On Apr 2, 2020, at 11:27 AM, James Holton <[email protected]
<mailto:[email protected]>> wrote:
Personally, if I were infected with SARS-CoV-1 instead of
SARS-CoV-2 I'd still like to know that.
It is most certainly true that the primer design must be done
right: checking for self-annealing, low genomic variability,
cross-reactivity to potential contaminants etc. Fortunately, we
have tools for this that can be used at home.
I agree the CRISPR-based tests are very exciting, as are many of
the other new tests being rolled out. Assay times of 15
minutes, 5 minutes, and now 2 minutes have been claimed. The
problem I see is they all rely on specialized equipment, skilled
technicians and expensive reagents. Ramping up production to
the billion-test scale may not be feasible. Even if it were, all
the PPE needed to extract those samples safely would be
prohibitive, as would be the sample-tracking logistics.
For reasons such as this, I am curious to see if an at-home
do-it-yourself test is possible. It may serve no purpose other
than to satisfy indiviual curiosity, but I think it would go a
long way to defusing the fear that comes from not knowing. This
would not just be for sputum, but possibly doorknobs, packages,
and, yes, mobile phones.
And for those wondering about those nasal swabs: I've done a
little research on them and I think the reason for going full
"Total Recall" and sticking it way up inside your head is not
because the virus is more concentrated there (we don't even know
what the concentration is), but rather because potential
contaminants are minimized. Think about it: PCR is a very
sensitive technique, and you want to make sure the sample came
from the intended patient, not the other patient who walked
through the door just before you did after sneezing in their
hand and touching the doorknob. If you touched that same
doorknob and then <ahem> "scratched" your nose, then a swab of
your nostrils might pick up a virus or two. That would be a
false positive.
I expect there are many aspects of current test that don't have
to be the way they are, but nonetheless are "required" because
they were inherited from previous tests. I expect we all have
learned the hard way that in biological science when you are
handed a protocol you follow that protocol to the letter. How
many times have you had to teach a student that? It is not a
bad policy, but eventually there comes a time for "assay
development". This is when you start asking "why do we do it
that way, again?"
For example, swabs with calcium alginate are not allowed
becuase they can "kill the virus". If all we want is genomic
RNA, then why do we care? Possibly because the traditional
method of identifying most pathogens is to culture them. The
CDC protocol also recommends against cotton swabs with wood
handles. Why? Perhaps because they contain DNA, and for PCR
you always worry about contamination. Is there any chance the
probes will anneal to something in the cotton or pine genomes?
I doubt it, but I also doubt that anyone has checked.
Thank you for the suggestions so far! Very interesting and helpful!
-James Holton
MAD Scientist
On 3/31/2020 11:46 PM, Sahil Batra wrote:
Dear Prof. Holton,
An innovative idea; however all of the 30 kb genome may not be
useful for specific detection - SARS-CoV1 and SARS-CoV2 share
80% identity.
A similar fluorescent detection approach for SARS Cov2 -- using
the indiscriminate collateral activity of Cas12 nuclease -- has
been reported here:
https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf
Although not tested on samples from patients.
Regards,
Sahil Batra
PhD candidate, IIT Kanpur
On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <[email protected]
<mailto:[email protected]>> wrote:
One problem I see is the sputum, there’s a reason why swabs
are made to get sufficient viral material.
Since stool samples test PCR positive that might be an
easier approach to get sufficient viral material. As a side
note, these are not infectious anymore, or at least one has
not been able to infect tissue cultures from stool samples.
It’s worth a thought, I’ll need to read those papers you
referenced.
I believe I read a suitable preprint for viral load, will
search for it tomorrow.
Jürgen
__________________________________________
Jürgen Bosch, Ph.D.
Division of Pediatric Pulmonology and Allergy/Immunology
Case Western Reserve University
2109 Adelbert Rd, BRB 835
Cleveland, OH 44106
Phone: 216.368.7565 <tel:216.368.7565>
Fax: 216.368.4223 <tel:216.368.4223>
CEO & Co-Founder at InterRayBio, LLC
Johns Hopkins University
Bloomberg School of Public Health
Department of Biochemistry & Molecular Biology
On Apr 1, 2020, at 00:50, James Holton <[email protected]
<mailto:[email protected]>> wrote:
In order to do global survelinace of this new virus I
figure we're going
to need billions of tests. The biggest barriers I believe are
logistical. Shipping back and forth to a central labs
isn't going to
cut it, and neither are test kits that cost $800 each.
I think I may have a plausible way forward to a low-cost
and easily
mass-produced test for the SARS-CoV-2 virus using mostly
items people
already have, such as smartphones. The most expensive
reagent required
will be labeled oligos, but those scale very well.
The key observation is that smartphones can detect as few
as 1e6
particles/mL if they do long exposures (180s). This was using
bioluminescence. Reported here:
https://www.nature.com/articles/srep40203.pdf
The other side of that coin is the expected titer of the
virus in
sputum. I don't know of any reports for SARS-CoV-2 itself,
but for four
other respiratory viruses, including one coronavirus, it
ranges from 1e6
to 1e8 particles/mL :
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/
This is encouraging! The challenge will be to detect
viral genomes in
"the field" without sophisticated lab equipment like a PCR
machine,
lasers, 3D printers, etc. The concentration will be 1e-15
M, a
challenge, but then again we can detect single molecules
using
fluorescence. The questions are:
1) can we get the background low enough so that the dark
current of the
camera dominates
2) can we make the signal high enough to overcome the dark
current.
1) will depend on the availability of mass-produced filter
technology.
However, the best filter may simply be time. Provided the
fluorophore
lifetime is long enough and the camera synchronization
tight enough one
could simply measure the "afterglow" after the camera
flash has turned
off. An interesting candidate is europium. Most
fluorophores decay in
nanoseconds, but lanthanides can be microseconds to
milliseconds. In
fact, "glow-in-the-dark" toys usually use europium-doped
ZnS or SrAl04.
Those decay over minutes to hours. What I'm not sure
about is using
them for FRET. I would appreciate input on experience with
this.
2) I believe signal could be enhanced by using very
luminous tags (such
as quantum dots), and/or by using multiple tags per
genome. This virus
has the largest RNA genome known to date at 30 kbases.
That means there
is room for up to 2000 15-mer tags, each with its own
label. The set-up
cost for doing ~2000 oligo synthesis reactions will be
high, but it can
be done at scale. You only need ~2 fmol of each oligo, 10
umol
synthesis is about $1k, so I estimate about $1 per test
using 1000
different oligos. This price point will be important if we
want to make
billions of tests to be used all over the world. In some
countries $1
is a lot.
The detection strategy I am focusing on is FRET. That is,
oligos would
be made in pairs, recognizing abutting sections of the
viral genome.
Like this:
5' atttcgctgattttggggtc-ATTO465
ATTO550-cattatcagacattttagt 3'
which would anneal to one of the current CDC test primer
sites:
3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5'
The result in this case would be maximum FRET efficiency
only when both
oligos are bound. From what I can tell, the ATTO465 dye
is one that is
most sensitive to the blue peak in the iPhone "flash" LED
spectrum, and
ATTO550 should give maximum contrast between the green and
red channels
of the iPhone camera. That way you would discriminate
presence/absence
by color. Red=virus, Green=clear. That is just an
example. Other tags
might work better. Maybe quantum dots.
Additional aparatus would be required, of course, and at
least a few
reagents to crack open the capsids (DTT and guanidine).
These could be
shipped dry in foil packs. The end user would simply tear
it open and
spit into it. If the intersted party is performing the
test on
themselves, then there is no biohazard. Heating to 70C
(cup of coffee?)
should kill the virus, and these reagents will make it
even more dead.
I'm not sure how much purification would be required. The
assay volume
in the Nature paper above was 1 mL. I expect signal would
be improved
by concentrating the RNA as close to the camera as
possible. It may
even be possible to absorb the nucleic acid directly onto
the cover
glass of the smartphone camera. RNA sticks to glass at pH
< 7.5, and
not much else does. Quiagen EZ1 nucleic acid purificaiton
columns are
nothing but silica glass beads after all.
There are still details to work out, but I am intruiged by
the fact that
this seems physically possible and the potential of being
very cheap,
rugged, portable and scaled up rapidly. It would be nice
to be able to
leverage a device that is in already in the hand of half
the people on
the planet.
Comments? Insights?
-James Holton
MAD Scientist
########################################################################
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
------------------------------------------------------------------------
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
------------------------------------------------------------------------
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
------------------------------------------------------------------------
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1