Hello Meike,
We had a known period of delay last week - hopefully your job was able
to processes in the time since then. This is how you can determine a
job's status:
https://wiki.galaxyproject.org/Support#Dataset_status_and_how_jobs_execute
The Main site is down right now, but watch our
Hello,
I am trying to map sequences with Bowtie for Illumina. I have been waiting for
a whole day now but it still says Job is waiting to run. Are the jobs stuck
in a queue or is there any other problem?
Thanks a lot in advance!
Meike
Hi Maria,
I didn't notice any obvious problematic usage, format, or content issues
with the Tuxedo pipeline execution in your history. Your protocol is
right on track. This leaves data and parameter inputs to consider.
I did notice that you are mainly using defaults and omitting the use of
Hello,
I am new to cuff diff and just got my data output back and it doesn't look
like anything is statistically significant. There are three treatment
groups with two biological replicates each group. I am not sure if I made
an error somewhere along the line, need to adjust the parameters, or if
Hi Maria,
More details are needed to help. Would you like to share a history with me?
You might also find the tutorials and other resources for RNA-seq
analysis we have helpful. Many are linked from here:
https://wiki.galaxyproject.org/Support#Tools_on_the_Main_server:_RNA-seq
I've also
Hi all,
we are two new galaxy users.
We have developed 2 new tools and we would connect them into a new
workflow.
We are able to import both tools and to link them into a workflow but we
aren't able to pass the output of the first tool as the input of the
second tool.
The first tool
Hi Pasquale,
From a quick look (and I am not the tool-building expert of our team!),
I suspect that the problem is with the format assigned to the output
of the first tool, and input of the second tool. Specifically,
format=string is problematic, unless you have also defined this in
your
You might also use ( / add to main) the CutAdapt tool, which is
available in the main toolshed. It takes multiple adapters, allows
3/5/both side adapters, and is fast.
Thanks Geert,
This tool was in the back on my mind, but I couldn't find it last
week for some reason!
Seung Hee - this is a very good choice, for use in a local or or cloud
Galaxy.
http://getgalaxy.org
http://usegalaxy.org/cloud
I think I will close out the ticket below and point it to
Thanks Peter for another option!
Jen
Galaxy team
On 11/23/13 6:19 AM, Peter Cock wrote:
On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu wrote:
Hi Seung Hee,
I know we discussed this on the other list, but I didn't point you to the
open development ticket to (potentially)
Hi Seung Hee,
You can request that this tool be added to the public Main server at
usegalaxy.org through Trello and the team will consider it. For right
now, the options are local or cloud. (as in my other reply)
Or, you can look around the the other public servers hosted by our
community -
On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu wrote:
Hi Seung Hee,
I know we discussed this on the other list, but I didn't point you to the
open development ticket to (potentially) extend the functions of the Cut
tool. This is not being actively worked on right now, but
Hi Seung Hee,
I know we discussed this on the other list, but I didn't point you to
the open development ticket to (potentially) extend the functions of the
Cut tool. This is not being actively worked on right now, but you can
follow it for updates if you want.
https://trello.com/c/CbFSHrU5
Hi, I am a galazy user and I want to trim exact sequences (not the
location) from 5' end. Is there any tool I can use for this?
For example,
*AATGATACGGCGACCACCG **AACACTGCGTTTGCTGGCTTTG*ATG
From this sequence, I want to remove *AATGATACGGCGACCACCG,*
*so I can get
Hello;
I am having the following problems with RNAseq using galaxy; we have installed
the Galaxy local version on local server.
1. FastQC not running . gives an error and doesn't run on groomed or
un-groomed FastQ file. The error message shows in the below pic.
2. No reference
Hi all,
I have a dataset with potential pathological variants and I'd like to
combine them to a dataset with known clinical association variants to
identify those responsible for the phenotype.
I'll thank a lot any suggestion.
--
*J. Luis Santomé Collazo*
Hello Pranathi,
Sorry that you are having problems. Instead, use this Galaxy tool and
the links directly between Galaxy and SRA to add the fastq data to your
history:
1 - Get Data - EBI SRA ENA SRA
2 - Enter SRR192339 into the query box and click on search
3 - At the far right in the
Hello Jianguang,
The RNA-seq tutorial was just updated:
http://main.g2.bx.psu.edu/u/jeremy/p/galaxy-rna-seq-analysis-exercise
Hopefully this helps,
Jen
Galaxy team
On 8/9/12 10:41 AM, Du, Jianguang wrote:
I have RNA-seq datasets of several cell types. I want to compare
alternative splicing
Hello,
I am attempting to use Galaxy to calculate the mean sequence read
length and identify the range of read lengths for my 454 data. The
data has already been organized and sorted by species. The format of
the data is as follows:
On Thu, Aug 2, 2012 at 7:50 PM, D. A. Cowart dac...@psu.edu wrote:
Hello,
I am attempting to use Galaxy to calculate the mean sequence read length and
identify the range of read lengths for my 454 data. The data has already
been organized and sorted by species. The format of the data is as
Hi Jiwen,
As far as I know, this is possible. The CuffDiff log2 value is defined
here: http://cufflinks.cbcb.umd.edu/manual.html#gene_exp_diff
7 FPKMx 8.01089 FPKM of the gene in sample x
8 FPKMy 8.551545 FPKM of the gene in sample y
9 log2(FPKMy/FPKMx)
I think the sign is to show if it is x-fold more than the first
condition (+) or x-fold less than the first condition (-). A
regular fold would give you values from 1-whatever if sample 2 is
more than sample 1, and a fraction (0-1) if sample 1 is expressed
more
Hi Noa,
This is it exactly - thanks for adding in the interpretation!
Jen
On 5/10/12 11:54 AM, Noa Sher wrote:
I think the sign is to show if it is x-fold more than the first
condition (+) or x-fold less than the first condition (-). A regular
fold would give you values from 1-whatever if
Hello Tilahun,
Are you logged into your Galaxy instance UI using your admin account?
This will display the Admin menu.
Admin permissions are set up in the universe_wsgi.ini file:
# -- Users and Security
other items
# Administrative users - set this to a comma-separated list of valid
Hi Jennifer,
This is a subject I'm interested in. I wonder if you could share a
workflow to estimate percentage of reads mapping to for example
exomes(I can get the coordinates for a GFF dataset). I have a mapping
result for RNA-seq data and by looking in the browser, it seems to
also have a lot
Hi,
I am very confused by my mapping. Please help me figure out what's wrong with
my operation.
I got Illumina Hiseq 2000 paired end reads (mouse), and I used Tophat to map
these reads.
After mapping, I used IGV to have a look at the mapping.
I can see that some of the reads fall into exons
Hi Jiwen,
The bioinformatics part of your analysis sounds as if it went fine, so
that is good news. This list may not be the best place to get feedback
about library construction methods, but we can see who has help to offer.
I did a quick search myself and found this recent publication that
Hi Team,
This is Vijay from ELogic Technologies Pvt Ltd, Bangalore, India.
1. Using Galaxy local
2. NA
3. Galaxy was downloaded using the tar files
4. NA
5. When i tried to install Cufflinks into my system i am getting the following
error.
In file included from hits.h:21:0,
Hi,
I read on Readme for MACS that: For the experiment with several
replicates, it is recommended to concatenate several ChIP-seq treatment
files into a single file.
Now, I have illumina ChipSeq data: two files for IP samples and two files
for Control samples. Is It right to use Concatenate
@lists.bx.psu.edu
Subject: [galaxy-user] Help with sam to bam
Message-ID:ae8e036c-cbd3-46f9-b5a4-0615cd806...@uga.edu
Content-Type: text/plain; charset=us-ascii
Hi,
I was wondering if someone could help me with an error message I'm getting
after performing a sam to bam conversion in galaxy. I've used Bowtie
Hi,
I was wondering if someone could help me with an error message I'm getting
after performing a sam to bam conversion in galaxy. I've used Bowtie to map
sequence reads to a custom fasta file corresponding to one chromosome in my
organism. The mapping seems to work fine, but when I attempt a
Subject: Re: [galaxy-user] Help!! with Galaxy Cloud!
To: Mike Dufault dufau...@yahoo.com
Cc: galaxy-u...@bx.psu.edu
Date: Wednesday, April 13, 2011, 11:15 PM
Hi Mike, Once the given EBS volume is attached and mounted, all of the data
should be in /mnt/galaxyData/files/000/This assumes
Afgan eaf...@emory.edu
Subject: Re: [galaxy-user] Help!! with Galaxy Cloud!
To: Mike Dufault dufau...@yahoo.com
Cc: galaxy-u...@bx.psu.edu
Date: Wednesday, April 13, 2011, 11:15 PM
Hi Mike,
Once the given EBS volume is attached and mounted, all of the data should
be in /mnt
step closer.
Thanks again,
Mike
--- On *Fri, 4/15/11, Enis Afgan eaf...@emory.edu* wrote:
From: Enis Afgan eaf...@emory.edu
Subject: Re: [galaxy-user] Help!! with Galaxy Cloud!
To: Mike Dufault dufau...@yahoo.com
Cc: galaxy-u...@bx.psu.edu
Date: Friday, April 15, 2011, 8:21 AM
Hello Galaxy Staff,
My data has been running on the Amazon EC2 for just over 24hrs. I have not
closed any windows and my Exome analysis made it all the way through to filter
on Pile up. I have two tabs for this instance. One is the Galaxy Cloudman
Console and the other is the tab where I
Hi Mike,
Try accessing your Galaxy instance now. It should be ok.
The link in your email contained the IP for your instance so I took the
liberty of restarting Galaxy and that brought it back up. There seems to
have been an issue with Galaxy accessing its database and that resulted in
Galaxy
--- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote:
From: Enis Afgan eaf...@emory.edu
Subject: Re: [galaxy-user] Help!! with Galaxy Cloud!
To: Mike Dufault dufau...@yahoo.com
Cc: Anton Nekrutenko an...@bx.psu.edu, galaxy-u...@bx.psu.edu
Date: Tuesday, April 12, 2011, 8:55 PM
Hi Mike, Try
--- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote:
From: Enis Afgan eaf...@emory.edu
Subject: Re: [galaxy-user] Help!! with Galaxy Cloud!
To: Mike Dufault dufau...@yahoo.com
Cc: Anton Nekrutenko an...@bx.psu.edu, galaxy-u...@bx.psu.edu
Date: Tuesday, April 12, 2011, 9:16 PM
Ahh, for some
if the analysis would be compromised.
Thanks again to you and the whole Galaxy team.
Best,
Mike
--- On *Tue, 4/12/11, Enis Afgan eaf...@emory.edu* wrote:
From: Enis Afgan eaf...@emory.edu
Subject: Re: [galaxy-user] Help!! with Galaxy Cloud!
To: Mike Dufault dufau...@yahoo.com
Cc
39 matches
Mail list logo
