Here’s another link I found that should make this project feasible: https://physicsworld.com/a/smartphone-based-device-detects-norovirus/ <https://physicsworld.com/a/smartphone-based-device-detects-norovirus/>
Jürgen > On Apr 2, 2020, at 3:52 PM, Patrick Shaw Stewart <patr...@douglas.co.uk> > wrote: > > Jurgen, that was interesting. (Strange how your hair came and went during > the talk, leaving you bald sometimes - but of course that didn't matter ! ;) > > Did you know that coronavirus was first isolated at 33C and that this > temperature may be required for isolation? > https://www.bmj.com/content/3/5568/767 > <https://www.bmj.com/content/3/5568/767> > https://www.sciencedirect.com/science/article/pii/S019665531730901X > <https://www.sciencedirect.com/science/article/pii/S019665531730901X> > > We don't know why the virus stays in the throat in many people, but at other > times it goes to the lungs. ACE2 is predicted to be highly expressed in the > mouth and nose as well as the lungs. > https://www.researchsquare.com/article/rs-16992/v1 > <https://www.researchsquare.com/article/rs-16992/v1> > > A recent Nature paper noted that "sequence-distinct virus populations were > consistently detected in throat and lung samples from the same patient, > proving independent replication" > https://www.nature.com/articles/s41586-020-2196-x > <https://www.nature.com/articles/s41586-020-2196-x> > > It would be very interesting to know whether the lung samples were less > temperature-sensitive than the throat ones, and whether this could explain > the observed divergent tropism - (which you also noted). > https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/ > <https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/> > > Thx and stay warm (see my blog) > > Patrick > > > > On Thu, Apr 2, 2020 at 4:57 PM Jurgen Bosch <jxb...@case.edu > <mailto:jxb...@case.edu>> wrote: > I’m sharing a laymen’s talk I recently gave on some aspects of Corona. I’m > not claiming to be an expert, but there is useful information in the > presentation. I skipped the intro and zoomed directly to the start of my > presentation. > > https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204 > <https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204> > > I can make the slides available if anybody wants them. > > Jürgen > >> On Apr 2, 2020, at 11:27 AM, James Holton <jmhol...@lbl.gov >> <mailto:jmhol...@lbl.gov>> wrote: >> >> Personally, if I were infected with SARS-CoV-1 instead of SARS-CoV-2 I'd >> still like to know that. >> >> It is most certainly true that the primer design must be done right: >> checking for self-annealing, low genomic variability, cross-reactivity to >> potential contaminants etc. Fortunately, we have tools for this that can be >> used at home. >> >> I agree the CRISPR-based tests are very exciting, as are many of the other >> new tests being rolled out. Assay times of 15 minutes, 5 minutes, and now 2 >> minutes have been claimed. The problem I see is they all rely on >> specialized equipment, skilled technicians and expensive reagents. Ramping >> up production to the billion-test scale may not be feasible. Even if it >> were, all the PPE needed to extract those samples safely would be >> prohibitive, as would be the sample-tracking logistics. >> >> For reasons such as this, I am curious to see if an at-home do-it-yourself >> test is possible. It may serve no purpose other than to satisfy indiviual >> curiosity, but I think it would go a long way to defusing the fear that >> comes from not knowing. This would not just be for sputum, but possibly >> doorknobs, packages, and, yes, mobile phones. >> >> And for those wondering about those nasal swabs: I've done a little >> research on them and I think the reason for going full "Total Recall" and >> sticking it way up inside your head is not because the virus is more >> concentrated there (we don't even know what the concentration is), but >> rather because potential contaminants are minimized. Think about it: PCR is >> a very sensitive technique, and you want to make sure the sample came from >> the intended patient, not the other patient who walked through the door just >> before you did after sneezing in their hand and touching the doorknob. If >> you touched that same doorknob and then <ahem> "scratched" your nose, then a >> swab of your nostrils might pick up a virus or two. That would be a false >> positive. >> >> I expect there are many aspects of current test that don't have to be the >> way they are, but nonetheless are "required" because they were inherited >> from previous tests. I expect we all have learned the hard way that in >> biological science when you are handed a protocol you follow that protocol >> to the letter. How many times have you had to teach a student that? It is >> not a bad policy, but eventually there comes a time for "assay development". >> This is when you start asking "why do we do it that way, again?" >> >> For example, swabs with calcium alginate are not allowed becuase they can >> "kill the virus". If all we want is genomic RNA, then why do we care? >> Possibly because the traditional method of identifying most pathogens is to >> culture them. The CDC protocol also recommends against cotton swabs with >> wood handles. Why? Perhaps because they contain DNA, and for PCR you >> always worry about contamination. Is there any chance the probes will >> anneal to something in the cotton or pine genomes? I doubt it, but I also >> doubt that anyone has checked. >> >> Thank you for the suggestions so far! Very interesting and helpful! >> >> -James Holton >> MAD Scientist >> >> >> On 3/31/2020 11:46 PM, Sahil Batra wrote: >>> Dear Prof. Holton, >>> >>> An innovative idea; however all of the 30 kb genome may not be useful for >>> specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity. >>> >>> A similar fluorescent detection approach for SARS Cov2 -- using the >>> indiscriminate collateral activity of Cas12 nuclease -- has been reported >>> here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf >>> <https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf> >>> Although not tested on samples from patients. >>> >>> Regards, >>> Sahil Batra >>> PhD candidate, IIT Kanpur >>> >>> On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <jxb...@case.edu >>> <mailto:jxb...@case.edu>> wrote: >>> One problem I see is the sputum, there’s a reason why swabs are made to get >>> sufficient viral material. >>> >>> Since stool samples test PCR positive that might be an easier approach to >>> get sufficient viral material. As a side note, these are not infectious >>> anymore, or at least one has not been able to infect tissue cultures from >>> stool samples. >>> >>> It’s worth a thought, I’ll need to read those papers you referenced. >>> >>> I believe I read a suitable preprint for viral load, will search for it >>> tomorrow. >>> >>> Jürgen >>> >>> >>> >>> >>> __________________________________________ >>> Jürgen Bosch, Ph.D. >>> Division of Pediatric Pulmonology and Allergy/Immunology >>> Case Western Reserve University >>> 2109 Adelbert Rd <>, BRB 835 >>> Cleveland, OH 44106 <> >>> Phone: 216.368.7565 <tel:216.368.7565> >>> Fax: 216.368.4223 <tel:216.368.4223> >>> CEO & Co-Founder at InterRayBio, LLC >>> >>> Johns Hopkins University >>> Bloomberg School of Public Health >>> Department of Biochemistry & Molecular Biology >>> >>>> On Apr 1, 2020, at 00:50, James Holton <jmhol...@lbl.gov >>>> <mailto:jmhol...@lbl.gov>> wrote: >>>> >>>> In order to do global survelinace of this new virus I figure we're going >>>> to need billions of tests. The biggest barriers I believe are >>>> logistical. Shipping back and forth to a central labs isn't going to >>>> cut it, and neither are test kits that cost $800 each. >>>> >>>> I think I may have a plausible way forward to a low-cost and easily >>>> mass-produced test for the SARS-CoV-2 virus using mostly items people >>>> already have, such as smartphones. The most expensive reagent required >>>> will be labeled oligos, but those scale very well. >>>> >>>> The key observation is that smartphones can detect as few as 1e6 >>>> particles/mL if they do long exposures (180s). This was using >>>> bioluminescence. Reported here: >>>> https://www.nature.com/articles/srep40203.pdf >>>> <https://www.nature.com/articles/srep40203.pdf> >>>> >>>> The other side of that coin is the expected titer of the virus in >>>> sputum. I don't know of any reports for SARS-CoV-2 itself, but for four >>>> other respiratory viruses, including one coronavirus, it ranges from 1e6 >>>> to 1e8 particles/mL : >>>> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/ >>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/> >>>> >>>> This is encouraging! The challenge will be to detect viral genomes in >>>> "the field" without sophisticated lab equipment like a PCR machine, >>>> lasers, 3D printers, etc. The concentration will be 1e-15 M, a >>>> challenge, but then again we can detect single molecules using >>>> fluorescence. The questions are: >>>> 1) can we get the background low enough so that the dark current of the >>>> camera dominates >>>> 2) can we make the signal high enough to overcome the dark current. >>>> >>>> 1) will depend on the availability of mass-produced filter technology. >>>> However, the best filter may simply be time. Provided the fluorophore >>>> lifetime is long enough and the camera synchronization tight enough one >>>> could simply measure the "afterglow" after the camera flash has turned >>>> off. An interesting candidate is europium. Most fluorophores decay in >>>> nanoseconds, but lanthanides can be microseconds to milliseconds. In >>>> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04. >>>> Those decay over minutes to hours. What I'm not sure about is using >>>> them for FRET. I would appreciate input on experience with this. >>>> >>>> 2) I believe signal could be enhanced by using very luminous tags (such >>>> as quantum dots), and/or by using multiple tags per genome. This virus >>>> has the largest RNA genome known to date at 30 kbases. That means there >>>> is room for up to 2000 15-mer tags, each with its own label. The set-up >>>> cost for doing ~2000 oligo synthesis reactions will be high, but it can >>>> be done at scale. You only need ~2 fmol of each oligo, 10 umol >>>> synthesis is about $1k, so I estimate about $1 per test using 1000 >>>> different oligos. This price point will be important if we want to make >>>> billions of tests to be used all over the world. In some countries $1 >>>> is a lot. >>>> >>>> The detection strategy I am focusing on is FRET. That is, oligos would >>>> be made in pairs, recognizing abutting sections of the viral genome. >>>> Like this: >>>> 5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3' >>>> which would anneal to one of the current CDC test primer sites: >>>> 3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5' >>>> The result in this case would be maximum FRET efficiency only when both >>>> oligos are bound. From what I can tell, the ATTO465 dye is one that is >>>> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and >>>> ATTO550 should give maximum contrast between the green and red channels >>>> of the iPhone camera. That way you would discriminate presence/absence >>>> by color. Red=virus, Green=clear. That is just an example. Other tags >>>> might work better. Maybe quantum dots. >>>> >>>> Additional aparatus would be required, of course, and at least a few >>>> reagents to crack open the capsids (DTT and guanidine). These could be >>>> shipped dry in foil packs. The end user would simply tear it open and >>>> spit into it. If the intersted party is performing the test on >>>> themselves, then there is no biohazard. Heating to 70C (cup of coffee?) >>>> should kill the virus, and these reagents will make it even more dead. >>>> I'm not sure how much purification would be required. The assay volume >>>> in the Nature paper above was 1 mL. I expect signal would be improved >>>> by concentrating the RNA as close to the camera as possible. It may >>>> even be possible to absorb the nucleic acid directly onto the cover >>>> glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and >>>> not much else does. Quiagen EZ1 nucleic acid purificaiton columns are >>>> nothing but silica glass beads after all. >>>> >>>> There are still details to work out, but I am intruiged by the fact that >>>> this seems physically possible and the potential of being very cheap, >>>> rugged, portable and scaled up rapidly. It would be nice to be able to >>>> leverage a device that is in already in the hand of half the people on >>>> the planet. >>>> >>>> Comments? Insights? >>>> >>>> -James Holton >>>> MAD Scientist >>>> >>>> ######################################################################## >>>> >>>> To unsubscribe from the CCP4BB list, click the following link: >>>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >>>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> >>> >>> To unsubscribe from the CCP4BB list, click the following link: >>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> >>> To unsubscribe from the CCP4BB list, click the following link: >>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1> > > -- > patr...@douglas.co.uk <mailto:patr...@douglas.co.uk> Douglas Instruments > Ltd. > Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK > Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek > > http://www.douglas.co.uk <http://www.douglas.co.uk/> > Tel: 44 (0) 148-864-9090 US toll-free 1-877-225-2034 > Regd. England 2177994, VAT Reg. GB 480 7371 36 ######################################################################## To unsubscribe from the CCP4BB list, click the following link: https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
