <>, BRB 835 >> Cleveland, OH 44106 <> >> Phone: 216.368.7565 <tel:216.368.7565> >> Fax: 216.368.4223 <tel:216.368.4223> >> CEO & Co-Founder at InterRayBio, LLC >> >> Johns Hopkins University >> Bloomberg School of Public Health >> Department of Biochemistry & Molecular Biology >> >>> On Apr 1, 2020, at 00:50, James Holton <jmhol...@lbl.gov >>> <mailto:jmhol...@lbl.gov>> wrote: >>> >>> In order to do global survelinace of this new virus I figure we're going >>> to need billions of tests. The biggest barriers I believe are >>> logistical. Shipping back and forth to a central labs isn't going to >>> cut it, and neither are test kits that cost $800 each. >>> >>> I think I may have a plausible way forward to a low-cost and easily >>> mass-produced test for the SARS-CoV-2 virus using mostly items people >>> already have, such as smartphones. The most expensive reagent required >>> will be labeled oligos, but those scale very well. >>> >>> The key observation is that smartphones can detect as few as 1e6 >>> particles/mL if they do long exposures (180s). This was using >>> bioluminescence. Reported here: >>> https://www.nature.com/articles/srep40203.pdf >>> <https://www.nature.com/articles/srep40203.pdf> >>> >>> The other side of that coin is the expected titer of the virus in >>> sputum. I don't know of any reports for SARS-CoV-2 itself, but for four >>> other respiratory viruses, including one coronavirus, it ranges from 1e6 >>> to 1e8 particles/mL : >>> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/ >>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/> >>> >>> This is encouraging! The challenge will be to detect viral genomes in >>> "the field" without sophisticated lab equipment like a PCR machine, >>> lasers, 3D printers, etc. The concentration will be 1e-15 M, a >>> challenge, but then again we can detect single molecules using >>> fluorescence. The questions are: >>> 1) can we get the background low enough so that the dark current of the >>> camera dominates >>> 2) can we make the signal high enough to overcome the dark current. >>> >>> 1) will depend on the availability of mass-produced filter technology. >>> However, the best filter may simply be time. Provided the fluorophore >>> lifetime is long enough and the camera synchronization tight enough one >>> could simply measure the "afterglow" after the camera flash has turned >>> off. An interesting candidate is europium. Most fluorophores decay in >>> nanoseconds, but lanthanides can be microseconds to milliseconds. In >>> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04. >>> Those decay over minutes to hours. What I'm not sure about is using >>> them for FRET. I would appreciate input on experience with this. >>> >>> 2) I believe signal could be enhanced by using very luminous tags (such >>> as quantum dots), and/or by using multiple tags per genome. This virus >>> has the largest RNA genome known to date at 30 kbases. That means there >>> is room for up to 2000 15-mer tags, each with its own label. The set-up >>> cost for doing ~2000 oligo synthesis reactions will be high, but it can >>> be done at scale. You only need ~2 fmol of each oligo, 10 umol >>> synthesis is about $1k, so I estimate about $1 per test using 1000 >>> different oligos. This price point will be important if we want to make >>> billions of tests to be used all over the world. In some countries $1 >>> is a lot. >>> >>> The detection strategy I am focusing on is FRET. That is, oligos would >>> be made in pairs, recognizing abutting sections of the viral genome. >>> Like this: >>> 5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3' >>> which would anneal to one of the current CDC test primer sites: >>> 3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5' >>> The result in this case would be maximum FRET efficiency only when both >>> oligos are bound. From what I can tell, the ATTO465 dye is one that is >>> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and >>> ATTO550 should give maximum contrast between the green and red channels >>> of the iPhone camera. That way you would discriminate presence/absence >>> by color. Red=virus, Green=clear. That is just an example. Other tags >>> might work better. Maybe quantum dots. >>> >>> Additional aparatus would be required, of course, and at least a few >>> reagents to crack open the capsids (DTT and guanidine). These could be >>> shipped dry in foil packs. The end user would simply tear it open and >>> spit into it. If the intersted party is performing the test on >>> themselves, then there is no biohazard. Heating to 70C (cup of coffee?) >>> should kill the virus, and these reagents will make it even more dead. >>> I'm not sure how much purification would be required. The assay volume >>> in the Nature paper above was 1 mL. I expect signal would be improved >>> by concentrating the RNA as close to the camera as possible. It may >>> even be possible to absorb the nucleic acid directly onto the cover >>> glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and >>> not much else does. Quiagen EZ1 nucleic acid purificaiton columns are >>> nothing but silica glass beads after all. >>> >>> There are still details to work out, but I am intruiged by the fact that >>> this seems physically possible and the potential of being very cheap, >>> rugged, portable and scaled up rapidly. It would be nice to be able to >>> leverage a device that is in already in the hand of half the people on >>> the planet. >>> >>> Comments? Insights? >>> >>> -James Holton >>> MAD Scientist >>> >>> ######################################################################## >>> >>> To unsubscribe from the CCP4BB list, click the following link: >>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> ######################################################################## To unsubscribe from the CCP4BB list, click the following link: https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
