}
Is there something missing in here because the \ifsecondargument check
here makes non sense because the second argument is mandatory and not
optional.
Is this what you want?
\define[2]\mpm
{\digits{#1}%
\doifsomething{#2}{\,±\,\digits{#2}}}
Since I was hoping that I could exploit the zeropadding
r=0pc,
> height=49pc,
> footer=0pc,
> bottomdistance=2.5pc,
> bottom=1pc,
> location=middle]
>
> \define\fullwidth{\dimexpr(\leftmargindistance+\leftmarginwidth+\textwidth)}
>
> \section{First}
> \subsection{First first}
>
> \input tufte
>
> \setupnarrower[left=
\usemodule[pgfplots]
\pgfplotsset{compat=newest}
\usebodyfont[xitsbidi]
\define[1]\cscript{\start\m{{\mathscript{#1}}}\stop}
\startmidaligned
\define[1]\cscript{\start\m{{\mathscript{#1}}}\stop}
\starttikzpicture
\startaxis
\addplot {x};
\node[above left] at (2,2) {\cscript{C}};
\stopaxis
=middle]
\define\fullwidth{\dimexpr(\leftmargindistance+\leftmarginwidth+\textwidth)}
\section{First}
\subsection{First first}
\input tufte
\setupnarrower[left=-9pc]
\startnarrower[left]
\startframedtext[frame=off,topframe=on,bottomframe=on,align=middle,width=\fullwidth]
The whole frame should
On Mon, 4 May 2020, Fabrice Couvreur wrote:
Hi,
Sorry to insist but I cannot fix this problem.
Thanks for any help.
I don't know the answer, but here is a simpler example without pgfplot which
fails (different calligraphic C's):
\define[1]\cscript{\start\switchtobodyfont[xitsbidi]\m
this problem ?
> Thanks for your help.
> Fabrice
>
> begin example
>
> \usemodule[pgfplots]
> \pgfplotsset{compat=newest}
>
> \define[2]\cscript{\start\switchtobodyfont[xitsbidi]\m{{\mathscript{#1}}_{#2}}\stop}
>
> \starttext
>
> \startmidaligned
> \startt
On 5/1/2020 1:58 PM, Gerben Wierda wrote:
But my guess is that if I had used ss instead of rm everywhere in my
code it would have worked as well.
or define the ss first and don't use \rm (first defined is default
On 4/26/2020 4:35 PM, Thomas A. Schmitz wrote:
A similar question has been asked three years ago, and Rik Kabel posted
a partial solution, adapted here:
\defineprocessor [Footnote] [right={ n}]
\define[1]
\fnindex{\index[Footnote->]{#1}}
\starttext
This is a sentence with a t
A similar question has been asked three years ago, and Rik Kabel posted
a partial solution, adapted here:
\defineprocessor [Footnote] [right={ n}]
\define[1]
\fnindex{\index[Footnote->]{#1}}
\starttext
This is a sentence with a term in the index: cat\index{cat}. This
sentence also
y code that doesn’t work.
>> \define[1]\StepsCommand{\doifelse{#1}{2}{k}{#1}\ignorespaces}
>> \defineitemgroup[Steps]
>> \setupitemgroup[Steps][each][n,packed]
>> \setupitemgroup[Steps][each][left=\StepsCommand]
>> \starttext
>> \startSteps
>> \item A
&
Kevin Kenan schrieb am 25.04.2020 um 21:24:
I’m trying to create a conditional that changes the symbol used for certain
item numbers. Here’s my code that doesn’t work.
\define[1]\StepsCommand{\doifelse{#1}{2}{k}{#1}\ignorespaces}
\defineitemgroup[Steps]
\setupitemgroup[Steps][each][n,packed
I’m trying to create a conditional that changes the symbol used for certain
item numbers. Here’s my code that doesn’t work.
\define[1]\StepsCommand{\doifelse{#1}{2}{k}{#1}\ignorespaces}
\defineitemgroup[Steps]
\setupitemgroup[Steps][each][n,packed]
\setupitemgroup[Steps][each][left=\StepsCommand
Hi,
This macro was written by Otared and it works well unless I change the size
of the font (see the second graph).
How to correct this problem ?
Thanks for your help.
Fabrice
begin example
\usemodule[pgfplots]
\pgfplotsset{compat=newest}
\define[2]\cscript{\start\switchtobodyfont[xitsbidi
][protrusion=myown]
\definedfont[Serif*whatever] \setupalign[hanging]
\dorecurse{100}{(#1) }
\stoptext
of course you need to define the cjk fences etc.
Hans
-
Hans Hagen | PRAGMA ADE
unction(dictionary,word,n)
>> return all
>> end
>> )
>> \stopluacode
>>
>> \definehyphenationfeatures
>> [dna]
>> [characters=all,
>>alternative=dna]
>>
>> \starttext
>>
>> \startfram
0 um 05:19 schrieb kaddour kardio :
>>
>> It's noticed that Optima is a Sans Serif font.
>> Maybe it conflicts with MacOS way to handle fonts.
>
> No, ConTeXt doesn’t care what kind of font you define as rm/ss/tt, and the O
> Am 24.04.2020 um 05:19 schrieb kaddour kardio :
>
> It's noticed that Optima is a Sans Serif font.
> Maybe it conflicts with MacOS way to handle fonts.
No, ConTeXt doesn’t care what kind of font you define as rm/ss/tt, and the OS
has no say in that.
TCCTGGTTGG%
TCTTACATTCTGTCGCCTC%
CTACTAGAGCCGGCATATT%
CTAGAAGGGCCGCCTTCATGTGG%
\stopframedtext
\stoptext
[1] https://mailman.ntg.nl/pipermail/ntg-context/2017/089106.html
Wolfgang
And without lua, just two lines of ConTeXt with a bit of TeX:
\define[1]\DNA{\handletokens #1\with\DNAspacer}
no difference towards the result.
This is the MWE based on your solution:
\define[2]\mycommandc{
\startxrow
\startxcell o#1 \stopxcell
\startxcell \tt\WORD{5'-#2} \stopxcell
\stopxrow
}
\definebreakpoint[mybreaks][][nright=100,nleft=100,type=1]
\setbreakpoints[mybreaks]
\starttext
On 4/23/2020 15:01, Benjamin Buchmuller wrote:
Sorry, I have just realized that the problem might not be \WORD{} actually, so
this one hyphenates:
\define[2]\mycommand{
\startxrow
\startxcell o#1 \stopxcell
\startxcell \tt\WORD #2 \stopxcell
\stopxrow
Sorry, I have just realized that the problem might not be \WORD{} actually, so
this one hyphenates:
\define[2]\mycommand{
\startxrow
\startxcell o#1 \stopxcell
\startxcell \tt\WORD #2 \stopxcell
\stopxrow
}
Whereas these ones don’t:
\define[2
using:
\defineseparatedlist
[mylist]
[
separator={,}, quotechar={"},
command=\mycommand
]
\define[2]\mycommand{
\startxrow
\startxcell o#1 \stopxcell
\startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell
\stopxrow
}
Since I
ant to use by setting `g:context_mtxrun`, e.g.:
>
>:let g:context_mtxrun='/path/to/context/mtxrun'
>
> Then, executing :ConTeXt will run the configured command. You may also
> define shell enviroment variables, if needed. For instance, I have
> configured Vim to use my installation
garden.net/Vim>
> >
> > But I do not understand how to customize it to be directed to the path
> > to my engine
> >
> > I’ve installed the LMTX in /Users/janneman/context-osx-64/
>
> I haven't tried LMTX yet, but you may configure the path to the ConTeXt
> e
may configure the path to the ConTeXt
> executable you want to use by setting `g:context_mtxrun`, e.g.:
>
> :let g:context_mtxrun='/path/to/context/mtxrun'
>
> Then, executing :ConTeXt will run the configured command. You may also
> define shell enviroment variables, if needed
to use by setting `g:context_mtxrun`, e.g.:
>
> :let g:context_mtxrun='/path/to/context/mtxrun'
>
> Then, executing :ConTeXt will run the configured command. You may also
> define shell enviroment variables, if needed. For instance, I have
> configured Vim to use my
ConTeXt
executable you want to use by setting `g:context_mtxrun`, e.g.:
:let g:context_mtxrun='/path/to/context/mtxrun'
Then, executing :ConTeXt will run the configured command. You may also
define shell enviroment variables, if needed. For instance, I have
configured Vim to use my inst
shell works a bit differently, but in this case problem is that
OSFONTDIR is a variable like PATH...
Otherwise:
$ set TEST a b c# define TEST envvar as array
$ echo $TEST
a b c
$ echo $TEST[2] # access 2nd member from the array
b
$ set -e TEST[2]# remove 2nd member from the a
, Fabrice Couvreur
a écrit :
> Hi,
> I know that this question has been raised several times (especially by me
> !), but the solutions provided sometimes work and sometimes not, especially
> in this example.
> Thanks for your help.
> Fabrice
>
> \useMPlibrary [dum]
&g
Hi,
I know that this question has been raised several times (especially by me
!), but the solutions provided sometimes work and sometimes not, especially
in this example.
Thanks for your help.
Fabrice
\useMPlibrary [dum]
\define\ItemCommand
{\hskip\zeropoint\relax\autoinsertnextspace
wesome installed in my system , maybe i should switch off
> to otf version?
>
> defining > unknown font 'fontawesome5brandsregular400', loading
> aborted
> fonts > defining > unable to define
> 'fontawesome5brandsregular400.otf' as 'thedefinedfont--0'
&
this is a part of my log file.
i have ttf-fontawesome installed in my system , maybe i should switch off
to otf version?
defining > unknown font 'fontawesome5brandsregular400', loading
aborted
fonts > defining > unable to define
'fontawesome5brandsregul
th] [TeX Gyre Pagella Math][default]
> >> \definetypeface[mainfont][tt][mono] [Dejavu Mono][default] [rscale=0.8,
> >> features=none]
> >> \setupbodyfont[mainfont,11pt]
> >> \usesymbols[fontawesome]
> >>
> >> \define\FA{\dosingleargument\doFA}
>
]
\definetypeface[mainfont][mm][math] [TeX Gyre Pagella Math][default]
\definetypeface[mainfont][tt][mono] [Dejavu Mono][default] [rscale=0.8,
features=none]
\setupbodyfont[mainfont,11pt]
\usesymbols[fontawesome]
\define\FA{\dosingleargument\doFA}
\def\doFA[#1]{\inlinedbox
{\scale[height=1em]{\symbol
Pagella Math][default]
\definetypeface[mainfont][tt][mono] [Dejavu Mono][default] [rscale=0.8,
features=none]
\setupbodyfont[mainfont,11pt]
\usesymbols[fontawesome]
\define\FA{\dosingleargument\doFA}
\def\doFA[#1]{\inlinedbox
{\scale[height=1em]{\symbol[fontawesome][#1]}}}
\starttext
Checked box \FA
][mono] [Dejavu Mono][default] [rscale=0.8,
features=none]
\setupbodyfont[mainfont,11pt]
\usesymbols[fontawesome]
\define\FA{\dosingleargument\doFA}
\def\doFA[#1]{\inlinedbox
{\scale[height=1em]{\symbol[fontawesome][#1]}}}
\starttext
Checked box \FA[check-square-o]
Unchecked box \FA[square-o
Hi Wolfgang,
That 's a pity indeed. I played around a bit and found a dirty hack
using catcodes. Maybe not the best solution, but it works for me.
Posting it here for future reference.
```
\define\textprime{'}
\makecharacteractive '
\define'{\lowerbox{0.3ex}\hbox{\math{\textprime}}}
```
Cheers
if there is a simple way to define my own command
to achieve the following:
\definesynonyms[glossary][glossaries][\fullgloss]%[#4]
% I wonder also what #4 is supposed to do?
\setupsynonyms[glossary][headstyle=bold]
\glossary[US]{United States}{The US is a country in the Americas.}
\glossary[UK]{United Kingdom
?
```
\define\SR
{\NC\NR\TB[halfline]}
\starttabulate[|r|l|]
\NC one \NC two \NC\NR
\NC two \NC three \SR
\NC four \NC five \NC\NR
\TB[halfline]
\NC five \NC six \NC\NR
\stoptabulate
```
Cheers,
Tim
5blue withpen pencircle scaled .75pt);
\stopuseMPgraphic
\define[1]\outlineFill{\useMPgraphic{outlineT}{tt="#1"}}%
\setuphead[chapter,title]
[textcommand=\outlineFill,
color=.625Blue,
numbercommand=\outlineFill,
number=yes]
\setupbodyfont[rm, 12pt]
\starttext
\start
,
Dalyoung
**
\startuseMPgraphic{outlineT}
draw outlinetext.b (\MPvar{tt})
(withcolor .75white)
(withcolor .725blue withpen pencircle scaled .75pt);
\stopuseMPgraphic
\define[1]\outlineFill{\useMPgraphic{outlineT}{tt="#1"}}%
\setuphead[cha
a small number) don't have such a big
difference between the ex-height of the upright and italic styles which
makes it hard to notice the problem.
begin example
\define[1]\ShowExheight
{\bgroup
\setupbodyfont[#1]
\subject{#1}
\starttabulate
\NC tf \NC \tf \the\exheight \NC\NR
ef macro to return the pair of a picture and a bounding
> box. I don't want to use the setbound operator, because as soon as I do
> that, I cannot access the components of the picture anymore with pathpart.
>
> I found metapost vardef returning multiple values <
> https://tex.stackexc
macros for
each result type.
I tried many things, amongst which:
vardef Foo( expr w, h)
% define pic
pic
end group,begingroup
% define pic
pic
endif
picture foo[]; foo = Foo( 2, 4);
___
If your question is of in
define it? You need something
\definefont[YourFont][somefontname*default,color at 15pt]
or define a featureset that sets 'color=yes' (or some specific rendering
using the other keys for color fonts).
Hans
Chapter1 -> 1retpahCyM. Basically any highly non-trivial
> > transformation that really needs Lua.
> > I've written simple Lua macros before, but the following approach trying to
> > define textcommand does not work since I can't find the way to pass the raw
> >
rivial transformation that really needs Lua.
>
> \starttext
>
> \completecontent
>
> \startchapter[title={Sample Chapter},list={retpahC elpmaS}]
> \stopchapter
>
> \stoptext
>
> > I've written simple Lua macros before, but the following approach trying
> > to define
ritten simple Lua macros before, but the following approach trying to
> define textcommand does not work since I can't find the way to pass the raw
> title to my transform function.
>
> \startluacode
> userdata = userdata or {}
> function userdata.mytransform(title)
> --
tle={Sample Chapter},list={retpahC elpmaS}]
\stopchapter
\stoptext
I've written simple Lua macros before, but the following approach trying
to define textcommand does not work since I can't find the way to pass
the raw title to my transform function.
\startluacode
userdata = userd
Hello,
I would like to display titles differently in TOC than they appear in text. For
example, MyChapter1 -> 1retpahCyM. Basically any highly non-trivial
transformation that really needs Lua.
I've written simple Lua macros before, but the following approach trying to
define textcommand d
led. I think I can do this in Gimp.
✔︎
>> For type and logos I still rely on (device dependend) CMYK colors and
>> my experience how they’ll come out in Euroscale printing.
> Device depended means what?
Not profiled.
I.e. the actual resulting color depends on the device, if it’s only d
to CMYK with the above cited profile chain?
Or shall I tell the designer: These are the values I need as CMYK, just
do it.
> Colors that you define in TeX or Metapost are a different problem. I
> *think* they should use the output intent as their profile. But I
> don’t know if the intent option
file?
> >
> > best use \smallcaps or somethign equivalent
>
> > Ah, so it was the \sc that was the problem. Thanks!
> \sc is more somthing mkii ... when type1 fonts (in an 8 bit universum)
> smallcaps and oldstyle and such meant using a different font
>
> nowadays one can tur
system that will work
world-wide, even if HKS is still usual in Germany and Toyo in Japan.)
It could also work to use spot colors and have the printshop convert them to
“their” CMYK profile.
Colors that you define in TeX or Metapost are a different problem. I *think*
they should use the output
are RGB colors as we are doing online first.
So if I create a poster or a flyer I have to do this:
1. Decide which print shop will print the material.
2. Download and install the color profile for this print shop in ConTeXt.
3. Specify CMYK values by using transicc with the given profile
4. Define
8 bit universum)
smallcaps and oldstyle and such meant using a different font
nowadays one can turn them on/off as features and when you need them a
lot you can even define an extra bodyfont variant from them and switch
to that one when needed
now, when smallcaps and oldstyle etc became features
)
enddef;
match((0,0));
\stopMPcode
\starttikzpicture
\define[2]\allumette{
\fill [yellow] (#1,#2) rectangle (#1+4,#2+0.2);
\fill [yellow!60!black] (#1,#2) -- ++(4,0)-- ++(0.1,-0.05) -- ++(-4,0)
-- ++(-0.1,0.05);
\draw (#1,#2) -- ++(0,0.2) -- ++(4,0) -- ++(0,-0.2) -- ++(0.1,-0.05)
Hi,
Sorry if my minimal example is not, but I have to understand with your help
what is wrong. For example, why a page break after the second item when
there seems to be enough space to stay on this page ?
Thanks
Fabrice
\define\starttikzpicture
{\hbox\bgroup\forcecolorhack\tikzpicture
w to apply primitives.
Maybe not PlainTeX, but plain TeX.
E.g. we usually use TeX primitives like \def (even if we have \define), while
with LaTeX you use \newcommand, similar with \vbox and others.
I understood LuaMetaTeX, as a stripped-down typesetting engine, would be closer
to the spirit of K
f how to apply primitives.
Maybe not PlainTeX, but plain TeX.
E.g. we usually use TeX primitives like \def (even if we have \define), while
with LaTeX you use \newcommand, similar with \vbox and others.
I understood LuaMetaTeX, as a stripped-down typesetting engine, would be closer
to the spir
s is one of the more complex shapes, if I can do this one it might give me
enough information to define all the other ones. Sorry to bother all of you but
the learning curve is steep and I always have not enough time.
Gerben Wierda
Chess and the Art of Enterprise Architecture <https://ea.rna.
Hi Denis,
you can’t have them all.
It might be related to the loopup order in the font itself. onum or pnum
precedence might require onum/pnum sups.
> (Note: Cardo is a ttf font, Linux Libertine O is a otf)
I think this makes no difference at all.
> By the way, what is the correct way t
\startcolumnset, the "AdSpace" appears on
the second page. While this was the intention of the example, it seems like I
can’t control on which page my ads/images appear.
In my actual project, all the defined columnsetareas show up on the second page
(where the first columnset starts
]\feature[+][f:superiors]12345}
\stoptext
Why is it that I have to manually disable onum and pnum with Cardo for
sups to work?
(Note: Cardo is a ttf font, Linux Libertine O is a otf)
By the way, what is the correct way to define a new font feature for
superios
gt;
> I would be grateful for an answer because I have no clue ;-) In my real life
> case, I fetch the content of the frame from an xml file. Since not every
> frame has line numbering, I am already inside the frame when I have to define
> and set up the line numbering environment. I c
of the frame from an xml file. Since not every frame
has line numbering, I am already inside the frame when I have to define and set
up the line numbering environment. I can probably code around it, but it makes
my life definitely
ntrollable without); how to
>> get more control over makeups and that columnsets are somewhat fastidious,
>> esp. with floats…
>
> Use \setuplayout[grid=yes] when "grid=strut" doesn't work.
That’s what I do.
>> \setuppapersize[A6]
>> \showframe[text]
>&
that columnsets are somewhat fastidious,
> esp. with floats…
Use \setuplayout[grid=yes] when "grid=strut" doesn't work.
> Still open: this one, different behaviour of \blank in before vs. command,
> chapters always starting on left pages despite page=no (a side effect of the
>
]
\definecolor[fakerulecolor][gray]
%\setuplayout[grid=yes]
%\showgrid
\define[2]\MySection{\vbox{%
\definecolor[fakerulecolor][blue]
%\blank[line,max]%
{\strut #2}\par
}}
\setuphead[section][
command=\MySection,
before={\blank[line]},
%before=,
after=,
style=\tf,
]
\definecolumnset
y, but it’s more controllable without); how to
get more control over makeups and that columnsets are somewhat fastidious, esp.
with floats…
Still open: this one, different behaviour of \blank in before vs. command,
chapters always starting on left pages despite page=no (a side effect of
the discussion I had with Hans in Bassenge...
*
In the preface of the columnsets manual we’re advised to
\usemodule[newcolumnsets]
This seems outdated.
*
If I use columnsets for two and three column pages, should I also use a
one-column columnset for consistency?
*
Can I define columnsetspans whose
=\endash~,
% midsentence=~\endash,
rightsentence=~\endash]
\define\quotedash{\emdash\endash}
%\setupbackend[export=yes]
\starttext
\startsection[title=Introduction]
Any of you able to help me get my quotation dashes into line when
automatically
inserted by the semantic commands? I'm sure
(it was ok) but after adding
"option=mp" I came across the same problem.
Is there any way how to define behaviour of both boxes in the existing \startMP
environment apart? Or is it not possible?
Best wish
Henning Hraban Ramm schrieb am 13.01.2020 um 19:21:
Am 2020-01-12 um 16:07 schrieb Henning Hraban Ramm :
Since the structureuservariables of a section aren’t defined in that section’s
"before", I would need a macro or buffer to define the contents of that
epigraph page, like thi
> Am 2020-01-12 um 16:07 schrieb Henning Hraban Ramm :
>
> Since the structureuservariables of a section aren’t defined in that
> section’s "before", I would need a macro or buffer to define the contents of
> that epigraph page, like this:
>
> That’s possible
Since the structureuservariables of a section aren’t defined in that section’s
"before", I would need a macro or buffer to define the contents of that
epigraph page, like this:
\def\PreImg{Dummy}
\startsetups FancyChapter
\setupheadertexts[][][][]
\doifelsebu
caption, it should
>> move to the next line. ATM I’m clueless...
>>
>> That’s not enough (also not a MWE):
>>
>> \define[1]\Foto{\hfill\hbox{\tfx Foto: #1}}
>
> Doesn't \wordright do what you want?
I a
not a MWE):
\define[1]\Foto{\hfill\hbox{\tfx Foto: #1}}
Best, Hraban
Doesn't \wordright do what you want?
--
Rik
___
If your question is of interest to others as well, please add an entry to the
Wiki!
maillist : ntg
Yet another small problem:
I my photo captions, the photographer should be right aligned and in one line,
i.e. if it doesn’t fit into the last line of the caption, it should move to the
next line. ATM I’m clueless...
That’s not enough (also not a MWE):
\define[1]\Foto{\hfill\hbox{\tfx Foto: #1
also use a different section name. But I don’t think that’s
the problem.
(The page number should appear on the right page; it wouldn’t hurt on the left
page, but the chapter title should only appear on following pages.)
Best, Hraban
%%
\defi
Hi again,
I’m trying to get uppercase titles with \WORD, but they aren’t broken into
lines; while \WORD works in normal text.
What’s the matter?
Best, Hraban
%
\define[2]\MyChapter{
\WORD{#2}
}
\setuphead[chapter][
command=\MyChapter
]
\starttext
\chapter{
\input tufte
}
\WORD{
\input
hink that’s
the problem.
(The page number should appear on the right page; it wouldn’t hurt on the left
page, but the chapter title should only appear on following pages.)
Best, Hraban
%%
\define[2]\FancyChapter{%
\doifnot{\structureuservari
=~\endash,
rightsentence=~\endash]
\define\quotedash{\emdash\endash}
%\setupbackend[export=yes]
\starttext
\startsection[title=Introduction]
Any of you able to help me get my quotation dashes into line when
automatically
inserted by the semantic commands? I'm sure a number of you look
cron {\buildtextmacron r}
\definecharacter Rlowmacron {\buildtextmacron R}
\define\lLM{\llowmacron}
\define\LLM{\Llowmacron}
\define\nLM{\nlowmacron}
\define\NLM{\Nlowmacron}
\define\rLM{\rlowmacron}
\define\RLM{\Rlowmacron}
This seems to do it, although if there is a better way please feel
on R}
\define\lLM{\llowmacron}
\define\LLM{\Llowmacron}
\define\nLM{\nlowmacron}
\define\NLM{\Nlowmacron}
\define\rLM{\rlowmacron}
\define\RLM{\Rlowmacron}
This seems to do it, although if there is a better way please feel
free to say.
Best, Richard
--
Richard Mahoney | Indica et Budd
}
}
}
fonts.handlers.otf.addfeature {
name = "xkern",
type = "kern",
data = {
["x"] = { ["x"] = 500 },
[" "] = { ["J"] = 500 }
}
}
\stopluac
fonts.handlers.otf.addfeature {
name = "xkern",
type = "kern",
data = {
["x"] = { ["x"] = 500 },
[" "] = { ["J"] = 500 }
}
}
\stopluacode
\startbu
["x"] = { ["x"] = 500 },
[" "] = { ["J"] = 500 }
}
}
\stopluacode
\startbuffer[Sample]
g, Jaxxb AJon
\stopbuffer
\define[2]\Test{
{\switchtobodyfont[#1]#2\getbuffer[Sample]}}
\setupbodyfo
This is the third sentence with a footnote.\footnote{This is the
> > third footnote and its mark is "2". }
> > \stopdocument
> >
> > Clearly this conversion repeats the marks "1", "*" and "2" repeatedly.
> > Is th
second footnote and its mark is "*". }
This is the third sentence with a footnote.\footnote{This is the
third footnote and its mark is "2". }
\stopdocument
Clearly this conversion repeats the marks "1", "*" and "2" repeatedly.
Is the
ence with a footnote.\footnote{This is the third
footnote and its mark is "2". }
\stopdocument
Clearly this conversion repeats the marks "1", "*" and "2" repeatedly. Is
there a way to define a new/special footnote command (say, "\symfootnote")
which
On 12/22/2019 06:08, Hans Hagen wrote:
btw, this happens often, like with oldstyle, the wished default is the
hard coded default so one has to enable/disable
now, what you miss is that you define a font without applying any
features ...
Thank you, Hans,
I see now that SS01 reverses
' is active
open source > level 2, order 3, name './j2.tex'
fonts > preloading latin modern fonts (second stage)
fonts > 'fallback modern-designsize rm 12pt' is loaded
fonts > defining > font with asked name 'jost-100-hairline' is
not found using lo
irI\subff{ss01}\getbuffer[ss01]}
\stoplines
\stoptext
btw, this happens often, like with oldstyle, the wished default is the
hard coded default so one has to enable/disable
now, what you miss is that you define a font without app
ametric solution would let you define a "registration" color in
ConTeXt, then map it to the corresponding "withcolor" instruction in
mp-crop.mkiv. I'm sure there are already functions to do that mapping.
It's the difficult part (at least for me) when Hans talks about adding
ping it only to the K channel.
I’d regard that a misconfiguration on their side.
Maybe it helps to define the output intent:
https://wiki.contextgarden.net/Command/setupbackend
https://wiki.contextgarden.net/PDFX
>> If you need more control you can create your own marks and add them as
>> backgr
as above? Do
>>> you need to modify the generated CSS for that, or would ConTeXt (or
>>> Pandoc) allow you to take care of (some of) those things?
>>>
>>> Nicola
>>
>> For Pandoc: Some things can be tweaked with pandoc, but for anything
>> that is a bit m
ndoc)
>> allow you to take care of (some of) those things?
>>
>> Nicola
>
> For Pandoc: Some things can be tweaked with pandoc, but for anything that is
> a bit more advanced you'll probably need a custom CSS. For special content
> you can use spans and divs. In
that is a bit more advanced you'll probably need a custom CSS. For
special content you can use spans and divs. In your custom CSS you can
define how those elements should be rendered. Sounds pretty similar to
what Hans wrote in his response. Probably the main questions are if you
prefer to work
, but maybe nowadays one could also right a more readable lua code to
achieve the same.
Best regards: Otared K.
\define\thinrulesfillpage%
{
\hphantom{Answer} % this is necessary, I don't know why...
\blank
\scratchcounter\dimexpr(\pagegoal-\pagetotal-2\lineheight
1001 - 1100 of 6270 matches
Mail list logo
