Personally, if I were infected with SARS-CoV-1 instead of SARS-CoV-2 I'd
still like to know that.
It is most certainly true that the primer design must be done right:
checking for self-annealing, low genomic variability, cross-reactivity
to potential contaminants etc. Fortunately, we have tools for this that
can be used at home.
I agree the CRISPR-based tests are very exciting, as are many of the
other new tests being rolled out. Assay times of 15 minutes, 5 minutes,
and now 2 minutes have been claimed. The problem I see is they all rely
on specialized equipment, skilled technicians and expensive reagents.
Ramping up production to the billion-test scale may not be feasible.
Even if it were, all the PPE needed to extract those samples safely
would be prohibitive, as would be the sample-tracking logistics.
For reasons such as this, I am curious to see if an at-home
do-it-yourself test is possible. It may serve no purpose other than to
satisfy indiviual curiosity, but I think it would go a long way to
defusing the fear that comes from not knowing. This would not just be
for sputum, but possibly doorknobs, packages, and, yes, mobile phones.
And for those wondering about those nasal swabs: I've done a little
research on them and I think the reason for going full "Total Recall"
and sticking it way up inside your head is not because the virus is more
concentrated there (we don't even know what the concentration is), but
rather because potential contaminants are minimized. Think about it:
PCR is a very sensitive technique, and you want to make sure the sample
came from the intended patient, not the other patient who walked through
the door just before you did after sneezing in their hand and touching
the doorknob. If you touched that same doorknob and then <ahem>
"scratched" your nose, then a swab of your nostrils might pick up a
virus or two. That would be a false positive.
I expect there are many aspects of current test that don't have to be
the way they are, but nonetheless are "required" because they were
inherited from previous tests. I expect we all have learned the hard
way that in biological science when you are handed a protocol you follow
that protocol to the letter. How many times have you had to teach a
student that? It is not a bad policy, but eventually there comes a time
for "assay development". This is when you start asking "why do we do it
that way, again?"
For example, swabs with calcium alginate are not allowed becuase they
can "kill the virus". If all we want is genomic RNA, then why do we
care? Possibly because the traditional method of identifying most
pathogens is to culture them. The CDC protocol also recommends against
cotton swabs with wood handles. Why? Perhaps because they contain DNA,
and for PCR you always worry about contamination. Is there any chance
the probes will anneal to something in the cotton or pine genomes? I
doubt it, but I also doubt that anyone has checked.
Thank you for the suggestions so far! Very interesting and helpful!
-James Holton
MAD Scientist
On 3/31/2020 11:46 PM, Sahil Batra wrote:
Dear Prof. Holton,
An innovative idea; however all of the 30 kb genome may not be useful
for specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity.
A similar fluorescent detection approach for SARS Cov2 -- using the
indiscriminate collateral activity of Cas12 nuclease -- has been
reported here:
https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf
Although not tested on samples from patients.
Regards,
Sahil Batra
PhD candidate, IIT Kanpur
On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <[email protected]
<mailto:[email protected]>> wrote:
One problem I see is the sputum, there’s a reason why swabs are
made to get sufficient viral material.
Since stool samples test PCR positive that might be an easier
approach to get sufficient viral material. As a side note, these
are not infectious anymore, or at least one has not been able to
infect tissue cultures from stool samples.
It’s worth a thought, I’ll need to read those papers you referenced.
I believe I read a suitable preprint for viral load, will search
for it tomorrow.
Jürgen
__________________________________________
Jürgen Bosch, Ph.D.
Division of Pediatric Pulmonology and Allergy/Immunology
Case Western Reserve University
2109 Adelbert Rd, BRB 835
Cleveland, OH 44106
Phone: 216.368.7565 <tel:216.368.7565>
Fax: 216.368.4223 <tel:216.368.4223>
CEO & Co-Founder at InterRayBio, LLC
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology
On Apr 1, 2020, at 00:50, James Holton <[email protected]
<mailto:[email protected]>> wrote:
In order to do global survelinace of this new virus I figure
we're going
to need billions of tests. The biggest barriers I believe are
logistical. Shipping back and forth to a central labs isn't
going to
cut it, and neither are test kits that cost $800 each.
I think I may have a plausible way forward to a low-cost and easily
mass-produced test for the SARS-CoV-2 virus using mostly items
people
already have, such as smartphones. The most expensive reagent
required
will be labeled oligos, but those scale very well.
The key observation is that smartphones can detect as few as 1e6
particles/mL if they do long exposures (180s). This was using
bioluminescence. Reported here:
https://www.nature.com/articles/srep40203.pdf
The other side of that coin is the expected titer of the virus in
sputum. I don't know of any reports for SARS-CoV-2 itself, but
for four
other respiratory viruses, including one coronavirus, it ranges
from 1e6
to 1e8 particles/mL :
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/
This is encouraging! The challenge will be to detect viral
genomes in
"the field" without sophisticated lab equipment like a PCR machine,
lasers, 3D printers, etc. The concentration will be 1e-15 M, a
challenge, but then again we can detect single molecules using
fluorescence. The questions are:
1) can we get the background low enough so that the dark current
of the
camera dominates
2) can we make the signal high enough to overcome the dark current.
1) will depend on the availability of mass-produced filter
technology.
However, the best filter may simply be time. Provided the
fluorophore
lifetime is long enough and the camera synchronization tight
enough one
could simply measure the "afterglow" after the camera flash has
turned
off. An interesting candidate is europium. Most fluorophores
decay in
nanoseconds, but lanthanides can be microseconds to
milliseconds. In
fact, "glow-in-the-dark" toys usually use europium-doped ZnS or
SrAl04.
Those decay over minutes to hours. What I'm not sure about is using
them for FRET. I would appreciate input on experience with this.
2) I believe signal could be enhanced by using very luminous tags
(such
as quantum dots), and/or by using multiple tags per genome. This
virus
has the largest RNA genome known to date at 30 kbases. That means
there
is room for up to 2000 15-mer tags, each with its own label. The
set-up
cost for doing ~2000 oligo synthesis reactions will be high, but
it can
be done at scale. You only need ~2 fmol of each oligo, 10 umol
synthesis is about $1k, so I estimate about $1 per test using 1000
different oligos. This price point will be important if we want
to make
billions of tests to be used all over the world. In some
countries $1
is a lot.
The detection strategy I am focusing on is FRET. That is, oligos
would
be made in pairs, recognizing abutting sections of the viral genome.
Like this:
5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3'
which would anneal to one of the current CDC test primer sites:
3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5'
The result in this case would be maximum FRET efficiency only
when both
oligos are bound. From what I can tell, the ATTO465 dye is one
that is
most sensitive to the blue peak in the iPhone "flash" LED
spectrum, and
ATTO550 should give maximum contrast between the green and red
channels
of the iPhone camera. That way you would discriminate
presence/absence
by color. Red=virus, Green=clear. That is just an example. Other
tags
might work better. Maybe quantum dots.
Additional aparatus would be required, of course, and at least a few
reagents to crack open the capsids (DTT and guanidine). These
could be
shipped dry in foil packs. The end user would simply tear it
open and
spit into it. If the intersted party is performing the test on
themselves, then there is no biohazard. Heating to 70C (cup of
coffee?)
should kill the virus, and these reagents will make it even more
dead.
I'm not sure how much purification would be required. The assay
volume
in the Nature paper above was 1 mL. I expect signal would be
improved
by concentrating the RNA as close to the camera as possible. It may
even be possible to absorb the nucleic acid directly onto the cover
glass of the smartphone camera. RNA sticks to glass at pH < 7.5,
and
not much else does. Quiagen EZ1 nucleic acid purificaiton
columns are
nothing but silica glass beads after all.
There are still details to work out, but I am intruiged by the
fact that
this seems physically possible and the potential of being very
cheap,
rugged, portable and scaled up rapidly. It would be nice to be
able to
leverage a device that is in already in the hand of half the
people on
the planet.
Comments? Insights?
-James Holton
MAD Scientist
########################################################################
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
------------------------------------------------------------------------
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
------------------------------------------------------------------------
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
########################################################################
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1