or advice what to try/look into much appreciated. Graeme thinks
> it's something with ape not date.phylo...
>
> Very best
>
> Roland
>
> [[alternative HTML version deleted]]
>
> ___
> R-sig-phylo mailing list
> R-s
= 1, method = "equal").
>
> Roland
>
>
>
> On Thu, Jul 21, 2011 at 1:24 PM, Klaus Schliep
> wrote:
>
>> Dear Roland,
>>
>> it would be good if you add the datasets, that one can reproduce your
>> results (archotreeresolved, ages). I would gu
s wrote:
>> > Hi
>> >
>> > Thanks guys.
>> >
>> > Attached are the two files (will these work via the list?)
>> >
>> > When I type trackback() all I get is 1: date.phylo(archotreeresolved,
>> ages,
>> > rlen = 1, method = &q
(t1 =
>> "Plant1", t2 = "Plant2", t3 = "Plant3", t4 = "Plant4"))
>>
>>
>> Does anyone have an idea what I'm doing wrong?
>>
>> Thank you.
>>
>> Liutauras
>
> ___
> R-si
o work either.
>
> Any help would be gratefully received.
>
> Jarrod Hadfield
>
>
> --
> The University of Edinburgh is a charitable body, registered in
> Scotland, with registration number SC005336.
>
> ___
> R-sig-phylo mailing list
th the shoreless waves
> Was born and nurs'd in ocean's pearly caves;
> First forms minute, unseen by spheric glass,
> Move on the mud, or pierce the watery mass;
> These, as successive generations bloom,
> New powers acquire and larg
Canto I.V
>
> _______
> R-sig-phylo mailing list
> R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>
--
Klaus Schliep
Université Paris 6 (Pierre et Marie Curie)
9, Quai Saint-Bernard, 75005 Paris
___
R-sig-phylo mailing list
R-sig-phylo@r-project.org
https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
y
>> 1400 S. Lake Shore Dr.
>> Chicago, IL 60605
>>
>> [[alternative HTML version deleted]]
>>
>> ___
>> R-sig-phylo mailing list
>> R-sig-phylo@r-project.org
>> https://stat.ethz.ch/mailman
drej Mikula
>>
>
> ___
> R-sig-phylo mailing list
> R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>
--
Klaus Schliep
Université Paris 6 (Pierre et Marie Curie)
9, Quai Saint-Bernard, 75005 Paris
___
R-sig-phylo mailing list
R-sig-phylo@r-project.org
https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
de Medeiros
>>> PhD Student - Farrell Lab
>>> Harvard University
>>>
>>>[[alternative HTML version deleted]]
>>>
>>> __**_
>>> R-sig-phylo mailing list
>>> R-sig-phylo@r-projec
Dear Gwennaël,
it seems it is a problem with the path to clustal, as the path
contains spaces. Try
clustal(x, exec = shortPathName("C:/Program Files
(x86)/ClustalW2/clustalw2.exe"))
it works for me.
Regards,
Klaus
On 1/3/12, Gwennaël Bataille wrote:
> Dear all,
> I really need some help for u
t [1:5] 2 2 2 1 1
>> $ X2 : int [1:5] 1 2 1 2 1
>> $ X3 : int [1:5] 1 1 1 1 1
>> $ X4 : int [1:5] 1 2 2 2 2
>> $ X5 : int [1:5] 2 2 1 2 2
>> $ X6 : int [1:5] 1 1 2 2 2
>> $ X7 : int [1:5] 2 1 1 1 2
>> $ X8 : int [1:5] 1 2 1 1 1
>> $ X9
Hello Alejandro,
you can use the phangorn package to do this in R.
The code could look like this:
library(phangorn)
tree <- read.tree("treefile") # load the tree / topology
dat <- read.phyDat("datafile") # load the data
#Parsimony, apply length using the ACCTRAN criterion
treeMP <- acctran(tree,
Dear Gwennaël,
first it seems there was a bug in the function prop.clades from ape
introduced recently, results in many zeros of bootstrap values.
This function needs to be replaced in the ape package:
prop.clades <- function (phy, ..., part = NULL, rooted = FALSE)
{
if (is.null(part)) {
Dear Jeike,
you can try the phangorn package. The parsimony functions allow to
specify your own character states and if you use the method="sankoff"
you can define a cost matrix for the transitions between different
states, method="fitch" assumes equal transition costs, but is much
faster. Drop me
Dear Gwennaël,
the bootstrapping function is fine, it is just a problem with the
plotting. Can you try this function, it should work:
plotBSNew <- function (tree, BStrees, type = "unrooted", bs.col = "black",
bs.adj = NULL, ...)
{
prop.clades <- function (phy, ..., part = NULL, rooted = FAL
Hello Brian,
it is quite easy:
trees = bootstrap.phyDat(primates, pratchet, trace = 0)
plotBSNew(treeRatchet, trees)
You can use the same parameters as for pratchet and there is some
support for parallel code if you run it on a terminal (on Linux or
Mac).
Unfortunately there is was a bug introdu
Hi Brian,
I just uploaded a new version of phangorn on CRAN (1.6-0) which solved
the plotBS issue. The new version also returns silently a tree with
the bootstrap values as node labels. So if you want to export a tree
with edge length and bootstrap values, you should do something like
this:
treeR
;
> 14 Taviton Street
>
> London WC1H 0BW
> Tel: +44 (0) 2076798781
>
> [[alternative HTML version deleted]]
>
> _______
> R-sig-phylo mailing list
> R-sig-phylo@r-project.org
> https://stat
Hello John,
it seems the chronogram contains the heights instead of the
edge.lengths for each edge.
Here is a small function to convert the tree. You should check if it
is the same as in treefinder.
convert.tree <- function(tree){
el = numeric(max(tree$edge))
el[tree$edge[,2]] = tree$edge.l
-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>
--
Klaus Schliep
Université Paris 6 (Pierre et Marie Curie)
9, Quai Saint-Bernard, 75005 Paris
___
R-sig-phylo mailing list
R-sig-phylo@r-project.org
https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
Hello Ben,
is your tree ultrametric? Do you have a e.g. UPGMA tree? This would
explain your observation. You can test your tree with
is.ultrametric(trx).
Regards,
Klaus
On 5/27/12, Ben Weinstein wrote:
> Hi all,
>
> I'm trying to decide if this an R error, or an error in
> how I've implement
-phylo@r-project.org
>> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>
> --
> Emmanuel Paradis
> IRD, Jakarta, Indonesia
> http://ape.mpl.ird.fr/
>
> ___
> R-sig-phylo mailing list
> R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>
--
Klaus Schliep
Université Paris 6 (Pierre et Marie Curie)
9, Quai Saint-Bernard, 75005 Paris
___
R-sig-phylo mailing list
R-sig-phylo@r-project.org
https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
Hi Alastair,
I discovered two problems with the analysis. One is your data, which
contains too many transitions and so you lost most of the information
about your the process which generated the data.
There is also a problem with prop.clades, which does not take care
enough for different orderings
Hi Alastair
here is a solution, probably not the most elegant. You may look into
the function as.splits,
phangorn:::print.splits to improve the output and lento for a nicer
way of plotting your results.
x <- y <- list()
for (i in 1:100) {x[[i]] <- rtree(20); y[[i]] <- rtree(20)}
z = c(x,y)
z = l
>>> > R-sig-phylo mailing list
>>> > R-sig-phylo@r-project.org
>>> > https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>>> >
>>>
>>> [[alternative HTML version deleted]]
>>>
>>>
>>> __
[1] -2.220446e-16
>
> I am posting this in case it is of interest to others. As a quick fix,
> I am now rounding x.
>
> Thanks,
> Kelly
>
> [[alternative HTML version deleted]]
>
> ___
> R-sig-phylo mailing list -
@helmholtz-hzi.de>
>
>
>
>
> Helmholtz-Zentrum f?r Infektionsforschung GmbH | Inhoffenstra?e 7 | 38124
> Braunschweig | www.helmholtz-hzi.de
>
> Vorsitzende des Aufsichtsrates: MinDir'in B?rbel Brumme-Bothe,
> Bundesministerium f?r Bildung
s://www.researchgate.net/profile/Luiz_Fagundes_de_Carvalho/?ev=prf_info
>
> [[alternative HTML version deleted]]
>
>
--
Klaus Schliep
Phylogenomics Lab at the University of Vigo, Spain
___
R-sig-phylo mailing list - R-sig-phylo@r-project.org
https
sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
--
Klaus Schliep
Phylogenomics Lab at the University of Vigo, Spain
___
R-sig-phyl
ltiPhylo"
plot(tr2)
for(i in 1:1000){print(i);write.tree(tr2[[i]])} # may helps find you
the trees which fail
write.tree(tr2, file="result.tre")
Cheers,
Klaus
On 2/28/13, Klaus Schliep wrote:
> Dear John,
>
> can you please be a bit more specific with your error message.
bel, ]
>
> [[alternative HTML version deleted]]
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-pro
ject.org/
>>
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
--
Klaus S
rong!
>
>
> Any input welcome,
>
> cheers,
> Xavier
>
> [[alternative HTML version deleted]]
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http:/
> Joe Felsenstein j...@gs.washington.edu
> Department of Genome Sciences and Department of Biology,
> University of Washington, Box 355065, Seattle, WA 98195-5065 USA
>
>
>
>
> [[alternative HTML version deleted]]
>
> ___
r Cell Biology and Genetics*
> *
> (MPI-CBG)
> *
> *
> Pfotenhauerstraße 108
> *
> *
> 01307 Dresden
> *
> *
>
> *
> *
> Phone: +49 351 210-2621
> *
> *Mail: prudent [ at ] mpi-cbg.de
> **---*
>
> [[alt
R-sig-phylo mailing list - R-sig-phylo@r-project.org
>> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>> Searchable archive at
>> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>>
>
> ___________
> R-sig-phylo mailing list - R-sig-phylo
tinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
--
Klaus Schliep
Phylogenomics Lab at the University of Vigo, Spain
http://darwin.uvigo.es/kschliep/
[[alternative HTML version deleted]]
__
!
>
> Douda
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
--
Klaus Schliep
Phylogenomics Lab at the University of V
-- Forwarded message --
From: Klaus Schliep
Date: Thu, Aug 22, 2013 at 6:12 PM
Subject: Re: [R-sig-phylo] Collapsing branches with low bootstrap values
To: "Naxerova, Kamila"
Hi Kamila,
try function pruneTree in phangorn.
data(woodmouse)
f <- function(x) nj(di
;
> Thank you & cheers,
> Sereina
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
--
Klaus
or ways I could modify the pglmm.fit function to
> speed the estimation process?
>
> Thanks in advance for any suggestions. And thanks to Tony and Matt for
> developing these models and making them available in R.
>
> Dan
>
> ______
ctive and
>> has two levels of menus.
>>
>> Joe
>>
>> Joe Felsenstein j...@gs.washington.edu
>> Department of Genome Sciences and Department of Biology,
>> University of Washington, Box 355065, Seattle, WA 98195-5065 USA
>>
>
> ___
his how to predict the number of possible trees?
>
> Best Wishes, Augusto Ribas
>
> --
> Grato
> Augusto C. A. Ribas
>
> Site Pessoal: http://recologia.com.br/ <http://augustoribas.heliohost.org>
> Github: https://github.com/Squiercg
> Lattes: http://lattes.c
lor="black",
> edge.width=3,add=T)
>
> --
> Grato
> Augusto C. A. Ribas
>
> Site Pessoal: http://recologia.com.br/ <http://augustoribas.heliohost.org>
> Github: https://github.com/Squiercg
> Lattes: http://lattes.cnpq.br/7355685961127056
>
> [[alter
gt;
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
--
Klaus Schliep
[[alter
>
> Thanks!
> Fabricia.
>
> ----------
> *De:* Klaus Schliep
> *Para:* Fabricia Nascimento
> *Cc:* "r-sig-phylo@r-project.org"
> *Enviadas:* Terça-feira, 8 de Abril de 2014 13:13
> *Assunto:* Re: [R-sig-phylo] chronos and gammaStat
>
> Hello Frabricia,
&
this is the problem?
> Should I convert it?
>
> Thanks!
>
> ------
> *De:* Klaus Schliep
> *Para:* Fabricia Nascimento
> *Cc:* "r-sig-phylo@r-project.org"
> *Enviadas:* Terça-feira, 8 de Abril de 2014 13:20
>
> *Assunto:* Re: [R-sig-ph
ls=sort(unique(char)))
>
> anc<-ancestral.pars(tree,char,type="MPR") #here's the crash!
>
>
>
> --
> David W. Bapst, PhD
> Adjunct Asst. Professor, Geology and Geol. Eng.
> South Dakota School of Mines and Te
-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
--
Klaus Schliep
[[alternative HTML version deleted]]
___
R-sig-phylo mailing l
ystématique et Evolution Case postale 39
> UMR CNRS 7205
>
> 57 rue cuvier
>
> FRANCE-75005 Paris
>
> portable +33629375132
> poste 0140793200
>
> [[alternative HTML version deleted]]
>
>
> ___
> R-sig-ph
392:195)),(A393:198,(A394:269,(A395:97,A396:184)
>
> )),((A397:18,(A398:281,(A399:343,(A400:238,A401:280,(A402:163,(A403:308,
>
> ((A404:399,(A405:317,(A406:40,A407:191))),(((A408:230,A409:350),(A410:112,(A
>
> 411:346,(A412:68,(A413:387,(A414:332,A415:333)),(A416:250,(A417:232,(A41
>
> 8:348,(A419:67,(
correct tree and the OutbreakTools function
> >> is not. We can see the why with last three lines in the console:
> >>
> >> identical(tree1$tip.label,tree2$tip.label)
> >>
> >> [1] TRUE
> >>
> >> identical(tree1$edge.length,tree2$edge.length)
&g
"S28"
> >> "S18" "S5""S11" "S18.1" "S20.1" "S16.1"
> >
> >> When I plot any tree in treeP, S18.1, S20.1 and S16.1 appear together
> with
> >> S18, S20 and S16, as intended. So why are t
gt; />/ Thanks,
> />/
> />/ Robin
> />/
> />/ Robin van Velzen
> />/ PhD student
> />/ Biosystematics Group
> />/ Wageningen University
> />/
> />/ Wageningen Campus, Radix building 107, Room W4.Aa.095
> />/ Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands
&
absence of the trait, and ideally is capable
>> of generating a dataframe of the appropriate format for the above functions
>> automatically. It seems that a function to do this should exist already,
>> but as I can't seem to find anything I would appreciate some help
>>
gt; [1] 2 1 1
>
> There are four positions (X1-X4) but only three site patterns and
> therefore three parsimony scores.
>
> Thank you.
>
> Rob
>
>
>
>
>
> [[alternative HTML version deleted]]
>
> ___
> R-sig-phyl
Hello Vojt�ch,
have you looked into consensusNet in phangorn?
Regards,
Klaus
Am 03.11.2014 03:10 schrieb "Vojt�ch Zeisek" :
> Hello,
> let's say I have many gene trees (all have same labels) in one multiPhylo
> object. The trees are not fully congruent. One of the reasons can be
> hybridization
Hello Manabu,
try Ancestors from phangorn.
Regards
Klaus
Am 04.11.2014 08:12 schrieb "Manabu Sakamoto" :
> Dear list,
>
> I was wondering if there was an existing function to identify all the nodes
> (e.g., phylo$edge[,1]) along a pathway from the root to any given tip.
>
> I've found Descendants
list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at http://www.mail-archive.com/r-
> sig-ph...@r-project.org/
>
--
Klaus Schliep
Postdoctoral Fellow
Revell Lab, University of Massachusetts Boston
[[alternative HTML vers
using phytools on a PC. Anybody
> know what gives here?
>
> cheers,
>
> Gabe
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http
ng that something like pml (phangorn) can be modified to do
> that, but I haven't been able to figure it out myself yet.
>
> Thanks in advance,
> George
>
> [[alternative HTML version deleted]]
>
> _______
> R-sig-phylo m
t;
> http://webpages.sdsmt.edu/~dbapst/
> http://cran.r-project.org/web/packages/paleotree/index.html
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
>
.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
--
Klaus Schliep
Postdoctoral Fellow
Revell Lab, University of Massachusetts Boston
[[alternative HTML version deleted]]
__
TML version deleted]]
>
> _______
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archive.com/r-sig-phylo@r-project.org/
>
--
Klaus
leX = FALSE, col = 1, width = 1, cex = 0.8)
>
>
> (THIS DOES NOT WORK!)
>
>
> Thanks in advance for helping me with this!
>
>
> Marina
>
> [[alternative HTML version deleted]]
>
> ___
> R-sig-phylo mailing list - R-si
Dear Kamila,
plotBS checks if trees are rooted or not and if not midpoint roots the tree
nrooted <- root(nj(dist),outgroup=x)
is.rooted(nrooted) # returns FALSE
however the ape function does not pick up that the tree is rooted.
Add the argument resolve.root=TRUE:
nrooted <- root(nj(dist),outgroup=
~--~--~---
>
> [[alternative HTML version deleted]]
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.mail-archi
1.0135
> > write.tree(phy=ltr, file="")
> [1]
>
> "((t2:0.06701971429,t1:0.06701971429):2.686176768,(t5:1.207768321,(t6:0.4984853178,(t4:1.013489985,t3:1.013489985):0.09146602338):0.1028123128):1.545428161);"
> >
> > tr_wFossils = read.tree(file=""
t; > > Searchable archive at
> > > http://www.mail-archive.com/r-sig-phylo@r-project.org/
> > >
> > >
> > >
> > > --
> > > David W. Bapst, PhD
> > > Adjunct Asst. Professor, Geology and Geol. Eng.
> > > South Dakota Schoo
Best,
>
> *Gustavo Burin Ferreira, **Msc.*
> Instituto de Biociências
> Universidade de São Paulo
> Tel: (11) 98525-8948
>
> On Tue, Oct 20, 2015 at 5:15 PM, Klaus Schliep
> wrote:
>
>> Hi Gustavo & David,
>>
>> I attached a file that contains a
That's fine with me.
On Tue, Oct 20, 2015 at 3:29 PM, David Bapst wrote:
> Ah, thanks, Klaus! I was is it alright with you if I merge these edits
> into paleotree?
> -Dave
>
> On Tue, Oct 20, 2015 at 1:15 PM, Klaus Schliep
> wrote:
> > Hi Gustavo & Davi
http://www.linkedin.com/in/anandksrao>
> _
> CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT - translate THAT!
>
> [[alternative HTML version deleted]]
>
> ________
lled any bioconductor packages, chances are that you also
installed Biostrings package are pretty high.
Regards,
Klaus
--
Klaus Schliep
Postdoctoral Fellow
Revell Lab, University of Massachusetts Boston
[[alternative HTML version deleted]]
__
Dear Tim,
I added an optional argument sitewise to the CI and RI function in
phangorn. The vector may contains NaN if the function is undefined: pscore
of 0 for CI, uninformative site for RI.
It is now on github:
library(devtools)
install_github("KlausVigo/phangorn")
Cheers,
Klaus
On Thu, Dec 1
s,foo)
> Error in lapply(ttrees, foo) : object 'ttrees' not found
> > class(trees)<-"multiPhylo"
> > fit.equal<-t(mapply(fit.model,trees,xy))
> Error in mapply(fit.model, trees, xy) : object 'xy' not found
> > mean(fit.equal[,1]) ## should
Hi all,
you have to install the Biostrings package from bioconductor. Than it
should works. Phangorn has a dependency on biostrings and phytools depend
on phangorn.
Have a nice weekend
Klaus
Am 09.01.2016 16:35 schrieb "Donald Miles" :
> Dear All,
>
> I receive the same error as Gabriela when I tr
710
> Cell 423-676-7489
> Office/lab 423-439-4359
> Fax423-439-5958
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at
> http://www.
; G
>
>
>
> Gudrun Gygli, MSc
>
> PhD candidate
>
> Wageningen University
> Laboratory of Biochemistry
> Dreijenlaan 3
> 6703 HA Wageningen
> The Netherlands
>
> Phone 31 317483387
> e-mail: gudrun.gy...@wur.nl
>
> - - - - - - - - - - - - - - - - -
t; PhD candidate
>
> Wageningen University
> Laboratory of Biochemistry
> Dreijenlaan 3
> 6703 HA Wageningen
> The Netherlands
>
> Phone 31 317483387
> e-mail: gudrun.gy...@wur.nl
>
> - - - - - - - - - - - - - - - - - -
>
> Project information:
> http://www.wagening
> > R-sig-phylo mailing list - R-sig-phylo@r-project.org
> > https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> > Searchable archive at
> > http://www.mail-archive.com/r-sig-phylo@r-project.org/
> >
>
> [[alternative HTML version deleted
HI Kamilla,
can you send me your code and data and what phangorn version are you using?
Cheers,
Klaus
On Tue, Jun 14, 2016 at 6:42 PM, Kamila Naxerova
wrote:
> Hi all,
>
> I am trying to attach bootstrap values to a small tree (just 4 taxa).
> plotBS() in the phangorn package gives me the follow
f the workshop, course leaders Drs. April Wright
and Klaus Schliep (with Dr. Liam Revell participating remotely) will
provide an introduction to the primary data structures and methods of
common phylogenetic R packages, the basics of computational algorithms
for phylogenies, and an overview of pa
Hello all,
this may come be surprising to many, but consulting the manual
?is.ultrametric can be helpful. Why not simply try e.g.
is.ultrametric(tree, tol=.01)
So in this sense RTFM
Regards,
Klaus
On Aug 16, 2016 9:31 AM, "Martin Dohrmann"
wrote:
>
> Am 16.08.2016 um 15:20 schrieb Joseph W.
tionary Biology
> Room 2071, Kraus Natural Sciences Building
> Ann Arbor MI 48109-1079
> josep...@umich.edu
>
>
>
> On 16 Aug, 2016, at 10:15, Klaus Schliep wrote:
>
> Hello all,
> this may come be surprising to many, but consulting the manual
> ?is.ultrametric can be
ultrametric(phy, tol = .Machine$double.eps^0.5).
> According to ?.Machine this value does not depend on the machine precision.
> On my laptop, it gives:
>
> R> .Machine$double.eps^0.5
> [1] 1.490116e-08
>
> Best,
>
> Emmanuel
>
>
> Le 16/08/2016 à 18:15,
>
> option = 1 => using the criterion you suggested below
> option = 2 => using the current 'variance' criterion
>
> And other criteria could be added.
>
> What do you think?
>
> Best,
>
> Emmanuel
>
>
> Le 17/08/2016 à 19:16, Klaus Schliep a
Dear Rav,
write.dna() from ape just does this.
Klaus
On Sep 12, 2016 9:07 AM, "Bhuller, Ravneet" <
ravneet.bhulle...@imperial.ac.uk> wrote:
> Hi Thibaut,
>
> Is there anyway I can save the concatenated alignment (created using apex
> and the concatenate function) in FASTA format?
>
> Regards,
>
>
>><https://stat.ethz.ch/mailman/listinfo/r-sig-phylo>
> >>>><https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> >><https://stat.ethz.ch/mailman/listinfo/r-sig-phylo>>
> >>>>> Searchable archive at
> >&g
g
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at http://www.mail-archive.com/r-
> sig-ph...@r-project.org/
>
--
Klaus Schliep
Postdoctoral Fellow
Revell Lab, University of Massachusetts Boston
http://www.phangorn.org/
[[alternative HTML versio
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at http://www.mail-archive.com/r-
> sig-ph...@r-project.org/
>
--
Klaus Schliep
Postdoctoral Fellow
Revell Lab, University of Massachusetts Boston
http://www.phangorn.org/
[[alternative HTML version delete
___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at http://www.mail-archive.com/r-
> sig-ph...@r-project.org/
--
Klaus Schliep
Postdoctoral Fellow
Revell Lab, University
I had a look at the tree. There seems a bug in extract.clades, when the
tree was rooted before with the root() function. extract.clade() seem to
expect some ordering of nodes which seems not satisfied (and it looks as it
was written a long time ago).
I just wrote a small function (easier than to d
ncouver, Canada
>
> [[alternative HTML version deleted]]
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at http://www.mail-archive.com/r-
> sig-ph...@r-project.org/
>
mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at http://www.mail-archive.com/r-
> sig-ph...@r-project.org/
>
--
Klaus Schliep
Postdoctoral Fellow
Revell Lab, University of Massachusetts Boston
http://www.phangorn.org/
________
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
> Searchable archive at http://www.mail-archive.com/r-
> sig-ph...@r-project.org/
>
--
Klaus Schliep
Postdoctoral Fellow
Revell La
rtment of Genome Sciences and Department of Biology,
> University of Washington, Box 355065, Seattle, WA 98195-5065 USA
>
> ___
> R-sig-phylo mailing list - R-sig-phylo@r-project.org
> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>
Josef Puchta
>>
>> VAT-ID No.: DE143293537
>>
>>
>>
>> ___
>> R-sig-phylo mailing list - R-sig-phylo@r-project.org
>> https://stat.ethz.ch/mailman/listinfo/r-sig-phylo
>> Searchable archive at http:/
rzbin...@dkfz-heidelberg.de> wrote:
> Dear Klaus,
>
>
>
> Thanks a lot for your help
>
>
>
> and what is in that case xx and yy?
>
>
>
> Justyna
>
>
>
> *From:* Klaus Schliep [mailto:klaus.schl...@gmail.com]
> *Sent:* Friday, February 24, 2017 6:13 PM
1 - 100 of 144 matches
Mail list logo
