Re: [freenet-support] OS X Problems
- Original Message - From: "Noah Silverman" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Tuesday, August 24, 2004 4:22 AM Subject: [freenet-support] OS X Problems > Hi, > > I was able to download the latest package. > > For some reason, it won't run unless I comment out the line about: > JAVA_ARGS="-XX:MaxDirectMemorySize=128m $JAVA_ARGS" > > Once that is done, I can start freenet. Do you get any type of error message? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] OS X Problems
What about the logs? /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Noah > Silverman > Sent: den 24 augusti 2004 07:49 > To: [EMAIL PROTECTED] > Subject: Re: [freenet-support] OS X Problems > > > Only in the browser window. The terminal session where I > start freenet > seems fine. > > Below is a typical start... > > sh start-freenet.sh > Detected freenet-ext.jar > Detected freenet.jar > Sun java detected. > Sun Java 1.4.2 detected. > Starting Freenet now: Command line: java -Xmx128m > freenet.node.Main Done G4-17:~/Desktop/freenet noah$ INFO: > Native CPUID library jcpuid not > loaded, reason: 'Dont know jcpuid library name for os type > 'Mac OS X'' - > will not be able to read CPU information using CPUID > INFO: Native BigInteger library jbigi not loaded, reason: 'Dont know > jbigi library name for os type 'Mac OS X'' - using pure java > > > > > > Niklas Bergh wrote: > > > - Original Message - > > From: "Noah Silverman" <[EMAIL PROTECTED]> > > To: <[EMAIL PROTECTED]> > > Sent: Tuesday, August 24, 2004 4:22 AM > > Subject: [freenet-support] OS X Problems > > > > > > > >>Hi, > >> > >>I was able to download the latest package. > >> > >>For some reason, it won't run unless I comment out the line about: > >>JAVA_ARGS="-XX:MaxDirectMemorySize=128m $JAVA_ARGS" > >> > >>Once that is done, I can start freenet. > > > > > > Do you get any type of error message? > > > > /N > > ___ > > Support mailing list > > [EMAIL PROTECTED] > > http://news.gmane.org/gmane.network.freenet.support > > Unsubscribe at > > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > > Or mailto:[EMAIL PROTECTED] > > > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.su> pport > > Unsubscribe at > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > Or mailto:[EMAIL PROTECTED] > ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Virus found in Freenet Update
>Says downloader.OG is Windows-specific. This suggests it can't possibly >have infected a JAR file. Okay, WHICH FILE did it report was infected? [12:16] I'm still curious about this "downloader-og" that my antivirus claims that "nodeconfig.exe" contains. Is my AV fscked up or is something else a bit fishy? cheers /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Is this a problem?
Yes probably.. But they have been around forever, at least for windows users? /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Plonk > Sent: den 27 augusti 2004 22:57 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Is this a problem? > > > I get lots of these in my log: > > Delete failed on bucket t356f9930 > > Is this something I should be worried about? > > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.su> pport > > Unsubscribe at > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > Or mailto:[EMAIL PROTECTED] > ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Is this a problem?
Believe me.. I have tried. The probable cause is that something somewhere forgets to close a file it is holding... I haven't managed to find out eactly what code it is though. /N >Hmm. Since they don't happen on windows, they don't get debugged.. >Unless you want to have a crack at them Iakin? > >On Sun, Aug 29, 2004 at 02:01:56PM +0200, Niklas Bergh wrote: >> Yes probably.. But they have been around forever, at least for windows >> users? >> >> /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] is there any documentation
Well, the load section in the general information page really is the best documenation of how the load factor is calculated. The load section of the general information page explains, both the formula for how the load is calculated, as well as what values that your node currently puts on the different factors that are included in the formula. /N On Sun, September 12, 2004 23:47, UltraRed said: > that explains what the "load status" means on the freenet web interface? > > also, who do i interpret the other data under "load" on the general information page > as well as the other pages? > > thanks. > > UltraRed___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] freenet.conf empty
Try running the freenet jar with a '--config' parameter. This should allow you to create a new freenet.conf file. On Mon, September 13, 2004 1:20, daniele said: > Hi! > I installed java, and run sh start-freenet.sh. I can use the interface, > and i can also browse something. BUT, my freenet.conf file contains only > 2 lines, and no conf questions where asked when at start-up. I remember > I had the same problem when some months ago I tryed to install freenet, > but I don't remember the solution > Anyway, the output: > > localhost:/hdb/.freenet# sh start-freenet.sh > Detected freenet-ext.jar > Detected freenet.jar > Sun java detected. > Sun Java 1.4.2 detected. > Starting Freenet now: Command line: java -Xmx128m > -XX:MaxDirectMemorySize=128m freenet.node.Main > Done > localhost:/hdb/.freenet# INFO: Native CPUID library > 'freenet/support/CPUInformation/libjcpuid-x86-linux.so' loaded from resource > INFO: Optimized native BigInteger library > 'net/i2p/util/libjbigi-linux-pentium3.so' loaded from resource > > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > Or mailto:[EMAIL PROTECTED] > ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] is there any documentation
On Tue, September 14, 2004 1:27, UltraRed said: > that explains what the "load status" means on the freenet web interface? Yes, it states the exact factors that makes up the 'load' > also, who do i interpret the other data under "load" on the general information page Well, what can I say.. it is a textual representation of the different formulas for calculating the load. Tha actual load then is the maximum oof those calculated loads. > as well as the other pages? Please be more specific, there is at least 20 pages there. cheers /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] 5098 Errors sendingPacket == null!
Actually, it seems to have started getting better now.. I haven't seen any of those messages for a while in the log. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Toad Sent: den 23 oktober 2004 13:25 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] 5098 Errors sendingPacket == null! Argh. As usual it doesn't happen for me, so I can't fix it :< On Sat, Oct 23, 2004 at 10:28:25AM +0200, Niklas wrote: > Similar issue here.. > > /N > > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Wayne McDougall > Sent: den 23 oktober 2004 08:59 > To: [EMAIL PROTECTED] > Subject: [freenet-support] 5098 Errors sendingPacket == null! > > Running 5098 on Windows XP SP2 768 Mb RAM > > More information available on request. The node is non-responsive. From > "Recent > Logs" > > 19:47:04 jobDone(160,true) on [EMAIL PROTECTED] but > sendingPacket == null!- > 19:48:52 resetting - > 19:48:52 jobDone(160,true) on [EMAIL PROTECTED] > but > sendingPacket == null!- > 19:48:57 Failed to send packet, no more conns, No open connections > and no way to > contact node: DISCARDING > [EMAIL PROTECTED]@[EMAIL PROTECTED] > (null,null): outbound attempts=0:0/0:freenet.Message: beee48: DataChunk > @a3c1cfa4a430cdae:null:[EMAIL PROTECTED]:tru > e, > prio=1, expiryTime=1098514437842(-30 ms ago) on > [EMAIL PROTECTED] > (null,null): outbound attempts=0:0/0 - > 19:49:03 jobDone(160,true) on [EMAIL PROTECTED] but > sendingPacket == null!- > 19:49:18 Consecutive same winner: > [EMAIL PROTECTED]: > timeToSendWindow=0, [EMAIL PROTECTED] (DSA(296b 4c9c 8e19 ef59 > f21c > c003 36a6 3027 3b86 d9c2),tcp/romper.dyndns.org:26243, sessions=1, > presentations=3, ID=DSA(296b 4c9c 8e19 ef59 f21c c003 36a6 3027 3b86 d9c2), > version=Fred,0.5,STABLE-1.51,5098): outbound attempts=1:0/1 on > [EMAIL PROTECTED]: id=7668f1c687d0a1f9, > expiresAt=1098514218352 (59570 ms), > [EMAIL PROTECTED] > DataRequest @null @ 7668f1c687d0a1f9, > [EMAIL PROTECTED]@7668f1c687d0a1f9,t > rue@ > -1:1098514158352:false:null:[EMAIL PROTECTED] DataRequest > @null > @ 7668f1c687d0a1f9, sendTimeout=17720, > [EMAIL PROTECTED] > (ea8568751ef624ead2e446baf8ce0a95852586580f0203,request), > EstimateList=freenet.node.rt.ForgettingEstimateList: length=106, at=0, > noConnCount=0, backedOffCount=4 4 times - > 19:49:18 Consecutive same winner: > [EMAIL PROTECTED]: > timeToSendWindow=0, [EMAIL PROTECTED] (DSA(296b 4c9c 8e19 ef59 > f21c > c003 36a6 3027 3b86 d9c2),tcp/romper.dyndns.org:26243, sessions=1, > presentations=3, ID=DSA(296b 4c9c 8e19 ef59 f21c c003 36a6 3027 3b86 d9c2), > version=Fred,0.5,STABLE-1.51,5098): outbound attempts=1:0/1 on > [EMAIL PROTECTED]: id=7668f1c687d0a1f9, > expiresAt=1098514218352 (59570 ms), > [EMAIL PROTECTED] > DataRequest @null @ 7668f1c687d0a1f9, > [EMAIL PROTECTED]@7668f1c687d0a1f9,t > rue@ > -1:1098514158352:false:null:[EMAIL PROTECTED] DataRequest > @null > @ 7668f1c687d0a1f9, sendTimeout=17720, > [EMAIL PROTECTED] > (ea8568751ef624ead2e446baf8ce0a95852586580f0203,request), > EstimateList=freenet.node.rt.ForgettingEstimateList: length=106, at=0, > noConnCount=0, backedOffCount=5 5 times > > Continues on like this > > The node itself has effectively stopped functioning. > > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > Unsubscribe at > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > Or mailto:[EMAIL PROTECTED] > > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > Or mailto:[EMAIL PROTECTED] -- Matthew J Toseland - [EMAIL PROTECTED] Freenet Project Official Codemonkey - http://freenetproject.org/ ICTHUS - Nothing is impossible. Our Boss says so. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Re: 5098 Errors sendingPacket == null!
Here is yet a new message from the log, quite common.. seems to come in bursts: Did not terminate [EMAIL PROTECTED] (f6dd7956f46d3d344f81ba78e5edee7a628ac54d120302,insert), EstimateList=freenet.node.rt.ForgettingEstimateList: length=199, at=0, noConnCount=0, backedOffCount=0 /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Wayne McDougall Sent: den 24 oktober 2004 23:44 To: [EMAIL PROTECTED] Subject: [freenet-support] Re: 5098 Errors sendingPacket == null! Niklas Bergh <[EMAIL PROTECTED]> writes: > Actually, it seems to have started getting better now.. I haven't seen any > of those messages for a while in the log. No better for me. Last one in the log was less than 2 hours ago. 9:01:13 AM (freenet.MuxConnectionHandler, Network writing thread, ERROR): jobDone(160,true) on [EMAIL PROTECTED] but sendingPacket == null! Consecutive same winner errors are now everywhere: 10:31:43Consecutive same winner: [EMAIL PROTECTED]: timeToSendWindow=0, [EMAIL PROTECTED] (DSA(7f3a 5eec db54 57ee a534 8715 0928 d369 bf47 a9d0),tcp/iakin.poweruser.org:26828, sessions=1, presentations=3, ID=DSA(7f3a 5eec db54 57ee a534 8715 0928 d369 bf47 a9d0), version=Fred,0.5,STABLE-1.51,5098): outbound attempts=5:0/5 on [EMAIL PROTECTED]: id=65a8258c50575a40, expiresAt=1098653506249 (2379 ms), [EMAIL PROTECTED] DataRequest @null @ 65a8258c50575a40, [EMAIL PROTECTED]@65a8258c50575a40, [EMAIL PROTECTED]:1098653503249:false:null:[EMAIL PROTECTED] DataRequest @null @ 65a8258c50575a40, sendTimeout=17720, [EMAIL PROTECTED] (601d992fd890b89d4bdb0f5ff5d84018c231a5440f0203,request), EstimateList=freenet.node.rt.ForgettingEstimateList: length=76, at=0, noConnCount=0, backedOffCount=11 11 times ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] DeBarsacCharleshenri?
I'm in as MikaMikado too... /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Stephen Mollett Sent: den 22 november 2002 10:04 To: [EMAIL PROTECTED] Subject: RE: [freenet-support] DeBarsacCharleshenri? I just tried it and got logged in as MikaMikado... Definitely something seriously wrong with security on the webserver. :-/ Stephen --- Pete Soden <[EMAIL PROTECTED]> wrote: > Way hey I've just logged in as him as well! Not a > good situation for the > project really. > > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED]]On Behalf Of Doug Bostrom > Sent: 22 November 2002 01:13 > To: [EMAIL PROTECTED] > Subject: [freenet-support] DeBarsacCharleshenri? > > > Anybody else seeing a weird symptom with the freenetproject.org site, > namely that > visiting the page automatically logs you in as > "DeBarsacCharleshenri" with > all > rights and privileges pertaining? > ... = == Buy a Pentium 4 (tm) for more accurate errors, faster crashes, brighter blue screens and quicker reboots! __ Do You Yahoo!? Everything you'll ever need on one web page from News and Sport to Email and Music Charts http://uk.my.yahoo.com ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Stale threads
I think I'm seeing the (once before mentioned) problem with threads dying (or at least idling). My node has been running for 20 hours straight now. Requests have dropped from about 10k/hour to 100/hour, connections have dropped from 50-100 active to 3, incoming connections graph looks like an inverse logarithmic graph. My processor is unused (5% load) and there is no network activity worth mentioning. This is what the 'General information' page in fred says: Node Version 0.5 Protocol Version 1.46 Build Number 537 CVS Revision 1.90.2.13 Uptime 19 hours 9 minutes Load Current routingTime 0ms Active pooled jobs 208 (104.0%) [Rejecting incoming connections and requests!] Available threads 34 It's normal for the node to sometimes reject connections or requestsfor a limited period. If you're seeing rejections continuously the node is overloaded or something is wrong (i.e. a bug). Current estimated load 100.0% Note the extreme difference between my machine:s actual load (5%) and freds estimated load (100%) If I look under 'environment': Class Threads used freenet.Message: NodeAnnouncement 1 freenet.interfaces.PublicInterface$ConnectionShell 36 freenet.interfaces.LocalInterface$ConnectionShell 2 freenet.Message: DataRequest 5 freenet.OpenConnectionManager$ConnectionJob 188 freenet.client.InternalClient$ClientMessageVector 1 I think that 188 threads in ConnectionJob and 36 threads in ConnectionShell is quite a bit to high for my puny 3 active connections. Ideas? /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Stale threads
Going to be a little rude answering to my own post... Shutting down and restarting the node made it works as supposed again, connections are booming and processor and bandwidth is used again. Can it be so that the load estimation routine is sort of 'leaking' resources. Maybe it was a missguided effort from the overload protection mechanism that made my node unusable? Many of my threads where allocated to 'ConnectionJob', can it be so that the only thing they where doing was rejecting connections (also a kind of ConnectionJob I guess)? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Niklas Bergh Sent: den 25 november 2002 10:07 To: [EMAIL PROTECTED] Subject: [freenet-support] Stale threads I think I'm seeing the (once before mentioned) problem with threads dying (or at least idling). My node has been running for 20 hours straight now. Requests have dropped from about 10k/hour to 100/hour, connections have dropped from 50-100 active to 3, incoming connections graph looks like an inverse logarithmic graph. My processor is unused (5% load) and there is no network activity worth mentioning. This is what the 'General information' page in fred says: Node Version 0.5 Protocol Version 1.46 Build Number 537 CVS Revision 1.90.2.13 Uptime 19 hours 9 minutes Load Current routingTime 0ms Active pooled jobs 208 (104.0%) [Rejecting incoming connections and requests!] Available threads 34 It's normal for the node to sometimes reject connections or requestsfor a limited period. If you're seeing rejections continuously the node is overloaded or something is wrong (i.e. a bug). Current estimated load 100.0% Note the extreme difference between my machine:s actual load (5%) and freds estimated load (100%) If I look under 'environment': Class Threads used freenet.Message: NodeAnnouncement 1 freenet.interfaces.PublicInterface$ConnectionShell 36 freenet.interfaces.LocalInterface$ConnectionShell 2 freenet.Message: DataRequest 5 freenet.OpenConnectionManager$ConnectionJob 188 freenet.client.InternalClient$ClientMessageVector 1 I think that 188 threads in ConnectionJob and 36 threads in ConnectionShell is quite a bit to high for my puny 3 active connections. Ideas? /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] multiple datastore
I guess he means that if you have a look in your datastore directory you will notice multiple directories 0,1,1a and so on. You can symlink these to a folder on another of your drives/partitions (and the files will be stored there instead). An alternative can be to mount your disks/partitions directly under one or more of the directories in the datastore folder (but I'm not sure I would recommend that, to unflexible). /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Sägesser Lukas Sent: den 25 november 2002 10:19 To: [EMAIL PROTECTED] Subject: AW: [freenet-support] multiple datastore i'm sorry, i didn't understand that "symlink in space on different partitions". can you explain please ? :) i'm running linux. -Ursprüngliche Nachricht- Von: Edgar Friendly [mailto:[EMAIL PROTECTED]] Gesendet: Sonntag, 24. November 2002 22:48 An: [EMAIL PROTECTED] Betreff: Re: [freenet-support] multiple datastore Sägesser Lukas <[EMAIL PROTECTED]> writes: > hi, > > is it not possible to have multiple native datastores ? > i'd love to donate more diskspace, but its split on several hard disks symlink in space on different partitions. If running windows, re-partition. Thelema -- E-mail: [EMAIL PROTECTED] Raabu and Piisu GPG 1024D/36352AAB fpr:756D F615 B4F3 BFFC 02C7 84B7 D8D7 6ECE 3635 2AAB ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Stale threads
Well.. It happened again, now with version 539. # Current routingTime: 0ms. # Active pooled jobs: 300 (100.0%) # Current estimated load: 100.0%. And my processor is doing nothing but idling... My node worked fine for a week or so, then last night I increased the number of threads from 200 to 300. Bandwidth usage increased by about 30% (which was also my goal with the change) and I thought that all was fine but today my node is doing absolutely nothing. A restart solved the problem this time also, bandwidth usage is now back to somewhere between 1 and 1.5MBit/s, but I don't really like the idea of having to do one or two restarts a day to keep my node working. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Niklas Bergh Sent: den 25 november 2002 10:28 To: [EMAIL PROTECTED] Subject: RE: [freenet-support] Stale threads Going to be a little rude answering to my own post... Shutting down and restarting the node made it works as supposed again, connections are booming and processor and bandwidth is used again. Can it be so that the load estimation routine is sort of 'leaking' resources. Maybe it was a missguided effort from the overload protection mechanism that made my node unusable? Many of my threads where allocated to 'ConnectionJob', can it be so that the only thing they where doing was rejecting connections (also a kind of ConnectionJob I guess)? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Niklas Bergh Sent: den 25 november 2002 10:07 To: [EMAIL PROTECTED] Subject: [freenet-support] Stale threads I think I'm seeing the (once before mentioned) problem with threads dying (or at least idling). My node has been running for 20 hours straight now. Requests have dropped from about 10k/hour to 100/hour, connections have dropped from 50-100 active to 3, incoming connections graph looks like an inverse logarithmic graph. My processor is unused (5% load) and there is no network activity worth mentioning. This is what the 'General information' page in fred says: Node Version 0.5 Protocol Version 1.46 Build Number 537 CVS Revision 1.90.2.13 Uptime 19 hours 9 minutes Load Current routingTime 0ms Active pooled jobs 208 (104.0%) [Rejecting incoming connections and requests!] Available threads 34 It's normal for the node to sometimes reject connections or requestsfor a limited period. If you're seeing rejections continuously the node is overloaded or something is wrong (i.e. a bug). Current estimated load 100.0% Note the extreme difference between my machine:s actual load (5%) and freds estimated load (100%) If I look under 'environment': Class Threads used freenet.Message: NodeAnnouncement 1 freenet.interfaces.PublicInterface$ConnectionShell 36 freenet.interfaces.LocalInterface$ConnectionShell 2 freenet.Message: DataRequest 5 freenet.OpenConnectionManager$ConnectionJob 188 freenet.client.InternalClient$ClientMessageVector 1 I think that 188 threads in ConnectionJob and 36 threads in ConnectionShell is quite a bit to high for my puny 3 active connections. Ideas? /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Virus warning
A mail from this mailinglist titled "[freenet-support] Fw: Best Friends" contains the virus: W32/Lentin.F@mm Beware /N
Re: [freenet-support] Stale threads
Here it is. C:\Program Files\Freenet 0.5>java -jar freenet.jar Full thread dump Java HotSpot(TM) Client VM (1.4.1_01-b01 mixed mode): "Interface # tcp/" prio=5 tid=0x0AC65C28 nid=0x17c8 in Object.wait() [b23f00 0..b23fd8c] at java.lang.Object.wait(Native Method) - waiting on <03075E90> (a freenet.interfaces.LocalInterface) at java.lang.Object.wait(Unknown Source) at freenet.interfaces.Interface.run(Interface.java:147) - locked <03075E90> (a freenet.interfaces.LocalInterface) at java.lang.Thread.run(Unknown Source) "Interface # tcp/8481" prio=5 tid=0x0AC8F560 nid=0x1e0 in Object.wait() [b1ff000 ..b1ffd8c] at java.lang.Object.wait(Native Method) - waiting on <03075F00> (a freenet.interfaces.LocalInterface) at java.lang.Object.wait(Unknown Source) at freenet.interfaces.Interface.run(Interface.java:147) - locked <03075F00> (a freenet.interfaces.LocalInterface) at java.lang.Thread.run(Unknown Source) "Interface # tcp/26026" prio=5 tid=0x0AC8F008 nid=0xfe0 in Object.wait() [b1bf00 0..b1bfd8c] at java.lang.Object.wait(Native Method) - waiting on <03075F88> (a freenet.interfaces.PublicInterface) at java.lang.Object.wait(Unknown Source) at freenet.interfaces.Interface.run(Interface.java:147) - locked <03075F88> (a freenet.interfaces.PublicInterface) at java.lang.Thread.run(Unknown Source) "Ticker" daemon prio=5 tid=0x0AD341E0 nid=0xa08 in Object.wait() [b17f000..b17fd 8c] at java.lang.Object.wait(Native Method) at freenet.Ticker.run(Ticker.java:122) - locked <03076018> (a freenet.Ticker) at java.lang.Thread.run(Unknown Source) "Fproxy insert request cleanup thread." daemon prio=5 tid=0x0AD14C30 nid=0x91c i n Object.wait() [b13f000..b13fd8c] at java.lang.Object.wait(Native Method) - waiting on <03076090> (a java.util.Vector) at freenet.client.http.Reaper.run(Reaper.java:92) - locked <03076090> (a java.util.Vector) at java.lang.Thread.run(Unknown Source) "Fproxy insert request cleanup thread." daemon prio=5 tid=0x0AC6AE58 nid=0xdc4 i n Object.wait() [b0ff000..b0ffd8c] at java.lang.Object.wait(Native Method) - waiting on <03076120> (a java.util.Vector) at freenet.client.http.Reaper.run(Reaper.java:92) - locked <03076120> (a java.util.Vector) at java.lang.Thread.run(Unknown Source) "QThread-6" prio=5 tid=0x0AC29CE0 nid=0x568 in Object.wait() [b0bf000..b0bfd8c] at java.lang.Object.wait(Native Method) - waiting on <03076168> (a freenet.thread.QThreadFactory$QThread) at java.lang.Object.wait(Unknown Source) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:203) - locked <03076168> (a freenet.thread.QThreadFactory$QThread) "QThread-5" prio=5 tid=0x0AC7B228 nid=0xb90 in Object.wait() [b07f000..b07fd8c] at java.lang.Object.wait(Native Method) - waiting on <030761C0> (a freenet.thread.QThreadFactory$QThread) at java.lang.Object.wait(Unknown Source) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:203) - locked <030761C0> (a freenet.thread.QThreadFactory$QThread) "QThread-4" prio=5 tid=0x0AC7ABF8 nid=0x10d0 in Object.wait() [b03f000..b03fd8c] at java.lang.Object.wait(Native Method) - waiting on <03076218> (a freenet.thread.QThreadFactory$QThread) at java.lang.Object.wait(Unknown Source) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:203) - locked <03076218> (a freenet.thread.QThreadFactory$QThread) "QThread-3" prio=5 tid=0x00A49928 nid=0x16dc in Object.wait() [afff000..afffd8c] at java.lang.Object.wait(Native Method) - waiting on <03076270> (a freenet.thread.QThreadFactory$QThread) at java.lang.Object.wait(Unknown Source) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:203) - locked <03076270> (a freenet.thread.QThreadFactory$QThread) "QThread-2" prio=5 tid=0x00A49DF0 nid=0x9c0 in Object.wait() [afbf000..afbfd8c] at java.lang.Object.wait(Native Method) - waiting on <030762C8> (a freenet.thread.QThreadFactory$QThread) at java.lang.Object.wait(Unknown Source) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:203) - locked <030762C8> (a freenet.thread.QThreadFactory$QThread) "QThread-1" prio=5 tid=0x00A49C98 nid=0xcb8 in Object.wait() [af7f000..af7fd8c] at java.lang.Object.wait(Native Method) - waiting on <03076320> (a freenet.thread.QThreadFactory$QThread) at java.lang.Object.wait(Unknown Source) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:203) - locked <03076320> (a freenet.thread.QThreadFactory$QThread) "Thread creation thread." prio=5 tid=0x009C68C0 nid=0x1314 in Object.wait() [af3 f000..af3fd8c] at java.lang.Ob
Re: [freenet-support] Stale threads
Well, it should be the VM indicated in the text, it was itself which wrote it when I hit ctrl-Break... The symptoms are: Fred get stuck thinking that the machine is overloaded when it in fact doesn't have a thing to do. The fred load indicator is at 100% (or slightly above when viewing the textual value), taskmanager indicates a load of say, about, 5% which definitely is the correct number since the machine is as usable as if fred where shut down. Current routing time is 0 ms and the node is still QueryRejecting. I run two nodes and both exhibit the same problem. Both are running WinXP Pro and the same VM. This dump was from a my 629 node. No bandwidth-limiting or such enabled. No fiddling around with any config values except the most basic ones done. /I - Original Message - From: "Matthew Toseland" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Cc: <[EMAIL PROTECTED]> Sent: Tuesday, December 24, 2002 1:34 AM Subject: Re: [freenet-support] Stale threads ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] TFE, CRUFT & FF
Hmmm... And both of these where ones that had good link collections. Maybe it is a coordinated proof of concept, there has been much talk about the problems with the 'last single point of failure' lately. >Other sites seems to be still there, but how retrieve it if > TFE is not working ? >I bet that most of freenetters have no link > to freesites, but only to TFE I know FMB has an freesite announcement thingy.. ,maybe that would be a good startingpoint. /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Still not announcing..
Looking in your logfile I can see a couple of failed announcement attempts, I have taken a couple of guesses on what they might mean: 216.187.243.77:32374 - Peer hung up <---broken or maybe firewalled node Cannot connect to: check.ath.cx:41552 <---Node not running or have announced wrong address for itself or similar) Cannot connect to: check.ath.cx:41552 <---Node not running or have announced wrong address for itself or similar) 216.187.243.77:32374 - Peer hung up <---broken or maybe firewalled node Cannot connect to: check.ath.cx:41552 <---Node not running or have announced wrong address for itself or similar) Announcement attempt failed: freenet.Message: QueryRejected (possibly 64.32.194.167:21279)
RE: [freenet-support] build 544 - broken html
I have the same problem.. Think it has something to do with the new Anonymity filter. It basically seems like it strips som of the html tags (valid, nondangerous ones) from the page. I thought that there would be a fix in the next snapshot possible but it has been like this for three-four days now. I assume that it might be possible to disable the new anonymity filter but I haven't seen any description about ohw to do it yet.. /Niklas -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Klaus Koch Sent: den 12 januari 2003 09:13 To: [EMAIL PROTECTED] Subject: [freenet-support] build 544 - broken html I just upgraded to build 544. It seems that the html code delivered by this version is broken. anyone else got the same problem (not correctly displayed tables, non-active links, no images)? ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] 650 anonymity filtering
Have a look at the fproxy tab of the configurator... /N - Original Message - From: <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Monday, January 13, 2003 3:56 PM Subject: [freenet-support] 650 anonymity filtering > > From build 649 all site I access (including > TFE ang many others) are reduced to plaint > text withount any image or link. > > There is some setting to do in freenet.conf to > configure/disable filtering ? > > Thx. Marco > > > -- > + il Progetto Freenet - segui il coniglio bianco+ > * the Freenet Project - follow the white rabbit* > * Marco A. Calamari[EMAIL PROTECTED] www.marcoc.it* > * PGP RSA: ED84 3839 6C4D 3FFE 389F 209E 3128 5698 * > + DSS/DH: 8F3E 5BAE 906F B416 9242 1C10 8661 24A9 BFCE 822B + > > > > ___ > support mailing list > [EMAIL PROTECTED] > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] 650 anonymity filtering
ok, here it is. mainport.params.servlet.1.params.filter=false (or true) /N - Original Message - From: <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Tuesday, January 14, 2003 7:22 AM Subject: Re: [freenet-support] 650 anonymity filtering > > At 19.26 13/01/03 +0100, you wrote: > >Have a look at the fproxy tab of the configurator... > > I'm from the Linux side, no tab at all > > and no java compiler in place too, > just plain C . > > Ciao. Marco > > > > ___ > support mailing list > [EMAIL PROTECTED] > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Duplicate connections to/from fred
Just noticed this in my open connections list: 81.67.105.85:14623 1147625 no 132 0 114064 QThread-99 Outbound 1bca1c3 81.67.105.85:14623 12099820 no 2 0 77511 QThread-194 Outbound 12022b7 Two outbound connections from my node to the same other node. Is that correct? I did updatesnapshot just 30 minutes ago so I have the newest 544 (the one with a working anonymity filter). /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Node suddenly ceases traffic
This problem is very similar to the problem I have been wrestling with for some time... If you look in your 'Node Status Info' page, what CurrentRoutingTime do you see. Is it 0 and the row below still says that there are many pooled jobs and that your node is currently queryrejecting it might be the same problem. My problem appeared when I raised the number of threads in order to make my node use more of the available bandwidth. /N - Original Message - From: "Chris Linstruth" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Wednesday, January 15, 2003 11:02 PM Subject: Re: [freenet-support] Node suddenly ceases traffic > > On Wed, 15 Jan 2003, Matthew Toseland wrote: > > > On Wed, Jan 15, 2003 at 11:03:07AM -0800, Chris Linstruth wrote: > > > Finally looks like my announcement problem "fixed itself." Now I'm > > > seeing the same problem I was having a couple months ago on build 529. > > > > > > The node chugs along merrily until something happens and traffic stops > > > and it queryrejects everything. Attached are a couple mrtg graphs. > > Are you using the IBM JVM? Please don't do that. > > No. > > JVM Vendor Sun Microsystems Inc. > JVM Name Java HotSpot(TM) Server VM > JVM Version 1.4.1_01-b01 > > -- > Chris Linstruth <[EMAIL PROTECTED]> > QNET > 1529 East Palmdale Blvd Suite 200 > Palmdale, CA 93550 > (661) 538-2028 > > > > ___ > support mailing list > [EMAIL PROTECTED] > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Node suddenly ceases traffic
>On Thu, Jan 16, 2003 at 10:16:49AM -0800, Chris Linstruth wrote: >> Exactly what I'm seeing. When I stop/restart it'll run for >> give-or-take a few hours, 48 hours then usage will go to 0, 0ms >> CurrentRoutingTime. >What exact build number is this? I have seen this phenomenon with builds 537,539 and 629. Running on windows XP with Suns java-engine 1.4.1_01-b01 > And please send me a log file, with logLevel=debug, and a thread dump, which you get by kill -QUIT'ing the node. I've sent a thread-dump once before, see that one for an example. I tried to generate debug-level logfiles but those became somewhere between 5 and 10 gigabytes before the problem arised so I skipped that idea. I am currently running 544 and it just _might_ work better, I'm not totally sure yet though. I have two 544 nodes running 300 resp 500 threads and they have been running for 49 hours and 43 hours resp. and still seems to work as they should. I'll drop a mail if the problem arises in either of them. And, on a totally different subject, would it be possible to get counters/graphs for bytes sent/bytes in sendqueue (thank you for that one, whoever added it to the open connections page)/bandwidth consumed in the diagnostics page? It would be a really nice feature to have I think. /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Node suddenly ceases traffic
:) Just out of curiosity, how large was it before it was compressed? /N - Original Message - From: "Chris Linstruth" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Tuesday, January 21, 2003 12:22 AM Subject: Re: [freenet-support] Node suddenly ceases traffic > It's 547 MB gzipped. > > -- > Chris Linstruth <[EMAIL PROTECTED]> > QNET > 1529 East Palmdale Blvd Suite 200 > Palmdale, CA 93550 > (661) 538-2028 > > > On Mon, 20 Jan 2003, Matthew Toseland wrote: > > > On Mon, Jan 20, 2003 at 01:04:13PM -0800, Chris Linstruth wrote: > > > -rw-rw-r--1 freenet freenet 547933288 Jan 17 11:38 freenet.log.gz > > > > > > 547 MB. How do you want it? > > Compress it first, then email it :) > > I recommend bzip2. Logfiles always compress pretty well. > > > > Also I need the stack dump, and the build number. > > > > > > -- > > > Chris Linstruth <[EMAIL PROTECTED]> > > > > > > On Thu, 16 Jan 2003, Matthew Toseland wrote: > > > > > > > On Thu, Jan 16, 2003 at 10:16:49AM -0800, Chris Linstruth wrote: > > > > > Exactly what I'm seeing. When I stop/restart it'll run for give-or-take > > > > > a few hours, 48 hours then usage will go to 0, 0ms CurrentRoutingTime. > > > > What exact build number is this? > > > > And please send me a log file, with logLevel=debug, and a thread dump, > > > > which you get by kill -QUIT'ing the node. > > > > > > > > > > Glad I'm not alone. > > > > > -- > > > > > Chris Linstruth <[EMAIL PROTECTED]> > > > > > QNET > > > > > 1529 East Palmdale Blvd Suite 200 > > > > > Palmdale, CA 93550 > > > > > (661) 538-2028 > > > > > > > > > > > > > > > On Thu, 16 Jan 2003, Niklas Bergh wrote: > > > > > > > > > > > This problem is very similar to the problem I have been wrestling with for > > > > > > some time... If you look in your 'Node Status Info' page, what > > > > > > CurrentRoutingTime do you see. Is it 0 and the row below still says that > > > > > > there are many pooled jobs and that your node is currently queryrejecting it > > > > > > might be the same problem. > > > > > > > > > > > > My problem appeared when I raised the number of threads in order to make my > > > > > > node use more of the available bandwidth. > > > > > > > > > > > > /N > > > > > > > > > > > > - Original Message - > > > > > > From: "Chris Linstruth" <[EMAIL PROTECTED]> > > > > > > To: <[EMAIL PROTECTED]> > > > > > > Sent: Wednesday, January 15, 2003 11:02 PM > > > > > > Subject: Re: [freenet-support] Node suddenly ceases traffic > > > > > > > > > > > > > > > > > > > > > > > > > > On Wed, 15 Jan 2003, Matthew Toseland wrote: > > > > > > > > > > > > > > > On Wed, Jan 15, 2003 at 11:03:07AM -0800, Chris Linstruth wrote: > > > > > > > > > Finally looks like my announcement problem "fixed itself." Now I'm > > > > > > > > > seeing the same problem I was having a couple months ago on build 529. > > > > > > > > > > > > > > > > > > The node chugs along merrily until something happens and traffic stops > > > > > > > > > and it queryrejects everything. Attached are a couple mrtg graphs. > > > > > > > > Are you using the IBM JVM? Please don't do that. > > > > > > > > > > > > > > No. > > > > > > > > > > > > > > JVM Vendor Sun Microsystems Inc. > > > > > > > JVM Name Java HotSpot(TM) Server VM > > > > > > > JVM Version 1.4.1_01-b01 > > > > > > > > > > > > > > -- > > > > > > > Chris Linstruth <[EMAIL PROTECTED]> > > > > > > > QNET > > > > > > > 1529 East Palmdale Blvd Suite 200 > > > > > > > Palmdale, CA 93550 > > > > > > > (661) 538-2028 > > > > > > > > > > > > > > > > > > > > > > > > > > > > ___ > > > > > > > support mailing list > > > > > > > [EMAIL PROTECTED] > > > > > > > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > > > > > > > > > > > > > > > > > > > > > > > > > ___ > > > > > > support mailing list > > > > > > [EMAIL PROTECTED] > > > > > > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > > > > > > > > > > > > > > > > > > > > > ___ > > > > > support mailing list > > > > > [EMAIL PROTECTED] > > > > > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > > > > > > > > > > > > > > > > > > > > > > ___ > > > support mailing list > > > [EMAIL PROTECTED] > > > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > > > > > > > > > > ___ > support mailing list > [EMAIL PROTECTED] > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Node suddenly ceases traffic
Well, one of my nodes stopped doing stuff now too... Its log was 2 gigabytes even though it was only set to log at 'minor'... It survived 5 days and about 50 gigabytes of transfered data. One curious thing that I noted though: Routingtime was 0, queued jobs where a whole bunch and load was at 100%, just as usual. The unusual thing was that the node said it had 114 active inbound connections (but the sendqueue was 0 bytes, compared to a more normal day when the sendqueue is a couple of tens of megs). Could this say something new? /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Node suddenly ceases traffic
Ed Tomlinson said in the devl-list: >Here is a little problem noticed today. There seems to be a case where a >thread can hang when waiting for data. This is what I see. > >>From the connections applet: > >Peer addr Send Count Send Size Receiving Messages Idle time Lifetime Thread Type ID >64.53.216.3:64638 0 0 yes 1 0 13897805 FThread-41 Inbound bc7f3f Could this be the very same problem? All my 114 idle inbound connections looked something like this (not v656 but other versions). /N - Original Message - From: "Niklas Bergh" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Friday, January 24, 2003 11:33 PM Subject: Re: [freenet-support] Node suddenly ceases traffic > Well, one of my nodes stopped doing stuff now too... Its log was 2 gigabytes > even though it was only set to log at 'minor'... It survived 5 days and > about 50 gigabytes of transfered data. One curious thing that I noted > though: Routingtime was 0, queued jobs where a whole bunch and load was at > 100%, just as usual. The unusual thing was that the node said it had 114 > active inbound connections (but the sendqueue was 0 bytes, compared to a > more normal day when the sendqueue is a couple of tens of megs). Could this > say something new? > > /N > > > ___ > support mailing list > [EMAIL PROTECTED] > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] JVM max-mem and the freenet.exe launcher
Is there any way to get freenet.exe to launch fred with -XmxXXX? Could I do something in flaunch.ini maybe. /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] unable to access fproxy from second computer
I don't know how to do it by subnet but this works to allow a single other computer to connect (has worked with the last 10 stable builds at least): mainport.bindAddress=* mainport.allowedHosts=127.0.0.1,192.168.1.200 I am not sure that both are needed but when they are both there is works... /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] JVM max-mem and the freenet.exe launcher
Good, I just hit the limit (13gig datastorage or so). /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Dave Hooper Sent: den 27 januari 2003 11:22 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] JVM max-mem and the freenet.exe launcher > Is there any way to get freenet.exe to launch fred with -XmxXXX? Could > I do something in flaunch.ini maybe. No. Not yet! I'll make this change because I think it's been suggested in the past and as the Windows user base increases it's becoming more important to improve the end-user experience (which includes tinkerers and developers!). I'll add a few new keys to flaunch.ini to make this possible: javaexec=j:\sun\java\bin\jre1.4.1.0\java.exe jflags=-abc -def -ghi java=javaexec and augment freenet.exe to pass the flags to the jvm. This also opens up the possibility of choosing (at runtime, rather than install time) an alternative JVM (great for developers, maybe redundant for most end users but still potentially useful), by specifying, e.g. javaexec=j:\sun\java\bin\jre1.4.1.0\java.exe javaexec2=j:\sun\java\bin\jre1.4.1.0\javaw.exe javaexec3=j:\kaffe\bin\java.exe jflags=-abc -def -ghi jflags2=-console -ghi jflags3=--whatever java=javaexec2 I'll also add a configuration dialog to freenet.exe to support choosing a JVM from the list and specifying the appropriate flags for *that* JVM (This also gives a better interface to specifying jvm-specific flags.) I might leave it to the windows installer maintainers to popuplate the list of jvms (javaexec/javaexec2/javaexec3/...) in flaunch.ini rather than having to duplicate code and make freenet.exe search for installed jvms. d ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Freenet on Mac OS X--Running, but Can't See FProxy
Does localhost resolve correctly? Try http://127.0.0.1: Regards /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Aaron Davies Sent: den 29 januari 2003 08:14 To: [EMAIL PROTECTED] Subject: [freenet-support] Freenet on Mac OS X--Running, but Can't See FProxy I just d/l'd and installed the latest release, and the new Freenet Controller app says Freenet is running, but when I try to connect to http://localhost:, all I get is a message that localhost could not be contacted. What's wrong? -- ____ / ) / ) /--/ __. __ / / __. , __o _ _ / (_(_/|_/ (_(_) / / <_ /__/_(_/|_\/ <__http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Freenet on Mac OS X--Running, but Can't See FProxy
Ok, then that wasn't the problem.. Are you sure that the freenet server manages to start up correctly. I am not aquaitned with the Controller app, maybe it is saying the wrong thing. The freenet server should have produced a log file named freenet.log in the same directory as the jar-file. Can you have a look inside this one with a text editor to see if everything looks normal (or send it here even). /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Aaron Davies Sent: den 29 januari 2003 10:28 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Freenet on Mac OS X--Running, but Can't See FProxy When I open it in Safari, it changes to http://127.0.0.1:/servlet/nodeinfo/ and says "Could not open the page "http://127.0.0.1:/servlet/nodeinfo/"; because Safari could not load any data for this location." On Wednesday, January 29, 2003, at 03:23 AM, Niklas Bergh wrote: > Does localhost resolve correctly? Try http://127.0.0.1: > > Regards > /N > > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED]] On Behalf Of Aaron Davies > Sent: den 29 januari 2003 08:14 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Freenet on Mac OS X--Running, but Can't See > FProxy > > > I just d/l'd and installed the latest release, and the new Freenet > Controller app says Freenet is running, but when I try to connect to > http://localhost:, all I get is a message that localhost could not > be contacted. What's wrong? > -- > ____ > / ) / ) >/--/ __. __ / / __. , __o _ _ > / (_(_/|_/ (_(_) / / <_ /__/_(_/|_\/ <__ > > ___ > support mailing list > [EMAIL PROTECTED] > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > > > ___ > support mailing list > [EMAIL PROTECTED] > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > > -- Aaron Davies [EMAIL PROTECTED] ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Native FEC support
This just appeared in my console: C:\Program Files\Freenet 0.5>java -Xmx200m -jar freenet.jar Sending redirect: /servlet/SFRequest/__ID_626c9c3e_ID__/status_main htl: 15 blockHtl : 15 retries: 4 retryHtlIncrement : 5 healHtl: 15 healPercentage : 20 threads: 10 doParanoidChecks : true forceSave : true skipDS : false useUI : true runFilter : true filterParanoidStringCheck : false Unable to find native library for fec8 Unable to find native library for fec16 Should fred be able to find a native library for fec (and if so where)? I ran updatesnapshot about 2 hrs ago. /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Assertion failed in v551
Found this in the console window: ---Unexpected Exception-- java.lang.RuntimeException: Assertion failed. at freenet.client.RequestManager.assertTrue(RequestManager.java:352) at freenet.client.RequestManager.handleDone(RequestManager.java:85) at freenet.client.RequestManager.access$0(RequestManager.java) at freenet.client.RequestManager$EventConnector.receive(RequestManager.java :68) at freenet.client.SimpleEventProducer.produceEvent(SimpleEventProducer.java :47) at freenet.client.InternalClient$InternalFeedbackToken.unlockedProduceEvent (InternalClient.java:175) at freenet.client.InternalClient$InternalGetToken.dataNotFound(InternalClie nt.java:304) at freenet.node.states.request.DataPending.dataNotFound(DataPending.java:14 7) at freenet.node.states.request.DataPending.receivedMessage(DataPending.java :123) at sun.reflect.GeneratedMethodAccessor15.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at freenet.node.State.received(State.java:126) at freenet.node.StateChain.received(StateChain.java:161) at freenet.node.StateChain.received(StateChain.java:52) at freenet.node.StandardMessageHandler$Ticket.run(StandardMessageHandler.ja va:212) at freenet.node.StandardMessageHandler$Ticket.received(StandardMessageHandl er.java:159) at freenet.node.StandardMessageHandler$Ticket.access$0(StandardMessageHandl er.java) at freenet.node.StandardMessageHandler.handle(StandardMessageHandler.java:6 8) at freenet.Ticker$Event.run(Ticker.java:214) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:212) It might have been generated when I was downloading a Fec-splitfile. Regards /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Native FEC support
>But when I start up freenet I get this: > >java.io.IOException: Couldn't get FECEncoder: OnionFEC_a_1_2 > at freenet.client.FECTools.getEncoder(FECTools.java:643) > at freenet.client.FECTools.segmentFile(FECTools.java:166) > at >freenet.node.states.FCP.NewFECSegmentFile.received(NewFECSegmentFile.ja va:24) > at freenet.node.StateChain.received(StateChain.java:161) > at freenet.node.StateChain.received(StateChain.java:52) > at >freenet.node.StandardMessageHandler$Ticket.run(StandardMessageHandler.j ava:212) > at >freenet.node.StandardMessageHandler$Ticket.received(StandardMessageHand ler.java:159) > at >freenet.node.StandardMessageHandler$Ticket.access$0(StandardMessageHand ler.java) > at >freenet.node.StandardMessageHandler.handle(StandardMessageHandler.java: 68) > at freenet.Ticker$Event.run(Ticker.java:214) > at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:212) Do you get this immediately when you start up really? It looks like it should be the result of a request? >Jan 29, 2003 10:55:51 PM (freenet.client.FECFactory, main): Couldn't load >class: NativeOnionFECEncoder. >Jan 29, 2003 10:55:51 PM (freenet.client.FECFactory, main): Couldn't load >class: NativeOnionFECDecoder. Is this during startup or when you try to fetch a fec encoded file? /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Assertion failed in v551
Same thing in v552. /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Another FEC problem
I was downloading a large FEC-splitfile and had configured the splitfile servelet to heal 20% of the missing blocks with HTL 20 When the download of segment #1 was done (there where more than enough blocks available to reconstruct the segment) I was met with an error message saying something like 'Failed gracefully, FECEncode failed' (I forgot to write it down) in the lower part of the interface. I then repeated the download and everything worked smoothly, 12 reconstructed segment #1 blocks where inserted into the network (and after that segment #2 download suceeded and 8 blocks where reconstructed and reinserted for it). I have a minor-level logfile covering this (3.5 gigabytes). Regards /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] DoS
Sascha The way freenet is built noone can do a direct DoS attack within freenet. Whenever anyone is DosS:ing all of the nodes in freenet will share to load. I personally think that your log file looks just fine, it is completely normal for some connections to die now and then, it is also quite normal to see some errors like 'Unkown control byte' and such since development is ongoing the whole time and since internet is not always doing good things to the data transmitted over it. As for the load issue, probably your node has become quite popular amongst the other nodes. This happens when you have a large datastore with popular data in it. The 'Too many ongoing connections' is a good sign of popularity, if you have the hardware for it you can increase the maximum number of threads your node is allowed to use, this will make your node able to handle (and make positive use of) more of the incoming connections. If you want to get rid of the load, you can try to shut down your node for a day or so. When you restart it again it will be quite a bit less popular due to its outage. Another possible reason for the overload might be that frost is trying to upload much of your shared files into freenet (because of the flood you mentioned). Will your load decrease if you shut down Frost for an hour or two? Btw, are you running the node properly nice:d? /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Node suddenly ceases traffic
8027 0 0 no 6 3705 17385 QThread-68016 Inbound c3e88a 12.238.83.186:4455 0 0 no 2 3585 3605 QThread-68143 Inbound 1d7cfe8 63.105.26.181:64940 0 0 no 2 3455 3505 QThread-68418 Inbound 1928c5d 66.31.44.189:3237 0 0 no 2 3124 3134 QThread-67797 Inbound 3d63d1 217.227.196.18:1894 0 0 no 2 3094 3104 QThread-67867 Inbound 6438b8 138.88.84.46:15926 0 0 no 22 2844 152099 QThread-68275 Inbound 7130a3 62.49.26.143:51322 0 0 no 0 2594 2594 QThread-67750 Inbound 1c7de2f 212.104.155.82:1792 0 0 no 0 2574 2574 QThread-67947 Inbound cc1e1f 65.94.205.69:1694 0 0 no 23 1813 73175 QThread-68149 Inbound 1e649f5 209.239.242.44:65039 0 0 no 2 1802 2554 QThread-68376 Inbound cd9e40 12.241.145.72:4292 0 0 no 4 1642 16243 QThread-67847 Inbound 15090ad 218.129.184.4:64956 0 0 no 4 1041 7771 QThread-67953 Inbound 4a7896 217.8.155.184:46746 0 0 no 3 931 941 QThread-68403 Inbound 132e801 68.15.17.90:65400 0 0 no 0 881 881 QThread-67884 Inbound 11dd8d7 68.58.206.237:4565 0 0 no 95 851 327881 QThread-68272 Inbound ee4497 68.97.44.181:4879 0 0 no 12 771 29653 QThread-68259 Inbound 8731c8 62.254.35.92:1144 0 0 no 24 441 72374 QThread-68406 Inbound fdd3b5 24.25.175.161:46238 0 0 no 12 390 27700 QThread-67492 Inbound 1d54bff 209.221.197.10:57505 0 0 no 209 200 698655 QThread-68269 Inbound 14ce8e9 And if it is interesting for anyone, my thread status: Total pooled threads 363 Available pooled threads 158 Pooled threads in use 205 Class Threads used freenet.interfaces.LocalInterface$ConnectionShell 1 freenet.node.states.data.DataStateInitiator 3 freenet.Message: NodeAnnouncement 1 freenet.interfaces.PublicInterface$ConnectionShell 191 freenet.OpenConnectionManager$ConnectionJob 9 /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Niklas Bergh Sent: den 26 januari 2003 21:50 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Node suddenly ceases traffic Ed Tomlinson said in the devl-list: >Here is a little problem noticed today. There seems to be a case where >a thread can hang when waiting for data. This is what I see. > >>From the connections applet: > >Peer addr Send Count Send Size Receiving Messages Idle time Lifetime >Thread Type ID >64.53.216.3:64638 0 0 yes 1 0 13897805 FThread-41 Inbound bc7f3f Could this be the very same problem? All my 114 idle inbound connections looked something like this (not v656 but other versions). /N - Original Message - From: "Niklas Bergh" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Friday, January 24, 2003 11:33 PM Subject: Re: [freenet-support] Node suddenly ceases traffic > Well, one of my nodes stopped doing stuff now too... Its log was 2 gigabytes > even though it was only set to log at 'minor'... It survived 5 days > and about 50 gigabytes of transfered data. One curious thing that I > noted > though: Routingtime was 0, queued jobs where a whole bunch and load was at > 100%, just as usual. The unusual thing was that the node said it had 114 > active inbound connections (but the sendqueue was 0 bytes, compared to a > more normal day when the sendqueue is a couple of tens of megs). Could this > say something new? > > /N > > > ___ > support mailing list > [EMAIL PROTECTED] > http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Heisenbug
>From my console: YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 1d47d9431d47d943 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 48797ce348797ce3 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 596e4384596e4384 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 6b6a1d326b6a1d32 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 10ac18d110ac18d1 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 65c0f83065c0f83 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 355a5f21355a5f21 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 5c32b9b15c32b9b1 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 51724e2c51724e2c YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 9e8f5c409e8f5c4 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 300e657e300e657e YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: ef302c80ef302c8 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 428c8435428c8435 YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 5a42243d5a42243d YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! PANIC! Just recreated heisenbug! ID: 3cbea5de3cbea5de YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! Please, put a timestamp on and it will be much easier to sync with the log afterwards. What should I report? Some tidbits: Fred seems dead, wont serve any data on localhost:, 4.5gigs of log at loglevel minor, v552, Suns JVM 1.4.1_01, static ip, 12 gigs of storage (for some reason only filled up to 8 gigs even though it was full a week ago). Partial thread dump (had to small console buffer): "QThread-8487" prio=5 tid=0x0DB9A008 nid=0x838 waiting for monitor entry [2d2f000..2d2fd8c] at freenet.node.ds.FSDataStore.getData(FSDataStore.java:155) - waiting to lock <1109BDA0> (a freenet.fs.dir.NativeFSDirectory) at freenet.node.states.request.Pending.searchData(Pending.java:475) at freenet.node.states.request.Pending.receivedRequestInitiator(Pending.jav a:211) at freenet.node.states.request.DataPending.receivedMessage(DataPending.java :66) at sun.reflect.GeneratedMethodAccessor2.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at freenet.node.State.received(State.java:126) at freenet.node.StateChain.received(StateChain.java:161) at freenet.node.StateChain.received(StateChain.java:52) - locked <1316A8A8> (a freenet.node.StateChain) at freenet.node.StandardMessageHandler$Ticket.run(StandardMessageHandler.ja va:212) - locked <1316A8A8> (a freenet.node.StateChain) at freenet.node.StandardMessageHandler$Ticket.received(StandardMessageHandl er.java:159) at freenet.node.StandardMessageHandler$Ticket.access$0(StandardMessageHandl er.java) at freenet.node.StandardMessageHandler.handle(StandardMessageHandler.java:6 8) at freenet.Ticker$Event.run(Ticker.java:214) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:212) "QThread-8397" prio=5 tid=0x0D9B2E50 nid=0x360 in Object.wait() [5fef000..5fefd8c] at java.lang.Object.wait(Native Method) at java.lang.Object.wait(Unknown Source) at freenet.ConnectionHandler.run(ConnectionHandler.java:370) - locked <124BC580> (a java.lang.Object) at freenet.OpenConnectionManager$ConnectionJob.run(OpenConnectionManager.ja va:591) at freenet.thread.QThreadFactory$QThread.run(QThreadFactory.java:212) "QThread-8307" prio=5 tid=0x21685818 nid=0xdd8 in Object.wait() [55bf000..55bfd8c] at java.lang.Object.wait(Native Method) at java.lang.Object.wait(Unknown Source) at freenet.ConnectionHandler.run(ConnectionHandler.java:370) - locked <122F2270> (a java.lang.Object) at freenet.interfaces.FreenetConnectionRunner.handle(FreenetConnectionRunne r.java:74) at freenet.interfaces.PublicInterface$ConnectionShell.run(PublicInterface.j
RE: [freenet-support] Heisenbug
Sorry for the loss of formatting, I hope that someone manages to read it anyway :( /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Build 659 (unstable)
> Fix (hopefully) for the problems which were reported with a node > getting 120 connections and then becoming unresponsive with no > traffic. OpenConnectionManager.put() should kill enough connections to > take us back under the connection limit, not search for enough and > then only kill one of them. Sounds like a good start ;) >Note that this is the unstable build. Testing would be appreciated >though especially from people who got problems related to item b). Will do. /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] The announcedTo counter in diagnostics
Is it supposed to do something? I have never seen a single entry in it (3 months of running freenet nodes). The log files indicates that announcing is being done. Windows XP+2000, suns JVM 1.4.1_01, all builds tried since november /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Heisenbug
Right, I just hadn't looked enough. Unfortunately a loglevel minor log doesn't give any help, it seems to have happened quite spontaneously at different times... Guess we'll have to wait for it to happen another time. Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8287): QueryRestarted @ 8a14dfc5c625dbfa <- 209.210.55.2:12357 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8521): QueryRestarted @ 8a14dfc5c625dbfa -> 66.28.14.56:2538 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8492): Void @ dd9df34cf0fffd28 -> 18.239.3.103:9959 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8346): DataRequest @ 8225f182be0d3d8d -> 217.160.78.31:37371 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8429): QueryRejected @ f562934eb0614c23 <- 141.24.32.207:56984 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8346): QueryRestarted @ f562934eb0614c23 -> 65.195.28.94:44782 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8272): InsertRequest @ 79e04e9e84437253 -> 219.117.201.240:36333 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8346): NodeAnnouncement @ f562934eb0614c23 -> 205.165.193.106:26288 Feb 2, 2003 6:42:06 PM (freenet.message.VoidMessage, QThread-8240): YOUR NODE CAUSED THE HEISENBUG - PLEASE REPORT SETUP TO FREENET DEV MAILING LIST! Feb 2, 2003 6:42:06 PM (freenet.message.NodeMessage, QThread-8240): PANIC! Just recreated heisenbug! ID: 428c8435428c8435 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8240): Void @ 428c8435428c8435 -> 62.249.189.106:31998 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8240): QueryRestarted @ 673f907ba85f4ac4 -> 62.167.0.87:51021 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8240): DataRequest @ 673f907ba85f4ac4 -> 80.192.66.82:9065 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8478): DataRequest @ 43fcefae90844c81 <- 68.58.206.237:34147 Feb 2, 2003 6:42:06 PM (freenet.ConnectionHandler, QThread-8522): QueryRejected @ 43fcefae90844c81 -> 68.58.206.237:34147 /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Build 659 (unstable)
659 would seem to have some problems with announcing. One of the nodes I upgraded yesterday hasn't done a single usefult thing since... Feb 4, 2003 5:39:20 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:39:21 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:39:31 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:39:31 PM (freenet.node.states.announcing.SendAnnouncement, QThread-6): Sending NodeAnnouncement failed: freenet.ConnectFailedException: Against peer DSA(eda1 570b d062 a746 1a54 e1cf 2800 9cf4 250f 5328) @ 193.11.247.167:61608 - Cannot connect to: 193.11.247.167:61608 (terminal) Feb 4, 2003 5:39:32 PM (freenet.node.states.announcing.SendAnnouncement, QThread-6): Sending NodeAnnouncement failed: freenet.ConnectFailedException: Against peer DSA(e3d9 6da2 c70f 7b75 0ad3 f077 236f bae0 6ed7 7e01) @ 217.215.123.28:19790 - Cannot connect to: 217.215.123.28:19790 (terminal) Feb 4, 2003 5:39:32 PM (freenet.OpenConnectionManager, QThread-5): Established connection: tcpconnection: 134.147.115.87:26277 Feb 4, 2003 5:39:34 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:39:39 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 160.26.102.198:4620 Feb 4, 2003 5:39:40 PM (freenet.interfaces.FreenetConnectionRunner, QThread-4): Inbound connection failed: java.io.EOFException Feb 4, 2003 5:39:41 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:39:44 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4103 Feb 4, 2003 5:39:48 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:39:51 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:00 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Polling and aggregation of diagnostics. Feb 4, 2003 5:40:01 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:03 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.SendAnnouncement, QThread-6): Sending NodeAnnouncement failed: freenet.ConnectFailedException: Against peer DSA(50a8 f534 ea52 f574 455c 00d9 5f7e e11d 2eb4 4570) @ 134.147.115.87:26277 - authentication timed out (terminal) Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, QThread-6): Announcement failed to eda1 570b d062 a746 1a54 e1cf 2800 9cf4 250f 5328 at depth 15. Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, QThread-6): Announcement failed to e3d9 6da2 c70f 7b75 0ad3 f077 236f bae0 6ed7 7e01 at depth 15. Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, QThread-6): Announcement failed to 50a8 f534 ea52 f574 455c 00d9 5f7e e11d 2eb4 4570 at depth 15. Feb 4, 2003 5:40:04 PM (freenet.interfaces.FreenetConnectionRunner, QThread-4): Inbound connection failed: java.io.EOFException Feb 4, 2003 5:40:05 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 129.116.44.183:33608 Feb 4, 2003 5:40:11 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:14 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4141 Feb 4, 2003 5:40:17 PM (freenet.node.states.maintenance.Checkpoint, QThread-6): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:40:21 PM (freenet.node.states.maintenance.Checkpoint, QThread-6): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:31 PM (freenet.node.states.maintenance.Checkpoint, QThread-6): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:31 PM (freenet.node.states.maintenance.Checkpoint, QThread-6): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:40:34 PM (freenet.interfaces.FreenetConnectionRunner, QThread-10): Inbound connection failed: java.io.EOFException Feb 4, 2003 5:40:35 PM (freenet.interfaces.FreenetConnectionRunner, QThread-4): Inbound connection failed: java.net.SocketTimeoutException: Read timed out Feb 4, 2003 5:40:40 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4166 Feb 4, 2003 5:40:41 PM (freenet.node.states.maintenance.Checkpoint, QThread-10
[freenet-support] Connection attemtpts counter error
Node version 660.. 6/4 successful (it was 3/1 right before)? tcp/138.88.84.46:164411.0 none 4 6 (150%) 9 secs. ago 552 1 0 no ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Why would my node to this?
Feb 7, 2003 12:07:42 PM (freenet.support.SimpleDataObjectStore, QThread-486): Trying to write to c:\rtnodes_14166a Feb 7, 2003 12:07:42 PM (freenet.support.SimpleDataObjectStore, QThread-486): Trying to write to c:\rtprops_14166b Version 660 /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Why would my node to this?
Now you are jesting with me Matthew. >But what it is actually doing is writing out the routing table. The real question was why are the files stored in 'c:\'? I haven't told my node to put anything there as far as I know. If I happened to run linux would the files be placed in '/'? /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
[freenet-support] Announcement problem
I just noticed that another of my nodes has suddenly stopped being useful. No connections in or out at all currently. Last part of the log: Feb 8, 2003 8:09:10 AM (freenet.node.states.announcing.Announcing, QThread-1818): Found 2 announcement targets for this node. Feb 8, 2003 8:09:32 AM (freenet.node.states.announcing.Announcing, QThread-1818): Announcement failed to d5f6 fcf4 4f77 7b5f dc91 bb7e a31d 0b99 7ddd 2ddf at depth 2. Feb 8, 2003 8:09:32 AM (freenet.node.states.announcing.Announcing, QThread-1818): Announcement failed to 6706 2742 3589 759e 1187 dbe9 66fb 98b0 93f6 0d02 at depth 2. Feb 8, 2003 8:24:10 AM (freenet.node.states.announcing.Announcing, QThread-1818): Found 2 announcement targets for this node. Feb 8, 2003 8:24:33 AM (freenet.node.states.announcing.Announcing, QThread-1818): Announcement failed to 319c 4799 819e 790f 3bfc f665 e7de 04b1 e585 1fb2 at depth 2. Feb 8, 2003 8:24:38 AM (freenet.node.states.announcing.NewInitialRequest, QThread-1818): Scheduling post-announcement request on chain 275cd702bbfd270a, for key e34207fc8075e7d481e816b24cdf747e8e9db21d0f0203 Feb 8, 2003 8:24:38 AM (freenet.node.states.announcing.Announcing, QThread-1818): Announced node successfully to 95c1 dee1 b574 a378 6d94 a35c 02dc 7049 66f3 4c8b at depth 2. Feb 8, 2003 8:39:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): Found 1 announcement targets for this node. Feb 8, 2003 8:39:30 AM (freenet.node.states.announcing.Announcing, QThread-1803): Announcement failed to 3d45 c09b 2617 813c 8d7b 994e 970f a2c5 517c 6f6d at depth 3. Feb 8, 2003 8:54:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): Found 1 announcement targets for this node. Feb 8, 2003 8:54:11 AM (freenet.node.states.announcing.Announcing, QThread-1803): Announcement failed to 993f acca cc9a 9911 bb44 034b b74d a422 0072 7210 at depth 2. Feb 8, 2003 9:09:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): Found 1 announcement targets for this node. Feb 8, 2003 9:09:13 AM (freenet.node.states.announcing.Announcing, QThread-1803): Announcement failed to 348a 08a4 51cd 6978 af9e 7b08 ece1 b28e e7ae 8dbf at depth 2. It is one of my 554 nodes /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
RE: [freenet-support] Build 659 (unstable)
659 seems to have solved the 'Node suddenly ceases traffic'-problem. I have a node that has been up for close 120 hours now and there is till no sign of stagnation. It is serving up 13000 q/h at about 1MBit/s. One thing though: Peer addr Send Count Send Size Receiving Messages Idle time Lifetime Thread Type ID 155.239.180.179:34467 0 0 yes 1 0 393188783 QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 353667846 QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 305199082 QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 27095 QThread-36576 Inbound 514847 213.208.127.216:17565 0 0 yes 7 0 172335455 QThread-44615 Inbound 134183 64.252.121.1:34381 0 0 yes 10 0 22933808 QThread-45372 Inbound 323c46 216.15.192.235:56589 0 0 yes 2 0 42376945 QThread-42938 Inbound 13374f 134.193.75.29:3277 0 0 yes 8 0 18536034 QThread-45215 Inbound 1423d4 129.240.200.147:39076 1 147772 yes 471 0 19078844 QThread-45337 Inbound 3c54ad This is the initial entries of my ocm table. I do not like that idle-time always is zero on those connections where 'receiving' is 'yes'. It seems like the idletime is set to zero even if the connection is idle. Should it really be so, couldn't idle-time be set to indicate the time since the last packet was recieved on that connection instead?! /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
RE: [freenet-support] Announcement problem
Nope, that is not it. I am *pretty* sure that this is the way: When announcing your node will send an announcement message with a specific HTL to 3 of the nodes in you routing table.. These three will in their turn distribute the announcement on to the best match in their routing table.. and so on until the HTL becomes zero.. Much like a plain insert. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] Sent: den 11 februari 2003 15:50 To: Niklas Bergh Subject: RE: [freenet-support] Announcement problem At 12.53 11/02/03 +0100, you wrote: >I have seen that earlier too but I haven't noticed it for a long time >now.. > >I think that if your node has been running earlier and because of that >is present in other nodes routingtables and thereby recieveing incoming >connections everything should start working because of that... This is what I find strange; after announcement, I must be in routing tables of all nodes that are in my routing table this is the supposed way things works, isn't it ? Ciao. Marco >/N > >-Original Message- >From: [EMAIL PROTECTED] >[mailto:[EMAIL PROTECTED]] On Behalf Of >[EMAIL PROTECTED] >Sent: den 11 februari 2003 11:36 >To: [EMAIL PROTECTED] >Subject: Re: [freenet-support] Announcement problem > > >At 02.45 11/02/03 -0500, you wrote: >>On Mon, 2003-02-10 at 20:07, Greg Wooledge wrote: >>> Build 611? Are you sure about that? I have made contact with >>> (unstable) nodes with build numbers as high as 663. >>> >>> Are you also seeing your problem with the stable builds? >> >>Sorry for the typo... that should say 661. Also tried it tonight with >>556: no successful announcements, same types of exceptions I included >>before. > >I don't know if this is significant, but in the last couple of month >my fresly bootsrapped node (now stable 552) has no traffic until I do >some retrieve with fproxy; then it begin to have traffic that >stabilize in a couple of hours. > >HTH. Marco > > >-- >+ il Progetto Freenet - segui il coniglio bianco+ >* the Freenet Project - follow the white rabbit* >* Marco A. Calamari[EMAIL PROTECTED] www.marcoc.it * >* PGP RSA: ED84 3839 6C4D 3FFE 389F 209E 3128 5698 * >+ DSS/DH: 8F3E 5BAE 906F B416 9242 1C10 8661 24A9 BFCE 822B + > > > >___ >Support mailing list >[EMAIL PROTECTED] >http://hawk.freenetproject.org:8080/mailman/listinfo/support -- + il Progetto Freenet - segui il coniglio bianco+ * the Freenet Project - follow the white rabbit* * Marco A. Calamari[EMAIL PROTECTED] www.marcoc.it* * PGP RSA: ED84 3839 6C4D 3FFE 389F 209E 3128 5698 * + DSS/DH: 8F3E 5BAE 906F B416 9242 1C10 8661 24A9 BFCE 822B + ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
FW: [freenet-support] Announcement problem
Mrgh.. The listserv sets the wrong reply to address in the mails from this list. Here comes a mail I thought I sent to the list two hours ago.. /N -Original Message- From: Niklas Bergh [mailto:[EMAIL PROTECTED]] Sent: den 11 februari 2003 13:01 To: 'bdonlan' Subject: RE: [freenet-support] Announcement problem This is the last part of a debug-level log from one of my nodes that are idle without reason (One that is idle from startup that is.. Not one of those becoming idle after a number of days).. I can't really find a reason for the problems from it. If someone is interested in looking then help yourself ;) /N idle66nodeLog.zip Description: Zip compressed data
FW: Longtime idle connections, was: [freenet-support] Build 659 (unstable)
And another one -Original Message- From: Niklas Bergh [mailto:[EMAIL PROTECTED]] Sent: den 11 februari 2003 12:57 To: 'Matthew Toseland' Subject: RE: Longtime idle connections, was: [freenet-support] Build 659 (unstable) On this particular node maxmimumThreads are set to 300 so everything is order from that aspect... /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
RE: Longtime idle connections, was: [freenet-support] Build 659 (unstable)
And here comes the third dump of the ocm contents 155.239.180.179:34467 0 0 yes 1 0 572922365 QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 533401428 QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 484932664 QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 450711357 QThread-36576 Inbound 514847 129.240.200.147:39076 1 147772 yes 471 0 198812426 QThread-45337 Inbound 3c54ad 66.28.14.56:4732 1 1021207 yes 1740 0 173207288 QThread-45442 Inbound 6a5180 210.86.48.242:44180 0 0 yes 1 0 106259012 QThread-45049 Inbound f955a 134.193.75.29:3277 0 0 yes 11 0 198269616 QThread-45215 Inbound 1423d4 216.87.102.230:2816 0 0 yes 8 0 73175861 QThread-45395 Inbound 4e23b2 Please note that the same connections are still there.. plus some newcomers. The send-queue-size 147772 is also stalled (haven't changed in a couple of hours) Summary of current connections: Number of open connections: 120 Number of outbound connections: 1 Number of inbound connections: 119 Routing time status: # Current routingTime: 0ms. # Active pooled jobs: 276 (92.0%) [QueryRejecting all incoming requests!] Threadcount (maximumthreads is set to 300...): Total pooled threads 349 Available pooled threads 74 Pooled threads in use 275 And yes.. The node is just about idle now.. A couple of strange things I note though.. 1. The node is not *completely* idle.. There seems to be one or two threads that are still making themselves useful, accepting an incoming connection now and then and establishing a new outgoing connection once in a while. I assume that given enough time they will also be stuck however... 2. For some really strange reason: 'Local mean traffic (queries per hour) : 19399.68744947998'. This CANNOT BE TRUE.. My node is definitely not serving up any 20kQueries/h, close to no processor or bandwidth is used. Is the open-but-idle connections counted into this value for some reason?! /N -Original Message- From: Matthew Toseland [mailto:[EMAIL PROTECTED]] Sent: den 11 februari 2003 10:02 To: Niklas Bergh Subject: Re: Longtime idle connections, was: [freenet-support] Build 659 (unstable) On Tue, Feb 11, 2003 at 09:52:17AM +0100, Niklas Bergh wrote: > > > -Original Message- > From: Matthew Toseland [mailto:[EMAIL PROTECTED]] > Sent: den 10 februari 2003 19:55 > To: Niklas Bergh > Subject: Re: [freenet-support] Build 659 (unstable) > > > On Mon, Feb 10, 2003 at 11:38:09AM +0100, Niklas Bergh wrote: > > 659 seems to have solved the 'Node suddenly ceases traffic'-problem. > > I > > > have a node that has been up for close 120 hours now and there is > > till > > > no sign of stagnation. It is serving up 13000 q/h at about 1MBit/s. > > >Yay. 1Mbps _both ways_ ? > > Nope, summed up. Most of it (80% or so) is outgoing traffic. > > > > > > One thing though: > > > > Peer addr Send Count Send Size Receiving Messages Idle time Lifetime > > Thread Type ID 155.239.180.179:34467 0 0 yes 1 0 393188783 > > QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 353667846 > > > QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 > > 305199082 > > > QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 > > 27095 > > QThread-36576 Inbound 514847 213.208.127.216:17565 0 0 yes 7 0 > > 172335455 QThread-44615 Inbound 134183 64.252.121.1:34381 0 0 yes 10 0 > > > 22933808 QThread-45372 Inbound 323c46 216.15.192.235:56589 0 0 yes 2 > > 0 > > > 42376945 QThread-42938 Inbound 13374f 134.193.75.29:3277 0 0 yes 8 0 > > 18536034 QThread-45215 Inbound 1423d4 129.240.200.147:39076 1 147772 > > yes 471 0 19078844 QThread-45337 Inbound 3c54ad > > > > This is the initial entries of my ocm table. I do not like that > > idle-time always is zero on those connections where 'receiving' is > > 'yes'. It seems like the idletime is set to zero even if the > > connection is idle. Should it really be so, couldn't idle-time be set > > to indicate the time since the last packet was recieved on that > > connection instead?! > > >Err... hmm. It is transferring a message with trailing fields i.e. a > file. This can take a long time, but it is not idle during that > time... > > Is the idle time specified in milliseconds? In that case, over the > first connection, one message in 109 hours > > OCM 24 hours later: > > Peer addr Send Count Send Size Receiving Messages Idle time Lifetime > Thread Type ID 155.239.180.179:34467 0 0 yes 1 0 470074608 > QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 430553671 > QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 382084907 > QThread-34344 Inbound 5
RE: [freenet-support] Build 659 (unstable)
JVM 1.4.1_01 (always and ever until there is a newer one) -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Matthew Toseland Sent: den 6 februari 2003 19:48 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Build 659 (unstable) Are you sure you aren't using a nonstandard JVM? The IBM JVM has been known to have serious problems, as has Kaffe, and old versions of the Sun one sometimes have nasty bugs.. On Thu, Feb 06, 2003 at 10:26:25AM +0100, Niklas Bergh wrote: > 659 would seem to have some problems with announcing. One of the nodes > I upgraded yesterday hasn't done a single usefult thing since... > > > Feb 4, 2003 5:39:20 PM (freenet.node.states.maintenance.Checkpoint, > QThread-4): Executing Checkpoint: Native Filesystem Directory > checkpoint Feb 4, 2003 5:39:21 PM > (freenet.node.states.maintenance.Checkpoint, > QThread-4): Executing Checkpoint: Autodetection of IP addresses > Feb 4, 2003 5:39:31 PM (freenet.node.states.maintenance.Checkpoint, > QThread-4): Executing Checkpoint: Autodetection of IP addresses > Feb 4, 2003 5:39:31 PM (freenet.node.states.announcing.SendAnnouncement, > QThread-6): Sending NodeAnnouncement failed: > freenet.ConnectFailedException: Against peer DSA(eda1 570b d062 a746 > 1a54 e1cf 2800 9cf4 250f 5328) @ 193.11.247.167:61608 - Cannot connect > to: 193.11.247.167:61608 (terminal) > Feb 4, 2003 5:39:32 PM (freenet.node.states.announcing.SendAnnouncement, > QThread-6): Sending NodeAnnouncement failed: > freenet.ConnectFailedException: Against peer DSA(e3d9 6da2 c70f 7b75 > 0ad3 f077 236f bae0 6ed7 7e01) @ 217.215.123.28:19790 - Cannot connect > to: 217.215.123.28:19790 (terminal) > Feb 4, 2003 5:39:32 PM (freenet.OpenConnectionManager, QThread-5): > Established connection: tcpconnection: 134.147.115.87:26277 > Feb 4, 2003 5:39:34 PM (freenet.node.states.maintenance.Checkpoint, > QThread-4): Executing Checkpoint: Native Filesystem Directory checkpoint > Feb 4, 2003 5:39:39 PM (freenet.interfaces.PublicInterface, Interface # > tcp/14166): Accepted connection: tcpconnection: 160.26.102.198:4620 > Feb 4, 2003 5:39:40 PM (freenet.interfaces.FreenetConnectionRunner, > QThread-4): Inbound connection failed: java.io.EOFException > Feb 4, 2003 5:39:41 PM (freenet.node.states.maintenance.Checkpoint, > QThread-4): Executing Checkpoint: Autodetection of IP addresses > Feb 4, 2003 5:39:44 PM (freenet.interfaces.PublicInterface, Interface # > tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4103 > Feb 4, 2003 5:39:48 PM (freenet.node.states.maintenance.Checkpoint, > QThread-10): Executing Checkpoint: Native Filesystem Directory > checkpoint > Feb 4, 2003 5:39:51 PM (freenet.node.states.maintenance.Checkpoint, > QThread-10): Executing Checkpoint: Autodetection of IP addresses > Feb 4, 2003 5:40:00 PM (freenet.node.states.maintenance.Checkpoint, > QThread-10): Executing Checkpoint: Polling and aggregation of > diagnostics. > Feb 4, 2003 5:40:01 PM (freenet.node.states.maintenance.Checkpoint, > QThread-10): Executing Checkpoint: Autodetection of IP addresses > Feb 4, 2003 5:40:03 PM (freenet.node.states.maintenance.Checkpoint, > QThread-10): Executing Checkpoint: Native Filesystem Directory > checkpoint > Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.SendAnnouncement, > QThread-6): Sending NodeAnnouncement failed: > freenet.ConnectFailedException: Against peer DSA(50a8 f534 ea52 f574 > 455c 00d9 5f7e e11d 2eb4 4570) @ 134.147.115.87:26277 - authentication > timed out (terminal) > Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, > QThread-6): Announcement failed to eda1 570b d062 a746 1a54 e1cf 2800 > 9cf4 250f 5328 at depth 15. > Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, > QThread-6): Announcement failed to e3d9 6da2 c70f 7b75 0ad3 f077 236f > bae0 6ed7 7e01 at depth 15. > Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, > QThread-6): Announcement failed to 50a8 f534 ea52 f574 455c 00d9 5f7e > e11d 2eb4 4570 at depth 15. > Feb 4, 2003 5:40:04 PM (freenet.interfaces.FreenetConnectionRunner, > QThread-4): Inbound connection failed: java.io.EOFException > Feb 4, 2003 5:40:05 PM (freenet.interfaces.PublicInterface, Interface # > tcp/14166): Accepted connection: tcpconnection: 129.116.44.183:33608 > Feb 4, 2003 5:40:11 PM (freenet.node.states.maintenance.Checkpoint, > QThread-10): Executing Checkpoint: Autodetection of IP addresses > Feb 4, 2003 5:40:14 PM (freenet.interfaces.PublicInterface, Interface # > tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4141 > Feb 4, 2003 5:40:17 PM (freenet.node.states.maintenance.Checkpoint, > QThread-6): Executing Checkpoint: Native Filesystem Directory checkpoint > Feb 4, 2003 5:4
Re: Longtime idle connections, was: [freenet-support] Build 659 (unstable)
I am not totally sure (starting the test today) but I *think* it does. I remember that I started noticing this problem when I first increased maxmimumThreads in order to make my node use up more of my available bandwidth /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
RE: [freenet-support] Rantsies
> > Good to hear. Wonder if it is because of working NGR or > simply because > > the unstable network is smaller.. I believe that this isn't > known yet. > Don't things work better when it's bigger? :-) It should do.. If routing was working well and able to cope with the growth and load balancing. > > Hmm.. Well.. Actually they both speak exactly the same > language.. The > Then, no reason why 'stable' couldn't actually talk well with > other stable > nodes and ngr ones? And just keep the unstable only dealing > with ngr for > testing? As of yesterday there where three types of nodes.. Stable, all non-NGR Unstable, anti-NGR (build <6281) Unstable, NGR (build 6281+) The previous two types could talk to each other.. The last type could only talk to its siblings > > Hmmm.. Not play really.. The intention is to make it work... > Perception skewers reality. I don't know WHY unstable works, > but I see that > it does. I tested again yesterday with stable (getting new > seednodes) and I > still couldn't *do* anything. Ie, couldn't retrieve any > 'known' keys. So, > either all the linked content just isn't there any more on > 'stable', or > something is still broke. Whether by luck or talent, it > seems that they have gotten unstable 'working'. Possibly anti-NGR... > > Probabilistic caching. > > Prevent nodes from caching data whose source they aren't > routing-wise > > close to. > Why? I don't understand this... ideally, shouldn't a node > cache *everything* > that runs through it, given enough space? It does, until the DS is 90% full.. After that it tries to enhance specialization by selectively accept stuff into its store.. > > NGR > > Keep track of not only which nodes have what data.. Also > keep track of > > how fast they can supply it. > Err, um... keep track of what nodes have what data? That > doesn't sound like a > good idea at all. Hopefully, you mean, "keep track of what > nodes can GET > what data". I hope, at least, that would be the way it works. > "No, I don't > have the GPL, but I know someone who can get it for ya... I'm > just passing > your request on..." Right, my mistake.. > > Problem #8: > > OCO. > > Massive amounts of CPU is used for connection negotiations due to > > heavy encryption stuff used in there. OCO amplified this > latent issue. > I read Toad's roadmap, and it seems that at least udp is > being considered. > Great. This is how it SHOULD be done: Or, at least, an > option. If you're on > lower bandwidth, udp should be fine, no? And solves having a ton of > connections always open. It'd put more load on the machine, > but, probably > still acceptable. The problem is not the TCP connections.. It is all about FNP connections (currently over TCP but they would have the same problem even over UDP). The problem is that two nodes has to autheticate with each other to verify that the Peer is who he says he is.. This is true no matter if the underlying transport would be TCP or UDP. > > 1. Multiplexing, would allow a single connections to send multiple > > messages simultaneously thereby enabling us to keep only one single > > connection open to each node, compared to keeping one free > connection > > the each node. > Ah, so THAT is why I see so multiple instances of a node in > the OC window? > Because this is yet to be done? Yep. > > If someone wants to add missing things to the list then > feel free to > > do so. > That's a pretty nice list, and certainly gives me a new perspective. Good, that was the intention :) There is no play involved.. Most everything is done for a quite good reason :) > > Nahh.. They don't really dismiss it.. They just want things > to start > > working at all first :) Any help would be very appreciated. > I think they're doing a good job with unstable. It just is > non-intuitive > that your best hope is NOT to get the stable release: I think > it'd be helpful > for the main page to reflect that unstable isn't really so > much 'broken' as 'in need of constant update'. Meaning, if > you are downloading the latest build each day, chances are > you're probably be better off than downloading the stable at > all. But, that's just my experience so far. Usually stable is the best hope.. It is just that here has been a rough couple of months lately.. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Help Respond Soon
What kind of error messages do you see? And also are you using some kind of broadband router/software firewall /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n > Sent: den 25 oktober 2003 23:39 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Help Respond Soon > > > I've been trying to get this Freenet to load the websites but > its not doing it at all. I have been leaving it on for a long > time now. > > Right now I have 2.40ghz, 768DDRRAM, and cable modem. > > I would like to know what I should set my settings to so I > can get the best results possible and make the pages load > more faster, because I havent been able to get any to load > except the main page which takes forever to load the little images. > > > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-> bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] browser
Title: Message How about using the 'Address' field then? I allows you to navigate to ANY web page in the whole wide world. Also, you can type in any start page you want in 'Tools\Internet Options\Home page'. If that doesn't work then I would suggest that you have a talk with Microsoft. And if you cannot remember the address of your previous 'Earthlink' start page then I suggest you have a talk with Earthlink. /N -Original Message-From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Robert GreenageSent: den 29 oktober 2003 15:08To: [EMAIL PROTECTED]Subject: [freenet-support] browser freenet has co opted my browser. when i log on to the net my browser would default to my ISP(earthlink) homepage.now it defaults to 127.0.0.1:. i cannot get it to go to any other website. even by using favorites or history. the default browser for earthlink is IE 6.0. this also happens to be how i access my mail. any ideas? --- Robert Greenage --- [EMAIL PROTECTED] --- EarthLink: It's your Internet. ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Re: Support Digest, Vol 3, Issue 38
Hmm.. Ok, so what exacltly is it that doesn't work for you? Is it getting the ActiveLinks in the web interface? Is it navigating to a freesite? If it is the second then you should get a message saying something like 'Route not found' or possibly 'Data not found' or something.. What does the page you get say? /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n > Sent: den 29 oktober 2003 16:02 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Re: Support Digest, Vol 3, Issue 38 > > > I don't see any error messages at all, I figured maybe it was > something due to the uptime of the program so i kept it on > about 10-12 hours, and the only difference I saw was that > when I started Freenet it was at a load of 100%, after the > 10-12 hours it was at a load of 0%. So I'm guessing there > might be something wrong with the settings, although it is > under the default settings at the moment. There's no > router/software firewall I have right now so that couldnt be > the issue. > > > > > Message: 5 > > Date: Wed, 29 Oct 2003 10:54:30 +0100 > > From: "Niklas Bergh" <[EMAIL PROTECTED]> > > Subject: RE: [freenet-support] Help Respond Soon > > To: <[EMAIL PROTECTED]> > > Message-ID: <[EMAIL PROTECTED]> > > Content-Type: text/plain; charset="us-ascii" > > > > What kind of error messages do you see? > > > > And also are you using some kind of broadband > router/software firewall > > > > /N > > > >> -Original Message- > >> From: [EMAIL PROTECTED] > >> [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n > >> Sent: den 25 oktober 2003 23:39 > >> To: [EMAIL PROTECTED] > >> Subject: [freenet-support] Help Respond Soon > >> > >> > >> I've been trying to get this Freenet to load the websites > but its not > >> doing it at all. I have been leaving it on for a long time now. > >> > >> Right now I have 2.40ghz, 768DDRRAM, and cable modem. > >> > >> I would like to know what I should set my settings to so I can get > >> the best results possible and make the pages load more faster, > >> because I havent been able to get any to load except the main page > >> which takes forever to load the little images. > >> > >> > >> ___ > >> Support mailing list > >> [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-> > >> bin/mailman/listinfo/support > >> > > > > > > -- > > > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-> bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Transient node detected
If you check the log file you probably will see a reason to why the node goes transient on you (close to the beginning). But.. If I should take a guess.. You are running the node on an NAT:ed computer? If you you have to tell the node the IP of the internet-side of the router (the ipAddress=XXX param in the config file). You also have to tell the router/NAT:in machine to port-forward TCP traffic to the node:s listenPort (can also be found in the config file). Dont forget to remove the '%' comment character from the ipAddressLine in the config file. Regards /N > when Launching Frost I get this. > ( Transient node detected > You are running a TRANSIENT node. Better run a > PERMANENT freenet node. ) > > How do I run a PERMANENT freenet node? > > I currently have a DSL and Cable internet connection > and can leave my comp's on all the time. > > I am also willing to donate my space and bandwith - and > computer skills to help freenet. > > Thanks > Phil Deck > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Re: 5029 overloads
> I am using YThreadFactory (obviously) and maximumThreads=300. Also, I'm > allocating 128MB to java memory. I'll keep it running until the > outgoing bandwidth gets really low. > > Recommendations? Or does this indicate a bug needing to be fixed? > > -Martin Given the amount of requests your that your node receive 128M probably isn't enough Try for a while with 192M or so. Well, Muxing and SIPv2 will both lead to decreased memory usage. Muxing will affect memory useage directly due to decreased amount of connections while SIPv2 will lead to decreased CPU which probably will cause some memory savings due to decreased enqueueing of stuff. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Re: route not found
> To fix this, I've enabled all outgoing packets for all programs in > ZoneAlarm (expert rules), but I'm afraid this may not be the > best idea > from a security point of view. Well.. It isn't good from that point of view if you suffer from problems with trojans and other stuff (=you run stuff on your computer that you don't know that you do).. It makes no difference for otherwise. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] [Dharmadoer7@aol.com: (no subject)]
>Any ideas? I don't really know the windows stuff... > >Hi..had a couple of correspondences with you and appreciated the >throroughness of the replies. If not you, one of you. In the email you strongly suggested >that, due to technical reasons, i should uninstall Freenet. The problem is >that everytime I try to follow the clear process, I always get the same message >- "You must turn off Freenet before you can uninstall", or the equivelant, >despite the fact that not only have I already turned it off, but have also >confirmed the fact that I'd done so. > >Please tell me what the necessary steps are to uninstall Freenet. Have you verified, using the task manager, that all processes associated with freenet is gone? Use the task manager to kill of any (or any unwanted if you run multiple java apps on your computer) java.exe processes and any freenet.exe process then start the uninstaller again. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] freenet load always >100%
> I'm not seeing this but now that the world seems to have "discovered" my node, > my JVM keeps dying with out-of-memory and NULL pointer exceptions. I still > have plenty of (virtual) memory left, so something else must be serving as a > "cap" on the memory that java can get. > > This might be a java tuning parameter or a kernel setting (I'm using FreeBSD > 4.9-STABLE), but if anybody has any clues I'm appreciate it. My current > solution of "shutting down freenet every time it happens and restarting it" > is getting old fast especially since that's getting to be about every hour > now. OOM:s usually causes NPE:s as a side effect. To allow java to use more memory spawn your node with something like 'java -Xmx256M XX'. Depending on which JVM version you are running the default maximum amount of memory the JVM will use is either 64 or 128 megs which is usually too little memory for a popular node to work well. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Can't receive any Freenet data
Actaully, this might be caused by a bug releated to seednodes reading which is solved in build 5033 (the absolute newest one).. Could you try upgrading to that build and also download http://freenetproject.org/snapshots/seednodes.ref and replace your local seednodes.ref file with this one... regards /N - Original Message - From: <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Saturday, November 15, 2003 2:58 AM Subject: Re: [freenet-support] Can't receive any Freenet data > > This is sadly a common first user situation. > > Exactly what happened? Did you try to fetch the links on the Web > > Interface page? Even under ideal conditions a node takes a while to > > become fully functional (current estimates are around 24 hours for a > > node to be reasonably useful). > > 24 hours are a long time for just a single connection. > I allways get the following error: > > "Couldn't Retrieve Key > Couldn't connect to the network. Are you sure you have configured Freenet > correctly? Also make sure that you are connected to the internet." > > when trying to connect to a freenet link like: > http://127.0.0.1:/[EMAIL PROTECTED]/TFE//?htl=15&try=3 > > > > > I note that you haven't showed the external internet address of the > > router. Did you add it to the freenet.conf file?: > > ipAddress=82.65.12.3 > > or > > ipAddress=amphibian.dyndns.org > > [ using dyndns is a common solution for such setups, they are a free > > dynamic DNS provider, www.dyndns.org ] > > > I didn't showed it because the external ip changes allways automatically > after the login to my ISP. > I just started the router and then i used the IP the router get from the ISP > after the login in the freenet.conf file, after editing the freenet.conf file > with the new ip i started freenet. > > > > > > Also, did you remove the % at the beginning of the line? > > No sorry i forgot it. > But i removed it a few minutes ago and tried it again but still no success. > I still get the above mentioned error message. > Do i really have to wait 24 hours for the first connection success message? > > > > > > > Those are the iptables firewall rules i used for accesing freenet: > > > iptables -A FORWARD -j ACCEPT -o ppp0 -p tcp \ > > > -s 192.168.100.8 --sport 1024: --dport 23030 -m state > > > --state NEW,ESTABLISHED,RELATED > > > > > > iptables -A FORWARD -j ACCEPT -i ppp0 -p tcp \ > > > --sport 23030 -d 192.168.100.8 -m state --state > > > ESTABLISHED,RELATED > > > > > > iptables -t nat -A PREROUTING -i ppp0 -p tcp --dport 23020 -j DNAT > > > --to-dest 192.168.100.8 > > > > Ok. Tell me your IP address and I will check connectivity. Or come to > > #freenet on irc.freenode.net, we will see if we can help you. > > Ok i just tested on the Shield UP website (a port scanner -> http://grc.com/ ) > if the port 23030 is open. > The results where: > > Port: 23030 > Status: Open > Protocol and Application: Unknown Protocol for this port > Unknown Application for this port > > Seems to me that this is working. > > > > > > > I do not know if it is a firewall rules problem. Check the Open > > Connections page, do you have incoming connections? > > No, the Open Connection page shows the following: > > "Connections open (Inbound/Outbound/Limit) 0 (0/0/512) > Connections transferring (Receiving/Transmitting) 0 (0/0) > Bytes waiting to be sent None" > > Best Regards, > Oliver C. > > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Freenet port not listening according to firewall.
- Original Message - From: "Kevin Bennett" <[EMAIL PROTECTED]> To: "Freenet Support" <[EMAIL PROTECTED]> Sent: Saturday, November 15, 2003 3:01 PM Subject: [freenet-support] Freenet port not listening according to firewall. > I noticed that once again I have no incoming connections. > > Looking at my software firewall logs I see a lot of the following entries > (dozens per minute): > > TCP Syn Packet on non-listening port. Packet has been dropped > Source IP address: > Destination IP address: > TCP Source Port: 4991 > TCP Destination Port: 49247 > TCP Message Flags: 0x0002 > > Adding an 'allow all TCP connections to use this port' rule makes no > difference. > > If I switch off the software firewall (that's okay as I'm behind a hardware > wall too) then I straight away get plenty of incoming connections. This definitely indicates to me that the firewall is the problem. > So for some reason the firewall seems to think that Freenet isn't listening > on 49247 despite the fact that it obviously is. > Does this mean that Freenet isn't advertising its port's 'openness' > correctly? Hardly, applications doesn't need to do any kind of 'advertising'. Applications just open a port and the OS does the rest. What does the appropriate OS tools (netstat for instance) tell you about which ports that is open?. Any differences in the output with the firewall on and off? /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Beginner... all I get is"Waitingfor127.0.0.1..." ...follow-up
>> 3. I'm behind a software firewall, and have set "local host" to the >> firewall IP, with port forwarding to my machine. Is that correct? > >Do you mean the configuration parameter named IPAddress? (I don't >know if windows users see the actual parameter names or not). Or have you set 'localhost' to the firewall IP in your 'host' file? If so... change it back, it should never ever point to another machine.. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Negative Local Ports
These are a programmatical thingy.. They tend to mean that something is wrong with the connection in question.. Maybe not fully opened yet.. Maybe on its way to closing. Check the mailing list archives for an exact description. /N > -BEGIN PGP SIGNED MESSAGE- > Hash: SHA1 > > For sometime now (3 or 4 weeks I think) I have been noticing > -ve Local Port numbers being reported in the Open Connection > Manager screen (Connection Mode). > > It does not seem to be associated with the remote node build > since atm I have 3 connections to a node, 2 with -ve numbers > and 1 with a +ve number. > > I might add that I have 67 other connections to other nodes > before you have a heart attack. All other Local Ports are in > the range of 3000 to 5000. The negative Local Port number is > -5 for both. > > Just rechecked and all 3 connections to the node are now -5. > > C:\USR\LOCAL\Freenet0.5 > [\\VIXEN\Richard]$ ver > > Microsoft Windows XP [Version 5.1.2600] > > C:\USR\LOCAL\Freenet0.5 > [\\VIXEN\Richard]$ java freenet.Version > Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280) > > C:\USR\LOCAL\Freenet0.5 > [\\VIXEN\Richard]$ java -version > java version "1.4.2_01" > Java(TM) 2 Runtime Environment, Standard Edition (build > 1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, > mixed mode) > > Will install 6340 and check with that. Probably take some > time to spot it though as it doesn't happen very often. > > Richard > - -- > - > -- > -- > CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC > TGCCACATCG > CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT > TTTGCTTCAG > dna.pl v0.2.4 (c) 20020613 (tm) rich at > mibnet.plus.com > -BEGIN PGP SIGNATURE- > Version: GnuPG v1.2.3-nr1 (Windows XP) > Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org > > iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+ > 9PrmpUDUqEeAPgXapjUw6Pk= > =Qpl2 > -END PGP SIGNATURE- > > > > -- > ** > ** > This message has been swept clean of viruses by > AVG Anti Virus email Scanner. > http://www.grisoft.com/html/us_index.cfm Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Negative Local Ports
Btw. This should now be 'fixed' in latest cvs. Textual descriptions will be displayed instead of those negative numbers. /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Niklas Bergh > Sent: den 19 november 2003 10:07 > To: [EMAIL PROTECTED]; [EMAIL PROTECTED] > Subject: RE: [freenet-support] Negative Local Ports > > > These are a programmatical thingy.. They tend to mean that > something is wrong with the connection in question.. Maybe > not fully opened yet.. Maybe on its way to closing. > > Check the mailing list archives for an exact description. > > /N > > > -BEGIN PGP SIGNED MESSAGE- > > Hash: SHA1 > > > > For sometime now (3 or 4 weeks I think) I have been noticing > > -ve Local Port numbers being reported in the Open Connection > > Manager screen (Connection Mode). > > > > It does not seem to be associated with the remote node build > > since atm I have 3 connections to a node, 2 with -ve numbers > > and 1 with a +ve number. > > > > I might add that I have 67 other connections to other nodes > > before you have a heart attack. All other Local Ports are in > > the range of 3000 to 5000. The negative Local Port number is > > -5 for both. > > > > Just rechecked and all 3 connections to the node are now -5. > > > > C:\USR\LOCAL\Freenet0.5 > > [\\VIXEN\Richard]$ ver > > > > Microsoft Windows XP [Version 5.1.2600] > > > > C:\USR\LOCAL\Freenet0.5 > > [\\VIXEN\Richard]$ java freenet.Version > > Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280) > > > > C:\USR\LOCAL\Freenet0.5 > > [\\VIXEN\Richard]$ java -version > > java version "1.4.2_01" > > Java(TM) 2 Runtime Environment, Standard Edition (build > > 1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, > > mixed mode) > > > > Will install 6340 and check with that. Probably take some > > time to spot it though as it doesn't happen very often. > > > > Richard > > - -- > > - > > -- > > -- > > CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC > > TGCCACATCG > > CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT > > TTTGCTTCAG > > dna.pl v0.2.4 (c) 20020613 (tm) rich at > > mibnet.plus.com > > -BEGIN PGP SIGNATURE- > > Version: GnuPG v1.2.3-nr1 (Windows XP) > > Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org > > > > iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+ > > 9PrmpUDUqEeAPgXapjUw6Pk= > > =Qpl2 > > -END PGP SIGNATURE- > > > > > > > > -- > > ** > > ** > > This message has been swept clean of viruses by > > AVG Anti Virus email Scanner. > > > http://www.grisoft.com/html/us_index.cfm > ** > ** > Checked by AVG anti-virus system (http://www.grisoft.com). > Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003 > > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/suppor t ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Freenet Stable Build 5039
Or.. as NGR would do it.. Hmmm.. that node is one slow sucker.. better send the query to another one next time. /N - Original Message - From: "TLD" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Wednesday, November 19, 2003 6:07 PM Subject: Re: [freenet-support] Freenet Stable Build 5039 > > This build turns off rejecting queries based on output bandwidth usage, > > a feature that is unnecessary (we have other ways of limiting bandwidth > > usage) and counterproductive to routing. > > Maybe so, but I doubt having a "Data waiting to be transmitted" value above > 30 minutes worth of transmission (with full bandwidth usage) is good for > the routing, either. > I noticed the value notably lower in the latest builds (in the order of > 5-10 minutes) with the bandwidth usage-based queryreject; I hope things > won't get Mighty Bad again :) > > > Might a "I have the key you need but my band is full and can't send it > right now, try searching with the other nodes meanwhile and come back later > if you really need it" message help such situation? > > -- > /~\ The ASCIITLD > \ / Ribbon Campaign "They that can give up essential liberty to obtain > X Against HTMLa little temporary safety deserve neither liberty > / \ Email! nor safety." -- Benjamin Franklin > > > > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Negative Local Ports
That are supposed to build up until the maximum connection limit is reached.. At that point they will start to get dropped whenever a new connection arrives.. Can this be the cause of what you are seeing? /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of > Richard Thomas Harrison > Sent: den 20 november 2003 09:29 > To: [EMAIL PROTECTED] > Subject: Re: [freenet-support] Negative Local Ports > > > -BEGIN PGP SIGNED MESSAGE- > Hash: SHA1 > > Niklas Bergh randomly hit the keyboard and managed to write > on 19/11/2003 09:21: > > | Btw. This should now be 'fixed' in latest cvs. Textual descriptions > | will be displayed instead of those negative numbers. > > So it does (unstable 6342). However, they don't close and > build up. I have sent a very large file to this list (about > 230k) about this. Unsurprisingly it has been held back for > approval before being posted (or not) to this list. > > Richard > - -- > - > -- > -- > CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC > TGCCACATCG > CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT > TTTGCTTCAG > dna.pl v0.2.4 (c) 20020613 (tm) rich at > mibnet.plus.com > -BEGIN PGP SIGNATURE- > Version: GnuPG v1.2.3-nr1 (Windows XP) > Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org > > iD8DBQE/vHs9DehCPPrjI9gRAt/aAJ0Y6KfxjJdS2wptO1QmzE6fDtprxwCfVF5L > T2ZD61GcG8UERF4tJjpKTZ8= > =WmTa > -END PGP SIGNATURE- > > > > -- > ** > ** > This message has been swept clean of viruses by > AVG Anti Virus email Scanner. > http://www.grisoft.com/html/us_index.cfm Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 16/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Unable to start after an insert
What does the log file say? /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Thad Eckard > Sent: den 25 november 2003 19:37 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Unable to start after an insert > > > I just realized that I think I'm having a problem. I made an > insert over the > night, woke up and stopped Freenet for about two minutes, > then tried to > re-start it. Now, Freenet keeps trying to start with no > success. The blue > arrowhead objects behind the rabbit just keep running up. I'm > using 5039. > > _ > Groove on the latest from the hot new rock groups! Get > downloads, videos, > and more here. > http://special.msn.com/entertainment/wiredform> usic.armx > > > ___ > > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-> bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Freenet stable build 5041
If it happens again.. Please spawn the node from a console window and generate a full stack dump for us in its 'hung state'. /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Kevin Bennett > Sent: den 25 november 2003 23:34 > To: [EMAIL PROTECTED] > Subject: RE: [freenet-support] Freenet stable build 5041 > > > FYI: After running this version for 50 mins, all activity > abruptly stopped. Input and output went from 56k/20k to 5k/0k > over a period of 2 minutes. No response from localhost: > either yet the node was apparently still running as there > were dozens of these log entries: > > (freenet.node.states.request.ReceivingReply, YThread-1008, > NORMAL): Receiving connection died in > freenet.node.states.request.ReceivingReply: > etc.. > > followed by quite literally hundreds like this: > > (freenet.message.DataRequest, YThread-2263, NORMAL): Long > messageInitialStateTime 13625 etc... > > and then a section with the occasional Long > messageInitialStateTime interspersed with (freenet.Ticker, > Ticker immediate execution thread, > NORMAL): > > On restarting the node, rates have gone back to normal. Lets > see how long it stays up... > > > Kevin. > > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] Behalf Of Toad > Sent: 25 November 2003 20:45 > To: [EMAIL PROTECTED]; [EMAIL PROTECTED] > Subject: [freenet-support] Freenet stable build 5041 > > > Freenet stable build 5041 is now available. Upgrade using > update.sh or freenet-webinstall.exe, or get the jar from > http://freenetproject.org/snapshots/freenet.ja> r . > > Changelog: > > * Major continuing work on routing: > ** > Contact the least accessed node every 30 seconds with a > recently requested key. This is estimated to add 3kqph to > load, but is very important given the next item. > ** New nodes in the routing table get pessimistic estimators. > So routing is not dominated by new nodes any more. They will > get routed to once they have demonstrated their abilities > through the above mechanism. > ** Try to manage routing table churn: accept new nodes into > the routing table from any wierd source if we have less than > 40 available, not backed off, nodes. If we have more than > that, do probabilistic referencing for StoreData's, and don't > borrow refs from requests. > ** Impose a network level maximum file size of 1MB. This > should make multiplexing easier, simplify code, and prevent > some bad behaviours that might be used for traffic analysis. > ** Make the global estimate, the request failure time, used > in routing, depend on the key AND the filesize. This prevents > bad routing of files of non-typical sizes. > ** Always reset the datasource when we serve data from the store. > ** Other minor changes. > * When we do a request with 'skip datastore' enabled, don't > actually delete the file from the datastore, just ignore it. > * Show the version of each node on the inbound requests page. > Improve the open connections and node reference status pages. > More diagnostics. Etc. > * Lots more bugfixes, logging changes, and other minor improvements. > -- > Matthew J Toseland - [EMAIL PROTECTED] > Freenet Project Official Codemonkey - > http://freenetproject.org/ ICTHUS - Nothing is > impossible. > Our Boss says so. > > > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-> bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Instead of getting smarter, My node seems to get dumber
Steven When you request a web page or similar from the network your node selects where to forward that request to. In certain circumstances your node cannot find a place to send the request on to, that is when you get that message. To see the list of other nodes that your node will forward requests to have a look at 'http://localhost:/servlet/nodestatus/nodestatus.html', if most of the nodes are blue you will see trouble, if most of the nodes are red then you might see some trouble. To weed out any 'bad' nodes from your routing table you have to let your node run for prolonged periods of time (permanently would be prefered). Also, since last weekend the network is undergoing severe changes, probably reinforcing your problems quite a bit. Btw, are you running the latest build (5046)? /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Steven > Sent: den 1 december 2003 09:42 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Instead of getting smarter,My node > seems to get dumber > > > So far I have completely Demilitarized my computer running > the node (placed it > outside of my linksys router's firewall), registered an > account with dyndns > in order to run a permanent node (which finally works) tried > stable and > unstable releases, and am still having the same problem... > When I start my > node, some (maybe half) of the links work (they load so fast > that i wonder if > they are not simply cached on my node already). When I click > dead links i > get an error that tells me to try higher HTL's and stuff. A > few hours go by, > and I think that things will improve as my node "learns" more > about the > network, instead, when I click dead links I get a different > error: "Your > request couldn't even make it off the node". > > I look around at all of the diagnostic information to maybe > find out if I was > somehow completely cut off from the network, but in the "open > Connections" > area, there are like 25 different connections to about 12 > different IP's. > Data is flowing to and from these different nodes, so I know > I'm not cut off > completely. my load indicator usually stays between 15 and > 30, and is > usually steady at around 25. > > If I stay connected to the network in this state for long > enough, will my node > "learn" enough to once again make requests to other nodes? > Do I need to > reseed and restart? Is this "normal" activity for a node? Is > there something > obvious that I'm missing? > > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-> bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Insert file by URI
Yes, it is a known one that hasn't been fixed yet /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Hiu Sing Ngai Sent: den 2 december 2003 11:27 To: [EMAIL PROTECTED] Subject: [freenet-support] Insert file by URI Hello, I'm trying to insert a file to freenet with the webinterface. The insertion has been successed but no CHK key has returned. Only "freenet:CHK@" has returned. Is this a bug? Thanks! Do you Yahoo!? Free Pop-Up Blocker - Get it now ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Problem accessing web interface from differentcomputer
Check the config file.. mainport.allowedHosts might be what you are looking for.. /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Thomas M|ller > Sent: den 29 november 2003 15:59 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Problem accessing web interface > from differentcomputer > > > Hi, > > I just installed freenet on a linux box with sun's > java 1.4.2 package. This linux box does not have an X > windows configured. When I open the web interface with > lynx localhost: it works fine. However, if I try > to access the web interface from another machine with > mozilla, I get the error "document contains no data". > > In the freenet.conf file, I set the options: > %mainport.allowedHosts=127.0.0.0/8,192.168.0.0/24 > %mainport.bindAddress=* > > netstat -l -p | grep java gives me: > tcp0 0 localhost:8481 *:* > LISTEN 18748/java > tcp0 0 *:24436 *:* > LISTEN 18748/java > tcp0 0 *: *:* > LISTEN 18748/java > tcp0 0 *:8891 *:* > LISTEN 18748/java > This indicates to me that the web interface should be > bound to all available interfaces of the linux box. > > What am I doing wrong? How can I manage to access the > web interface from another computer within the > 192.168.0.* subnet?? > > Thomas > > > __ > Do you Yahoo!? > Free Pop-Up Blocker - Get it now > http://companion.yahoo.com/ > ___ > Support mailing list > [EMAIL PROTECTED] > http://dodo.freenetproject.org/cgi-> bin/mailman/listinfo/support > ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Is there a user forum anywhere
Or come visit in #freenet on irc.freenode.net /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of > [EMAIL PROTECTED] > Sent: den 8 december 2003 21:30 > To: [EMAIL PROTECTED] > Subject: Re: [freenet-support] Is there a user forum anywhere > > > > >Is there an English language forum anywhere on the WWW (or > elsewhere) > > >where Freenet users can assist each other? > > > > That might be too anonymity-compromising for a lot of > users. Why not > > use > > Frost or maybe IIP? > > For those who don't mind non-anonymous communication (and > have an account on Livejournal), there's a newly-created > freenet community on there: > http://www.livejournal.com/userinfo.bml?user=freenet -- 9:28PM up 21 days, 28 mins, 2 users, load averages: 0.24, 0.29, 0.26 Every non-empty totally disconnected perfect compact metric space is homeomorphic to the Cantor set. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Explanation for 'nibbles' taken out of icons?
>1. First I get "Waiting for, etc". The search is fanning out, but either I'm queued, or nothing has yet >been found? Your request has gone out, your node is waiting for an answer from the network (to deliver it to your browser) >2. Brief bursts of, "Transferring data, etc", then back to "Waiting...". Data was found at some node, and delivered. Then the search continued? Your browser received an answer from freenet, succesful or not, and then started requestin the next item on the page. Number of simultaneuos browser requests can be configured, the exact method varies from browser to browser. >3. Long periods of "Waiting...". Data has been found, and I'm queued? Either your browser is serializing requests of your node are waiting for an answer from the network. >4. Some image icons get a 'white slash' through them. The data doesn't exist at any of the >available nodes? Almost.. The data couldn't be located on any of the nodes queried.. Might be the same thing, might not.. >5. During long intervals of "Transferring...", a small nibble disappears near >the lower left corner of some of the image icons, one by one. The search for the data >linked to this particular icon has been exhausted; this image data is not available? No idea what those nibbles are.. >6. After a long period (an hour, or more), I get "Done". Perhaps a dozen poster images >have been received, but, when the nibble is missing from every remaining image icon, >the search for any data related to this freesite is over? Right >7. How does the 'nibble' differ from the 'white slash'? Depending on the browser the white slash might broken image/image which isn't present on the supplied URL/request timeout.. The nibble I don't know anything about.. >8. Should one be patient enought to let freenet run at a site until "Done" is >reported, or is it a waste of time (and freenet resources) to let the search go on for >longer than, say, a minute? Ten minutes? An hour? No.. There are built-in timeouts and stuff so those things will work out automatically. >9. Tomorrow, different nodes (and a new build - I'm using 5049 today) may be available, >so the attempt to download the poster page could be repeated, with perhaps a different result. Right.. And maybe the author of the site reinserted missing stuff or maybe a different set of nodes reqceived the query ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Freenet under Linux issues
> Also, when I try clicking on Spread Freenet, I get a blank > page that says nothing more than 'Error'. ?? > > Justin Does the link take you to an URL which seems right? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Freenet under Linux issues
> On Wed, 10 Dec 2003 10:54:24 +0100 > "Niklas Bergh" <[EMAIL PROTECTED]> wrote: > > > > Also, when I try clicking on Spread Freenet, I get a blank > > > page that says nothing more than 'Error'. ?? > > > > > > Justin > > > > Does the link take you to an URL which seems right? > > It doesn't show me anything but that word, no links or URL's. Bah.. I didn't ask about the page.. I asked about the URL (it can usually be seen in the 'Address' field of the browser). Alternatively, chek where the link you click to get to the distrubution page lead to? This is displayed by most browsers somewhere when you hover the mouse. > The windows version doesn't seem to understand that I set the > ini to make it a perm node, so it refuses to even try. Maybe it cannot? Have you configured the Ipaddress properly if you are NAT:ed? Have you read what it says in the log? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] multiple nodes inside a NAT network??
> Just curious as to the logistics of multiple nodes behind a > NAT'ed firewall. I can have each of them have different > listen ports and forward the ports to the correct node, but > what will nodes outside the network think of multiple nodes > to the same IP? Will the nodes in the network learn to talk > to each other dirrectly? Will there be any proformance impact? > > Thanks! It ought to work just fine.. The network definitely has nothing against multiple nodes seemingly running on the same host. Your nodes will talk to each other through the NAT firewall (assuming is manages to route the connections correctly.. It should do that). Not much of a performance penalty should come from this. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] node references
>i am updating my node references. the message says this should only take a minute. It >has been saying >>that for over ten minutes now . is that normal? Nope.. Try downloading the seednodes.ref file manually from http://freenetproject.org/snapshots/seednodes.ref Put it in the 'Freenet' folder on your harddrive and restart the node to make use of it. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] number of connections + question about node refs
> I've limited the amount of connections my node can make to > 50. I don't know > how this effects the network, how it effects my node's > ability find files or > anything, all I know is this keeps freenet from eating all of > my system's > resources. Please tell me if their is a better way. What kind of resources? Memory, CPU or bandwidth? The main argument for allowing more connections to be open is that it is very expensive (CPU-wise) to open a new connection.. If you allow for more connections to stay open then less connections will need to be opened. Also.. You should never allow less than 2*50 connections if you are running with the default routing table size since the node needs to be able to keep two connections open per entry in the rt. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] network speed
> -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Jens > Skripczynski > Sent: den 17 december 2003 13:35 > To: [EMAIL PROTECTED] > Subject: [freenet-support] network speed > > > Hi, > > I wanted to as a question about network speed in general. > > How effektive does freenet use the total bandwidth assigned > to it ? (e.g. compared to http over TCP/IP). TCP/IP has an > overhead of about 10% and give http another 10%, leaving a > total bandwidth of approx. 80% for Data connections ([1]). Freenet doesn't use HTTP between nodes. > Next freenet. AFAIK all packets my freenet server sends have > to pass a fixed number of other nodes (chosen random), before > reaching their destiny. AFAIK n is 5 by now. Also freenet has > its own overhead, with routing, > searching,... say 20%. The request will stop passing through nodes earlier when the data is found. The ratio routing/data transfers varies very much between nodes. > So lets say I have a total bandwidth of 120kB (6 is a > divisor) then I have my bandwith and the bandwidth of 5 other > computers I have to route, thus having a new bandwidth of > 20kB that I can assume to be my own. -20% leaves me about > 16kB. 16/120 = 13 1/3 %. Usually routed messages/queries isn't what should consume most of your bandwidth. Transfers of located data is what should consume most bw. > Could somebody please verify my calculation / assumption ? > > Is it really that I have to sacrifice more than 85% of my > band-width for > being somewhat in a state of privacy ? I would do it, especially if I didn't need all that bw all the time for something else. Also consider that your node will become better at locating data the more you allow other people to use it (given that routing works as supposed). > [1] This is some assumption. It neglects compression in the > http protocoll > and others. Again, freenet nodes doesn't talk to each other using HTTP. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
Re: [freenet-support] network speed
> Niklas Bergh:
> > > -Original Message-
> > > From: [EMAIL PROTECTED]
> > > [mailto:[EMAIL PROTECTED] On Behalf Of Jens
> > > Skripczynski
> > > Sent: den 17 december 2003 13:35
> > > To: [EMAIL PROTECTED]
> > > Subject: [freenet-support] network speed
> > >
> > >
> > > Hi,
> > >
> > > I wanted to as a question about network speed in general.
> > >
> > > How effektive does freenet use the total bandwidth assigned
> > > to it ? (e.g. compared to http over TCP/IP). TCP/IP has an
> > > overhead of about 10% and give http another 10%, leaving a
> > > total bandwidth of approx. 80% for Data connections ([1]).
> >
> > Freenet doesn't use HTTP between nodes.
> Yeah, I know. I wanted to compare a 'normal' TCP/IP connection
> with a 'normal' Protocoll ('http' - could have been FTP, edonk...)
> with the freenet protocoll.
>
> With my assumptions I have calculated a percentage, that is lost
> by using http over tcp/ip compared to the total bandwidth.
> And got that I can use 80%, thus loose 20% to routing, commands
> -- overhead.
>
> Next I tried to do the same with freenet, with the knowledge I have
> about it.
>
> Since I (and the others) do not have a direct connection to the host,
You might have..or not. That is unknown to your node
> they must use the bandwidth of the other freenet users. Thus the ratio
> compared to the http over tcp/ip must be much less. Because if I use
> bandwidth from others, they will use mine, too - And most of the time
> at the same ratio.
>
> So now I tried to figure out, how much band-width is lost and got with my
> assumptions something around 20% - where you say I'm wrong.
> Has somebody done a calculation - experiment figuring out, how good the
> actual routing is (like take a netto traffic of 5 MB data and calculate
the
> brutto amount of data for routing) - next calculate how much bandwidth it
> consumes for each node, the calculate the percentage between the total
> bandwidth and the netto Bandwidth for data.
>
> Have you a better assumption for freenet ? It is very hard to make an
> assumtion from 'varies very much'. Varies very much with an average of 7
hops
> is more helpfull...
The number of hops really boils down to the popularity of data combined with
the efficency of the routing data/algorithm in your node (= base
effectiveness of the actual routing algorithm+your nodes experience level).
Both of these facts varies very much, hence my fuzzy description.. There has
been much discussion on the devl mailing list recently on how many hops that
is needed to locate data. One theory is that most data should be reachable
withing 10-15 hops.. If the data is very popular this value might even be
decreased down to 2-3 hops or so I assume.. If the data you are requesting
happens to be data that matches your nodes specialization very well then you
might find it at 0 or 1 hops even.
To calculate the current average effectiveness on a specific node you could
probably use TrailingBytesAttempted/SentBytes from the diags page. On my
high bw, stable branch, node that figure is somwhere around 0.93 when
averaged over 24 hours (7GByte/7.5GByte).
/N
/N
___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
[freenet-support] Stable build 5052
Freenet stable build 5052 is now available. Changelog: * tfAbsoluteMaxThreads config parameter added. tfAbsoluteMaxThreads will allow you to limit maximum number of threads the YThreadFactory will spawn. Default value is 500 threads. This solves at least some of the OutOfMemoryError:s people are encountering. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Stable build 5055 crashes under Linux
Yup. This means that the newest item in your datastore has a timestamp that is larger than what your current system clock says the time is. Have you modified the clock on the machine or similar recently? I recommend that you locate those files in your ds that is timestamped in the future and reset their timestamps to now (touch maybe). Or.. If it only is a matter of minutes.. Restart the node after those minutes have passes. /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of > Justin The Cynical > Sent: den 13 januari 2004 09:56 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Stable build 5055 crashes under Linux > > > *sigh* > > I got the message about the new build and the reports that > it's faster than the older builds. Yippie! > > So, I run update.sh, delete the old freenet.log, touch it, > and start the following command as nobody: > > sh start-freenet.sh ; tail -f ./freenet.log > > And here is what I find in my log: > > Jan 14, 2004 12:34:20 AM (freenet.node.Main, main, NORMAL): > Starting Freenet (Fred) 0.5 node, build #5058 on JVM Sun > Microsystems Inc.:Java > HotSpot(TM) Client VM:1.4.2_03-b0 2 > Jan 14, 2004 12:34:22 AM (freenet.node.Main, main, NORMAL): > loading node > keys: node Jan 14, 2004 12:34:22 AM (freenet.node.Main, main, > NORMAL): Read node file Jan 14, 2004 12:34:23 AM > (freenet.node.Main, main, > NORMAL): starting filesystem Jan 14, 2004 12:34:26 AM > (freenet.node.Main, main, ERROR): Unexpected Exception: > freenet.fs.dir.DirectoryException freenet.fs.dir.DirectoryException: > Clock skew > at > freenet.fs.dir.NativeFSDirectory.verifyList(NativeFSDirectory. > java:2042) > at freenet.fs.dir.NativeFSDirectory.(NativeFSDirectory.java:943) > at freenet.node.Main.main(Main.java:684) > > Obviously, it's not going any further. Any ideas? > > Justin > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.su> pport > ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] simple question
Title: Message Works fine here /N -Original Message-From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Matt WeaverSent: den 14 januari 2004 13:46To: [EMAIL PROTECTED]Subject: [freenet-support] simple question I cannot reach www.freenetproject.org to download all the new goodness that I have read about on the various mailing lists... Is the site down for some reason, or should I look harder on my end? I am having no other connectivity issues with my old freenet node, or any other internet related traffic... I have also tried to connect to the site from 3 distinct places, all on 3 totally different ISPs, and types of connectivity. -Matt ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Stable build 5055 crashes under Linux
I have checked to code. The file property that is used is 'last modified time'. Can you verify that your touch modified this property on the fields. I have now committed code to unstable which gives a more informative error message. Might be included in the next stable build if Matthew chooses to merge the change. /N > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of > Justin The Cynical > Sent: den 14 januari 2004 08:43 > To: [EMAIL PROTECTED] > Subject: Re: [freenet-support] Stable build 5055 crashes under Linux > > > On Wed, 14 Jan 2004 10:00:11 +0100 > "Niklas Bergh" <[EMAIL PROTECTED]> wrote: > > > Yup. This means that the newest item in your datastore has > a timestamp > > that is larger than what your current system clock says the time is. > > > > Have you modified the clock on the machine or similar recently? > > > > I recommend that you locate those files in your ds that is > timestamped > > in the future and reset their timestamps to now (touch > maybe). Or.. If > > it only is a matter of minutes.. Restart the node after > those minutes > > have passes. > > Tried that. In fact, I just went and touched every file in > the ./freenet filesystem, including the subdirectories. Same > results. ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.su> pport > ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Helping with website & a little question...
> Hello, > > I'd like to help freenet creating a translated into french > website, and also writing so docs or HOWTO etc. Wonderful > BTW, I've already written some articles about freenet such as > http://www.linuxfrench.net/article.php?> id_article=597 but the > comments are "we dont understand > anything on the website" or "I cant fetch any document" etc. > That's why I'd like to write some french docs and translate > the web site. > > Who should I contact ? I would suggest the project leader Ian Clarke, [EMAIL PROTECTED] He will most likely read your mail very soon. :) >Who is maintaining the website ? No-one and everyone > Is the website maintained through a CVS ? It is. > Otherwise, a little technical question. My node is _always_ > overloaded (due to BW limit 128Kb/s), and my routing table > knows only 50 other nodes even after some days of uptime. Do > I have a problem with my node, or others have also these kind > of values ? Nope, that is perfectly normal.. The overload issue is beeing worked on continously and 50 is the default configuration value for how many other nodes the node should try to route to. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] New node not working..."500 server error"from 127.0.0.1:8888.
> I never changed the browser configuration when I went from dial-up to > cable. Then again, since it is a Microsoft product, maybe it's going > around changing things behind my back and exercising more autonomy > than it should. I'll check... > All there is in LAN settings (which I assume will be used for > anything going through the network card, including cable inet) is > "automatically detect settings". There's a "bypass proxy server for > local addresses" option, but checking it would require taking off > "automatically detect settings" and setting who knows what else to > make normal Web browsing work again. 'Automatically detect settings' makes IE hail your ISP for proxy configuration and thereafter use the proxy the ISP gives you back for every single web page you are fetching from the net... Seems that the problem here is that your ISP has a broken automatic configuration script. This brokenness causes your your browser to ask the ISP:s proxy to fetch a page from itself and then send it to you.. A non-broken configuration script would make your browser ask your own machine for the page instead (and that is where it actually resides). Not using a proxy is 'normal browsing'. Just untick the 'automatically detect settings' checkbox and see if you can browse the web correctly that way.. You can always turn it back on again if it doesn't.. This feature is mostly used in enterprises, not so much for home internet connections. > Why on earth is this proving to be so complicated... *sigh* No other > p2p software I've got has had the slightest hiccup associated with > the transition to cable -- the speed boost and stabler connections > are all they seem to notice. :) Try accessing BearShares localhost web interface for instance.. Same thing ought to happen > Also, browsing locally hasn't been affected before, now that I think > of it. Several things on my system have documentation in plain-jane > HTML, notably GTKRadiant, and those render OK in IE. Seems like it > has no problem with static local content, only local services on > loopback? Most of those documentation page doesn't come with a web server serving them.. The problem has nothing to do with the actual content but rather with how it is delivered to the browser If the url is something like file:///yyy/zz.html the files are read directly from your local drive If the url is something like http:///yyy/zz.html the files are requested from a web server running on machine '' The proxy settings in IE only applies to http server connections. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
Re: [freenet-support] Odd failure(?) mode, and updating.
- Original Message - From: "Paul Derbyshire" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Friday, January 16, 2004 8:30 AM Subject: [freenet-support] Odd failure(?) mode, and updating. > You may remember me as the one who had problems with fproxy that > proved to be brain-dead IE defaults. Turns out fproxy and my node are > working fine, and the node gets around 1 request a second suggesting > it's integrating way better than the freesite of evil keeps bitching > about. :) > > Reachability of stuff browsed through the interface seems to improve > as it gels into the network. Good to hear, that is one of the reasons the why it is good to run a permanent node. > Then this AM there was an incident, which happened to catch me in > front of the keyboard. It was hard not to notice, since the whole > system became largely unresponsive. For whatever reason, my node had > spawned over 5000 new threads in a matter of seconds and bloated to > take up much more RAM and most of the CPU, forcing me to restart the > service from the tray menu. Hopefully enough is cached between > sessions that this won't seriously compromise the node's integration. > > I have a number of new questions, none of which the FAQ will answer. > 1. What caused this? I've heard of some versions grabbing a lot of > system resources when inserting certain kinds of keys locally through > FCP, but not spontaneously or as a result of requests. Can it happen > when some kinds of keys are inserted by just propagating to your > node? Was it trying to upload and store a large file, maybe one that > came in 5000 asynchronous fragments? Pathological behavior that > cripples the host system until the node is restarted manually, > possibly then hurting the network by interrupting what would have > been an important task for others or by setting back the "integration > clock" on your node is, IMO, bad. Thread, CPU, and memory use may > need to be throttleable as bandwidth currently is. (The same applies > double to the gnutella client I run, though, which frequently bloats > up to 2000 threads and uses way more ram than the freenet node under > normal circumstances -- i.e. normal for the node AND the gnutella > client. :)) The theory is that this happens when the node finishes a huge bunch of stuff at the same time (for instance when we have queued lost of messages to another node and then that dies.. suddenly we have large amounts of failure messages to handle). And.. even worse, when the node has huge amounts of threads running it will have problems catching up since we all the time receives more messages etc over the network that are supposed to be processed -> even more threads spawned > 2. Is this already addressed by the update? It is in the version you are running even.. set the config param 'threadFactory=Y' in the freenet.ini file (dont forget to remove the '%' comment sign). This will cause your node to use another threadfactory which respects the tfAbsoluteMaxThreads param (which defaults to 500 or so) > 4. My machine seems to get a new IP address every so often, > automagically, and not just after a reboot. How well will the node > handle that?: It checks periodically. > a. Will it start screwing up if the IP changes mid-session and have > to be manually restarted? How to detect this or better yet, automate > it? Short of restarting it on a fixed schedule, which would probably > be bad. Or will it discover the new ip for itself? Perhaps as long as > it works OK without uncommenting and changing the ipAddress line in > freenet.ini it will cope automatically? Yes > b. How bad an effect on the network will the dynamic IP have, > especially if it requires periodic node restarts beyond the usual > "Windows had a cerebral embolism in its atrophied and still largely > 16-bit brain; time to reboot again, sigh" situations? > I'd rather avoid the dyndns.org service that I was shocked to find > pimped in a comment in the configuration file. Shocked, because of > this from its Click-through Terms of Service Of The Week(tm by > Microsoft who pioneered the practise): Sure, a fixed IP would of course be better but fred is designed to cope with IP changes (read up on what ARK's (freenet only term) are if you want details) /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Which JRE is recommended for Win2k
> I'm running with the IBM JVM 1.4.1 wich has (at least under > linux) dramatically better performances than the SUN JVM. And is not available for windows yet :( I am running 1.4.2_03 and cannot say I am seeing any problems that are caused by the actual JVM version... /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Re: Which JRE is recommended for Win2k
> -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Someone > Sent: den 16 januari 2004 13:51 > To: [EMAIL PROTECTED] > Subject: [freenet-support] Re: Which JRE is recommended for Win2k > > > Herve Lefebvre schrieb: > > > What kind of errors ? > > I already reported them here and mailed some log files to toad. > > > or maybe a configuration problem. > > It is mainly on default configuration, I just had to reduce > the max connections to 80 because of my "cheap" SOHO router. > And with the builds previous to 5054 (the non mux builds) it > run for days without errors in the log, CPU and memory usage > was quite high but it didn't stall. > > > I'm running with the IBM JVM 1.4.1 wich has (at least under linux) > > dramatically better performances than the SUN JVM. > > Is there a stand alone JRE from IBM? I just found the big JDK > for Windows, which isn't good according to the readme of fred. Does it really include the 1.4.1 JVM or does it only include the 1.3.1 one? If it includes 1.4.1 I'd really much like to know where I can download it. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] 5061 Observations & questions
> -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] On Behalf Of Kevin Steen > Sent: den 16 januari 2004 12:35 > To: [EMAIL PROTECTED] > Subject: [freenet-support] 5061 Observations & questions > > > Some observations from my 5061 node, ocmContents page (and > the resulting questions to enhance my understanding of what's > going on.) : > > Established node, restarted and run for 2 hrs: > Total amount of messages transfered > Type > Sent/Received > DataNotFound >28/58 > InsertReply > 1/1 > StoreData >16/12 > Accepted >28/57 > NodeAnnouncement > 0/3 > QueryRestarted >28/59 > InsertRequest >56/25 > DataReply >16/17 > QueryRejected >29/65 > DataInsert > 1/5 > DataRequest >67/29 > QueryAborted > 3/3 > > + Shouldn't sent InsertRequests always be >= received InsertRequests? > (i.e Inserts from others + local inserts?) I have 56/25 > without doing any local inserts. Some of your InsertRequest where QR:d by the receiver -> Your node sent them to another node. > + Is there a timeout on data waiting to be transmitted? My > node seems to > get to approx 100KiB waiting and then everything stops > changing on the Messages transferred display. The data > waiting goes up and down about 5Kib, indicating something is > happening, but none of the message counts change. > > + How long until references are removed? Some of my Routing Table > entries still contain more than rtMaxRefs entries after 48 > hrs. Do they stay until the node is dropped from the routing table? Hmm.. Did you decrease your rtMaxRefs value in order to make the number of refs break the boundary? Usually refs are replaced with new ones when a new one from that node comes along or so.. > + How long until nodes are dropped from the routing table? They are never dropped, they are just replaced by other nodes (I think). > + What causes synchronisation between inbound & outbound > bandwidth? Only > my outbound bandwidth is limited (512/128 cable connection) > but inbound quickly stabilises at approx 90% of outbound. Nothing does it explicitly. A couple of things might cause a non-explicit sunc though, for instance: 1. If all data your node is sending actually is relayed from other nodes your outbound bw will never be larger than your inbound one. 2. Your node will usually not send a message unless it receives one and when it so does it will send at least one message. Regards /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
Re: [freenet-support] Marked specialisation with 6441
Hmmm.. possibly. I run two unstable nodes and both of the nodes 'Histogram of requested keys' looks better than they have for a long time. - Original Message - From: "Roger Hayter" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Friday, January 16, 2004 10:09 PM Subject: [freenet-support] Marked specialisation with 6441 > Has anyone noticed considerable specialisation appearing with the > current unstable builds (last 3/4 days)? I am getting 3:1 peaks in > "inbound request search keys" and "successful inbound request search > keys" for the same key space, as well as a distinct correlated peak in > datastore keys. So far rather flat success probability. This is so > different from the last six months I am surprised no one has commented. > Other routing success criteria (like "routedToChoiceRank") also seem to > be improving. I find this surprising as my node is only successfully > answering between 1 in 50 000 and one in 500 000 incoming queries, but I > wonder if it is a Good Thing? > -- > Roger Hayter > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
Re: [freenet-support] Number of stable nodes
Yet a couple... Connections open (Inbound/Outbound/Limit) 621 (576/45/956) Number of distinct nodes connected 507 /N - Original Message - From: "Kevin Bennett" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Sunday, January 18, 2004 12:36 PM Subject: RE: [freenet-support] Number of stable nodes > Slightly different here, my node is almost up to its limit: > > Connections open (Inbound/Outbound/Limit) 507 (471/36/512) > Number of distinct nodes connected 427 > > Kevin. > > > -Original Message- > From: [EMAIL PROTECTED] > [mailto:[EMAIL PROTECTED] Behalf Of Lefebvre Hervé > Sent: 18 January 2004 11:11 > To: [EMAIL PROTECTED] > Subject: Re: [freenet-support] Number of stable nodes > > > -BEGIN PGP SIGNED MESSAGE- > Hash: SHA1 > > On Dimanche 18 Janvier 2004 09:22, S wrote: > > > Connections open (Inbound/Outbound/Limit) 417 (379/38/512) > > Number of distinct nodes connected 333 > > Same here : > > Connections open (Inbound/Outbound/Limit) > 350 (329/21/512) > > - -- > Hervé LEFEBVRE > [EMAIL PROTECTED] > -BEGIN PGP SIGNATURE- > Version: GnuPG v1.2.3 (GNU/Linux) > > iD8DBQFACmnD/iEFFjpUUjMRAi1VAJ425dGu/JNcURFZVItqcJep3uoBzQCcCtkc > EEzZA7g1krOFUVniJndhs6k= > =FTpj > -END PGP SIGNATURE- > > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > > > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
