Re: [NTG-context] Use \unit for value and uncertainty

2020-05-09 Thread Benjamin Buchmuller
I know this is quite an old thread, but here is a minimal parser (\units with 
an “s”) that wraps around \digits and \unit to produce an acceptable output. 

As I frequently need to write ranges (or measures of uncertainty), I find it 
convenient to able to type

\units{4.0 to 5.0 centi meter} 

than 

\digits{4.0}\,to\,\unit{5.0 centi meter}.

Also, the parser will take care of exponents and bracket them accordingly. :D

ranges: keyword “to”: 4.0 – 5.0 cm
SEM:keyword “se”: 4.5 ± 0.5 cm
SD: keyword “sd”: 4.5 (0.5) cm

If no keyword is present, the default behaviour is \unit{…}.

The code is not perfect (and the level of abstraction potentially not yet 
sufficient to make it part of the phys-dim.mkiv source), but maybe helpful.

\starttext

\startluacode
userdata = userdata or {}

function userdata.units(input)

tbl = string.explode(input)

if tbl[2] == "to" then
context.digits(tbl[1])
context.phys_units_space()
context("--")
context.phys_units_space()
context.unit(table.concat(tbl, " ", 3))
elseif tbl[2] == "se" then
local sx1 = string.split(tbl[1], "e")
local sx2 = string.split(tbl[3], "e")
if (sx1[2] == sx2[2]) and not (sx1[2] == nil) then
context("(")
context.digits(sx1[1])
context.phys_units_space()
context("±")
context.phys_units_space()
context.digits(sx2[1])
context(")")
context.digits("e" .. sx1[2])
context.phys_units_space()
context.unit(table.concat(tbl, " ", 4))
else
context.digits(tbl[1])
context.phys_units_space()
context("±")
context.phys_units_space()
context.unit(table.concat(tbl, " ", 3))
end
elseif tbl[2] == "sd" then
local sx1 = string.split(tbl[1], "e")
local sx2 = string.split(tbl[3], "e")
if (sx1[2] == sx2[2]) and not (sx1[2] == nil) then
context.digits(sx1[1])
context.phys_units_space()
context("(")
context.digits(sx2[1])
context(")")
context.digits("e" .. sx1[2])
context.phys_units_space()
context.unit(table.concat(tbl, " ", 4))
else
context.digits(tbl[1])
context.phys_units_space()
context("(")
context.digits(tbl[3])
context(")")
context.unit(table.concat(tbl, " ", 4))
end
else
context.unit(table.concat(tbl, " "))
end

end
\stopluacode

\def\units#1{\ctxlua{userdata.units("#1")}}

Car 1 drives \units{4 to 5.2 kilo meter per hour}.

Car 2 drives \units{30.1 to 40.5 kilo meter per hour}.

Car 3 drives \units{40.= to 50.= kilo meter per hour}.

The average speed was \units{35,000 se 5000 meter per hour}.

The average speed was \units{35e3 se 0.5e3 meter per hour}.

The average speed was \units{35.2e3 se 5e2 meter per hour}.

\stoptext

The average speed was \units{35.2 se 5e2 meter per hour}.

The average speed was \units{_3.2 sd 5 meter per hour}.
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] mkiv digits/units zero padding not working

2020-05-07 Thread Benjamin Buchmuller
Following up on the work-around, here is my improved code for xtable.

What doesn’t work is:

* alignment on the decimal separator takes place only in the first column with 
decimals (i.e. B), not on the  following one; this is independent of R1 having 
a decimal value in this column or not

* row spanning is now tricky since the width of the header column is taken for 
the first of the three rows spanned, which becomes even more complicated with 
option=stretch, I guess if I right align the second column and would phantomize 
the hsize of the header, this could work with a bit of optimization.

What I like about this approach however is that one could read the two 
arguments from a CSV file, which would save a lot of typing (and to manually 
specify the padding).

\def\mpm#1#2{
\doifsomethingelse{#2}{
\startxcell[align=left] \digits{#1} \stopxcell
\startxcell ± \stopxcell
\startxcell \digits{#2} \stopxcell
}{
\startxcell[align=left] \digits{#1} \stopxcell
\startxcell \stopxcell
\startxcell \digits{#2} \stopxcell
}
}

\startxtable[split=repeat, aligncharacter=yes, alignmentcharacter={.}]

\startxtablehead
\startxrow[topframe=on, foregroundstyle=bold]
\startxcell A \stopxcell
\startxcell[align=left, nx=3] Bla bla bla bla bla bla bla bla 
\stopxcell
\startxcell C \stopxcell
\stopxrow
\stopxtablehead

\startxtablebody
\startxrow[topframe=on]
\startxcell R1 \stopxcell
\mpm{12.3}{}%{1.5}
\startxcell one \stopxcell
\stopxrow

\startxrow
\startxcell R2 \stopxcell
\mpm{0.01}{0.023}
\startxcell two \stopxcell
\stopxrow

\startxrow
\startxcell R3 \stopxcell
\mpm{2.3}{0.1}
\startxcell three\stopxcell
\stopxrow

\stopxtablebody

\stopxtable 

> On 7 May 2020, at 21:22, Benjamin Buchmuller  
> wrote:
> 
> Hi Wolfgang,
> 
> you are (of course) right again. I realised that I wouldn’t get the expected 
> behaviour after checking the snippet isolated from my document’s context, 
> where it is embedded in a \startplacetable[…]{}{}. I’m still learning to get 
> the gist of the \doifs, the curly and square bracketed arguments and so on. 
> Thanks for the hint! 
> 
> Seems like I’m going to make three cells and span the header column for now, 
> though I guess it would be a nice feature to have the padding working in the 
> other cases.
> 
> I’ll write a feature request for no 4.
> 
> Thanks!
> 
> 
>> On 7 May 2020, at 20:00, Wolfgang Schuster 
>>  wrote:
>> 
>> Benjamin Buchmuller schrieb am 07.05.2020 um 19:41:
>>> Hi Wolfang,
>>> Thank you for your reply. I have indeed not explained my intended result 
>>> very clearly.
>>> 1.
>>> Primarily, I need to get the two values aligned at the digit separator of 
>>> the first and second number respectively and overall at the ± sign. I’m 
>>> working in an xtable, where I have entries such as
>>> \startxcell \mpm{14.0==}{_1.5==} \stopxcell
>>> \startxcell \mpm{_0.034}{_0.013} \stopxcell
>>> and defined
>>> \def\mpm#1#2{
>>> \ifsecondargument
>>> \digits{#1}\,±\,\digits{#2}%
>>> \else
>>> \digits{#1}%
>>> \fi
>>> }
>> 
>> Is there something missing in here because the \ifsecondargument check here 
>> makes non sense because the second argument is mandatory and not optional.
>> 
>> Is this what you want?
>> 
>> \define[2]\mpm
>> {\digits{#1}%
>>  \doifsomething{#2}{\,±\,\digits{#2}}}
>> 
>>> Since I was hoping that I could exploit the zeropadding of \digits to get 
>>> the format right. Indeed, it would save a lot of typing, if I wouldn’t have 
>>> to specify the padding manually and I vaguely recall that there is 
>>> somewhere a ConTeXt solution that can make such alignments, but I simply 
>>> can’t find it any more …
>> 
>> You can align number on the decimal point (comma) but this works only when 
>> you have only one number in a cell.
>> 
>> \starttext
>> 
>> \startxtable[aligncharacter=yes,alignmentcharacter=±]
>>   \startxrow
>>   \startxcell
>>   \digits {14.0} ± \digits {1.5}
>>   \stopxcell
>>   \stopxrow
>>   \startxrow
>>   \startxcell
>>   \digits {0.034} ± \digits {0.013}
>>   \stopxcell
>>   \stopxrow
&

[NTG-context] mkiv \digits{2.0=} zero padding feature request

2020-05-07 Thread Benjamin Buchmuller
Hi,


As Wolfgang has figured out, zero padding in \digits only works for trailing 
(and omitted) zeroes when immediately preceded by the decimal separator.

It would be nice if this would work even if there is a number preceding, so that

\digits{3.1=}x\crlf
\digits{3.==}x\crlf
\digits{3.14}x

would align at the decimal separator when right aligned. This is useful in some 
circumstances, where the number of significant digits varies between sources, 
so that one needs to typset for example 

\digits{3.1=}±\digits{0.5}\crlf
\digits{3.28}±\digits{0.12}


Thanks!


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] mkiv digits/units zero padding not working

2020-05-07 Thread Benjamin Buchmuller
Hi Wolfgang,

you are (of course) right again. I realised that I wouldn’t get the expected 
behaviour after checking the snippet isolated from my document’s context, where 
it is embedded in a \startplacetable[…]{}{}. I’m still learning to get the gist 
of the \doifs, the curly and square bracketed arguments and so on. Thanks for 
the hint! 

Seems like I’m going to make three cells and span the header column for now, 
though I guess it would be a nice feature to have the padding working in the 
other cases.

I’ll write a feature request for no 4.

Thanks!


> On 7 May 2020, at 20:00, Wolfgang Schuster 
>  wrote:
> 
> Benjamin Buchmuller schrieb am 07.05.2020 um 19:41:
>> Hi Wolfang,
>> Thank you for your reply. I have indeed not explained my intended result 
>> very clearly.
>> 1.
>> Primarily, I need to get the two values aligned at the digit separator of 
>> the first and second number respectively and overall at the ± sign. I’m 
>> working in an xtable, where I have entries such as
>> \startxcell \mpm{14.0==}{_1.5==} \stopxcell
>> \startxcell \mpm{_0.034}{_0.013} \stopxcell
>> and defined
>> \def\mpm#1#2{
>>  \ifsecondargument
>>  \digits{#1}\,±\,\digits{#2}%
>>  \else
>>  \digits{#1}%
>>  \fi
>> }
> 
> Is there something missing in here because the \ifsecondargument check here 
> makes non sense because the second argument is mandatory and not optional.
> 
> Is this what you want?
> 
> \define[2]\mpm
>  {\digits{#1}%
>   \doifsomething{#2}{\,±\,\digits{#2}}}
> 
>> Since I was hoping that I could exploit the zeropadding of \digits to get 
>> the format right. Indeed, it would save a lot of typing, if I wouldn’t have 
>> to specify the padding manually and I vaguely recall that there is somewhere 
>> a ConTeXt solution that can make such alignments, but I simply can’t find it 
>> any more …
> 
> You can align number on the decimal point (comma) but this works only when 
> you have only one number in a cell.
> 
> \starttext
> 
> \startxtable[aligncharacter=yes,alignmentcharacter=±]
>\startxrow
>\startxcell
>\digits {14.0} ± \digits {1.5}
>\stopxcell
>\stopxrow
>\startxrow
>\startxcell
>\digits {0.034} ± \digits {0.013}
>\stopxcell
>\stopxrow
> \stopxtable
> 
> \stoptext
> 
>> 2. + 3.
>> Absolutely right, this is my bad. I have badly mixed from Hans’ solution to 
>> a similar problem,
>> https://www.mail-archive.com/ntg-context@ntg.nl/msg00724.html
>> which was actually \def\zeroamount{-} and the example in the source, I 
>> didn’t read properly. Just skip that part. :)
> 
> The message is from 2003!
> 
>> 4.
>> Indeed,
>> \startxcell \mpm{14.==}{_1.5=} \stopxcell
>> \startxcell \mpm{_0.03}{_0.01} \stopxcell
>> aligns properly. But sometimes, I have the first digit specified, but not 
>> the second and unfortunately this doesn’t work
>> \startxcell \mpm{14.5=}{_1.5=} \stopxcell
>> \startxcell \mpm{_0.03}{_0.01} \stopxcell
>> because = is not immediately preceded by .
> 
> Can you write another mail with a request for this.
> 
> Wolfgang

___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] mkiv digits/units zero padding not working

2020-05-07 Thread Benjamin Buchmuller
Hi Wolfang,

Thank you for your reply. I have indeed not explained my intended result very 
clearly. 

1. 

Primarily, I need to get the two values aligned at the digit separator of the 
first and second number respectively and overall at the ± sign. I’m working in 
an xtable, where I have entries such as

\startxcell \mpm{14.0==}{_1.5==} \stopxcell
\startxcell \mpm{_0.034}{_0.013} \stopxcell

and defined 

\def\mpm#1#2{
\ifsecondargument
\digits{#1}\,±\,\digits{#2}%
\else
\digits{#1}%
\fi
}

Since I was hoping that I could exploit the zeropadding of \digits to get the 
format right. Indeed, it would save a lot of typing, if I wouldn’t have to 
specify the padding manually and I vaguely recall that there is somewhere a 
ConTeXt solution that can make such alignments, but I simply can’t find it any 
more …

2. + 3.

Absolutely right, this is my bad. I have badly mixed from Hans’ solution to a 
similar problem, 

https://www.mail-archive.com/ntg-context@ntg.nl/msg00724.html

which was actually \def\zeroamount{-} and the example in the source, I didn’t 
read properly. Just skip that part. :)

4. 

Indeed, 

\startxcell \mpm{14.==}{_1.5=} \stopxcell
\startxcell \mpm{_0.03}{_0.01} \stopxcell

aligns properly. But sometimes, I have the first digit specified, but not the 
second and unfortunately this doesn’t work

\startxcell \mpm{14.5=}{_1.5=} \stopxcell
\startxcell \mpm{_0.03}{_0.01} \stopxcell

because = is not immediately preceded by .



> On 7 May 2020, at 18:21, Wolfgang Schuster 
>  wrote:
> 
> Benjamin Buchmuller schrieb am 07.05.2020 um 17:31:
>> Hi,
>> I’m trying to get
>> \digits{15.0=}±\digits{1.00}
>> \digits{_8.12}±\digits{0.34}
>> horizontally aligned as
>> 15.0 ±1.00
>>  8.12±0.34
>> But I get
>> 15.0±1.00
>>  8.12±0.34
>> instead.
>> From the source (phys-dim.mkiv), I can see that “=“ should expand to 
>> \hphantom{0}. (I think \zeropoint in the table is outdated, since 
>> \def\zeropoint\hphantom{0} does not solve the problem either.)
> 
> 1. Which table?
> 
> 2. This is not how \def works.
> 
> 3. When you redefine \zeropoint (which isn't a macro) you're going to break 
> everything.
> 
>> I can’t use tabulate or alignment in math mode for this problem 
>> unfortunately.
> 
> I looked at the code and the problem is = can only be used to insert space 
> for two digits (e.g. 100.==).
> 
> Wolfgang

___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] mkiv digits/units zero padding not working

2020-05-07 Thread Benjamin Buchmuller
Hi,

I’m trying to get

\digits{15.0=}±\digits{1.00}

\digits{_8.12}±\digits{0.34}

horizontally aligned as

15.0 ±1.00
 8.12±0.34

But I get

15.0±1.00
 8.12±0.34

instead.

From the source (phys-dim.mkiv), I can see that “=“ should expand to 
\hphantom{0}. (I think \zeropoint in the table is outdated, since 
\def\zeropoint\hphantom{0} does not solve the problem either.)

I can’t use tabulate or alignment in math mode for this problem unfortunately.

Any hints would be very welcome.

Thanks


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] \placetable[location=split] reference ??

2020-05-07 Thread Benjamin Buchmuller
Okay, I found the solution myself: Need to specify \startxtable[split=repeat] 
or else. 

It’s actually a bit surprising that the value of the “outer” enivornment 
(placetable) depends on the settings in the inner one (xtable). I speculate 
this might be because the order of the tables might be different as soon as 
xtable tries to place them …

Cheers

\startplacetable[reference=tab1,title={A table},location=split]
\startxtable[split=repeat]
\startxrow
\startxcell hi \stopxcell
\stopxrow
\stopxtable
\stopplacetable


> On 22 Apr 2020, at 21:10, Benjamin Buchmuller  
> wrote:
> 
> Hi,
> 
> I would like to reference a table of the following structure. 
> 
> \starttext
> 
> \startplacetable[reference=tab1,title={A table},location=split]
> \startxtable
> \startxrow
> \startxcell hi \stopxcell
> \stopxrow
> \stopxtable
> \stopplacetable
> 
> In Table \in[tab1]
> 
> \stoptext
> 
> 
> It has [location=split], which I need this because xtable doesn’t like to be 
> placed without a split; and apparently neither does it accept the 
> \placetable[ref]{...} syntax. However, the reference is now no longer 
> detected.
> 
> I can see that the split table’s caption is about to become "Table 1.a.", 
> "Table 1.b" etc. and I appreciate that this is potentially a quite complex 
> mechanism anyways, but if there was any chance to  get a reference as “Table 
> 1”, I would be helped a lot.
> 
> On similar lines, is there a way to have “Table 1 (continued).” in the 
> caption?
> 
> Cheers
> 
> 
> Benjamin
> 
> 

___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works

2020-04-26 Thread Benjamin Buchmuller
The problem seems to be resolved. Thanks to everyone, especially Hans, Taco and 
Wolfgang for the fast fix (offlist)!

After updating to

ConTeXt  ver: 2020.01.30 14:13 MKIV beta  fmt: 2020.4.26

Helvetica Neue works with:
==

\starttypescript [sans] [helvet]
   \setups[font:fallback:sans]
   \definefontsynonym [Sans]   [file:Helvetica Neue.ttc(Helvetica 
Neue)] [features=default]
   \definefontsynonym [SansBold]   [file:Helvetica Neue.ttc(Helvetica Neue 
Bold)]   [features=default]
   \definefontsynonym [SansItalic] [file:Helvetica Neue.ttc(Helvetica Neue 
Italic)]  [features=default]
   \definefontsynonym [SansBoldItalic] [file:Helvetica Neue.ttc(Helvetica Neue 
Bold Italic)] [features=default]
\stoptypescript

\definetypeface [helvet] [ss] [sans] [helvet] [default] 

\setupbodyfont [helvet, 12pt]

Optima works with:
==

\starttypescript [sans] [optima]
  \setups[font:fallback:sans]
  \definefontsynonym [Sans]   [file:Optima.ttc(Optima Regular)] 
[features=default]
  \definefontsynonym [SansBold]   [file:Optima.ttc(Optima Bold)]   
[features=default]
  \definefontsynonym [SansItalic] [file:Optima.ttc(Optima Italic)]  
[features=default]
  \definefontsynonym [SansBoldItalic] [file:Optima.ttc(Optima Bold Italic)] 
[features=default]
\stoptypescript

\definetypeface [optima] [ss] [sans] [optima] [default]

\setupbodyfont [optima]

\starttext
\tf Upright,
\bf Bold,
\it Italic,
\bi Bolditalic
\stoptext

Note 1: mtxrun --script fonts --list --all --pattern=helvetica etc. might still 
not display all variants correctly in the first place.

Note 2: There are predefined typescripts for Mac OS in ConTeXt 
(type-imp-osx.mkiv) but the file needs a update/cleanup.

> On 24 Apr 2020, at 12:14, Benjamin Buchmuller  
> wrote:
> 
> Hi Hraban,
> 
> Thanks for the hint (and the proper fontfamily setup), I have forced reload 
> ten times now from various accounts; the issue persists unfortunately. 
> 
> This might confirm Taco‘s notion that there is some bug lmtx. I’m running 
> macOS Catalina too, but as it worked with the standalone of Dec/Jan three 
> days ago, I suspect it is not because of a new feature in the OS, but rather 
> an old feature in mtxrun or elsewhere having disappeared. 
> 
>> On 24. Apr 2020, at 11:35, Henning Hraban Ramm  wrote:
>> 
>> 
>> 
>>> Am 24.04.2020 um 11:13 schrieb Benjamin Buchmuller 
>>> :
>>> 
>>> Although this specific issue might have been solved meanwhile by the 
>>> helpful suggestions of Wolfang, Thomas and others, I would like to point 
>>> out that I have recently also encountered an odd behaviour of the mtxrun 
>>> fontloader in the standalone, in which not all typefaces are 
>>> available/properly identified.
>>> 
>>> (I’m sorry to hijack this thread if this is unrelated.)
>>> 
>>> Basically, when I load “Helvetica Neue”, I get instead of “regular/normal” 
>>> always “light/italic”.
>>> 
>>> I have switched to heros for the meantime, but potentially there is some 
>>> bug behind this. (My documents with the version from Dec/Jan worked fine.)
>>> 
>>> I recite my example from Wed:
>>> 
>>> ConTeXt  ver: 2020.01.30 14:13 MKIV beta  fmt: 2020.4.22 (LuaTeX 1.11.1)
>>> 
>>> and I’m running now into troubles with system font indexing:
>>> 
>>> mtxrun --script fonts --reload
>>> 
>>> locates fonts in macOS directories appropriately (*.afm fonts placed in 
>>> .../tex/texmf-fonts are not found, but at the moment I don’t care too 
>>> much), however it resolves only to a single font variant for *.ttc instead 
>>> of all variants:
>>> 
>>> mtxrun --script fonts --list --all --pattern=helvetica
>>> 
>>> helvetica helvetica
>>> helveticalightoblique /System/Library/Fonts/Helvetica.ttc   
>>>  6
>>> helveticalightoblique helvetica
>>> helveticalightoblique /System/Library/Fonts/Helvetica.ttc   
>>>  6
>>> helveticaneuedeskinterfaceheavy   helveticaneuedeskinterface   
>>> helveticaneuedeskinterfaceheavy   
>>> /System/Library/Fonts/HelveticaNeueDeskInterface.ttc   10
>>> helveticaneuethinitalic   helveticaneue
>>> helveticaneuethinitalic   /System/Library/Fonts/HelveticaNeue.ttc   
>>>  14
>> 
>> If the subfont is not listed, ConTeXt/mtxrun couldn’t find it and won’t find 
>> it regardless of your setup.
>> 
>> Try
>> mtxrun --script fonts --re

Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works

2020-04-24 Thread Benjamin Buchmuller
Hi Hraban,

Thanks for the hint (and the proper fontfamily setup), I have forced reload ten 
times now from various accounts; the issue persists unfortunately. 

This might confirm Taco‘s notion that there is some bug lmtx. I’m running macOS 
Catalina too, but as it worked with the standalone of Dec/Jan three days ago, I 
suspect it is not because of a new feature in the OS, but rather an old feature 
in mtxrun or elsewhere having disappeared. 

> On 24. Apr 2020, at 11:35, Henning Hraban Ramm  wrote:
> 
> 
> 
>> Am 24.04.2020 um 11:13 schrieb Benjamin Buchmuller 
>> :
>> 
>> Although this specific issue might have been solved meanwhile by the helpful 
>> suggestions of Wolfang, Thomas and others, I would like to point out that I 
>> have recently also encountered an odd behaviour of the mtxrun fontloader in 
>> the standalone, in which not all typefaces are available/properly identified.
>> 
>> (I’m sorry to hijack this thread if this is unrelated.)
>> 
>> Basically, when I load “Helvetica Neue”, I get instead of “regular/normal” 
>> always “light/italic”.
>> 
>> I have switched to heros for the meantime, but potentially there is some bug 
>> behind this. (My documents with the version from Dec/Jan worked fine.)
>> 
>> I recite my example from Wed:
>> 
>> ConTeXt  ver: 2020.01.30 14:13 MKIV beta  fmt: 2020.4.22 (LuaTeX 1.11.1)
>> 
>> and I’m running now into troubles with system font indexing:
>> 
>> mtxrun --script fonts --reload
>> 
>> locates fonts in macOS directories appropriately (*.afm fonts placed in 
>> .../tex/texmf-fonts are not found, but at the moment I don’t care too much), 
>> however it resolves only to a single font variant for *.ttc instead of all 
>> variants:
>> 
>> mtxrun --script fonts --list --all --pattern=helvetica
>> 
>> helvetica helvetica
>> helveticalightoblique /System/Library/Fonts/Helvetica.ttc
>> 6
>> helveticalightoblique helvetica
>> helveticalightoblique /System/Library/Fonts/Helvetica.ttc
>> 6
>> helveticaneuedeskinterfaceheavy   helveticaneuedeskinterface   
>> helveticaneuedeskinterfaceheavy   
>> /System/Library/Fonts/HelveticaNeueDeskInterface.ttc   10
>> helveticaneuethinitalic   helveticaneue
>> helveticaneuethinitalic   /System/Library/Fonts/HelveticaNeue.ttc
>> 14
> 
> If the subfont is not listed, ConTeXt/mtxrun couldn’t find it and won’t find 
> it regardless of your setup.
> 
> Try
> mtxrun --script fonts --reload --force
> maybe even twice or thrice and check again.
> (Unfortunately this is not reliable.)
> 
> I get the full list:
> 
> identifier   familyname   
> fontname   filename   
> subfont   instances
> 
> helveticahelvetica
> helvetica  
> /System/Library/Fonts/Helvetica.ttc1
> helveticaneueblack   helveticaneue
> helveticaneuecondensedblack
> /System/Library/Fonts/HelveticaNeue.ttc10
> helveticaneuedeskinterfaceextrabold  helveticaneuedeskinterface   
> helveticaneuedeskinterfaceheavy
> /System/Library/Fonts/HelveticaNeueDeskInterface.ttc   10
> helveticaneuedeskinterfaceextralight helveticaneuedeskinterface   
> helveticaneuedeskinterfacethin 
> /System/Library/Fonts/HelveticaNeueDeskInterface.ttc   8
> helveticaneuedeskinterfacemedium helveticaneuedeskinterface   
> helveticaneuedeskinterfacemediump4 
> /System/Library/Fonts/HelveticaNeueDeskInterface.ttc   5
> helveticaneuedeskinterfacemediumitalic   helveticaneuedeskinterface   
> helveticaneuedeskinterfacemediumitalicp4   
> /System/Library/Fonts/HelveticaNeueDeskInterface.ttc   6
> helveticaneuedeskinterfacenormal helveticaneuedeskinterface   
> helveticaneuedeskinterfaceregular  
> /System/Library/Fonts/HelveticaNeueDeskInterface.ttc   1
> helveticaneueextralight  helveticaneue
> helveticaneuethin  
> /System/Library/Fonts/HelveticaNeue.ttc13
> helveticaneuenormal  helveticaneue
> helveticaneue  
> /System/Library/Fonts/HelveticaNeue.ttc1
> helveticaneueregular helveticaneue
> helveti

Re: [NTG-context] Basic font question (Optima, but no bold, no italics). Standalone ConTeXt does not work. TeX Live 2019 works

2020-04-24 Thread Benjamin Buchmuller
Although this specific issue might have been solved meanwhile by the helpful 
suggestions of Wolfang, Thomas and others, I would like to point out that I 
have recently also encountered an odd behaviour of the mtxrun fontloader in the 
standalone, in which not all typefaces are available/properly identified.

(I’m sorry to hijack this thread if this is unrelated.)

Basically, when I load “Helvetica Neue”, I get instead of “regular/normal” 
always “light/italic”.

I have switched to heros for the meantime, but potentially there is some bug 
behind this. (My documents with the version from Dec/Jan worked fine.)

I recite my example from Wed:

ConTeXt  ver: 2020.01.30 14:13 MKIV beta  fmt: 2020.4.22 (LuaTeX 1.11.1)

and I’m running now into troubles with system font indexing:

mtxrun --script fonts --reload

locates fonts in macOS directories appropriately (*.afm fonts placed in 
.../tex/texmf-fonts are not found, but at the moment I don’t care too much), 
however it resolves only to a single font variant for *.ttc instead of all 
variants:

mtxrun --script fonts --list --all --pattern=helvetica

helvetica helvetica
helveticalightoblique /System/Library/Fonts/Helvetica.ttc   
 6
helveticalightoblique helvetica
helveticalightoblique /System/Library/Fonts/Helvetica.ttc   
 6
helveticaneuedeskinterfaceheavy   helveticaneuedeskinterface   
helveticaneuedeskinterfaceheavy   
/System/Library/Fonts/HelveticaNeueDeskInterface.ttc   10
helveticaneuethinitalic   helveticaneue
helveticaneuethinitalic   /System/Library/Fonts/HelveticaNeue.ttc   
 14

As a consequence, when I run

\definefontfamily[mainface][ss][Helvetica Neue]
\setupbodyfont[mainface, 12pt, sans]

I get the light oblique variant instead of the regular one. I have tried to fix 
this via a 

\definefontfamily[mainface][ss][Helvetica Neue][tf=style:normal]

but apparently I understand too little about this setup altogether …

Thanks already for any suggestions!



> On 24 Apr 2020, at 08:53, ntg-context-requ...@ntg.nl wrote:
> 
> Send ntg-context mailing list submissions to
>   ntg-context@ntg.nl
> 
> To subscribe or unsubscribe via the World Wide Web, visit
>   https://mailman.ntg.nl/mailman/listinfo/ntg-context
> or, via email, send a message with subject or body 'help' to
>   ntg-context-requ...@ntg.nl
> 
> You can reach the person managing the list at
>   ntg-context-ow...@ntg.nl
> 
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of ntg-context digest..."
> Today's Topics:
> 
>   1. Re: Basic font question (Optima, but no bold, no italics).
>  Standalone ConTeXt does not work. TeX Live 2019 works
>  (Wolfgang Schuster)
> 
> From: Wolfgang Schuster 
> Subject: Re: [NTG-context] Basic font question (Optima, but no bold, no 
> italics). Standalone ConTeXt does not work. TeX Live 2019 works
> Date: 24 April 2020 at 08:53:52 CEST
> To: mailing list for ConTeXt users , Gerben Wierda 
> 
> 
> 
> Gerben Wierda schrieb am 24.04.2020 um 08:48:
>> With Arial:
>> 
>> \definefontfamily[mainface][rm][Arial]
>> \setupbodyfont[mainface,10pt]
>> 
>> 
>> 
>> with Optima:
>> 
>> \definefontfamily[mainface][rm][Optima]
>> \setupbodyfont[mainface,10pt]
>> 
>> 
>> It doesn’t matter if the font statements are before or after \starttext
>> 
>> Then I thought, let’s test some other things. I logged in as another user, 
>> and used ConTeXt from TeX Live 2019:
>> 
>> 
>> It seems to be that on my system, the standalone installed ConTeXt does not 
>> work with Optima, but the TeX Live installed one does.
> 
> Can you try this:
> 
> \definefontfamily [mainface] [rm] [Optima]
>   [it=optimaitalic,
>bf=optimabold,
>bi=optimabolditalic]
> 
> Wolfgang
> 
> 
> 
> ___
> If your question is of interest to others as well, please add an entry to the 
> Wiki!
> 
> maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
> webpage  : http://www.pragma-ade.nl / http://tex.aanhet.net
> archive  : https://foundry.supelec.fr/projects/contextrev/
> wiki : http://contextgarden.net
> ___

___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-24 Thread Benjamin Buchmuller
Hi Rik,

thank you as well, this works also nicely. I’ve created a wiki page meanwhile 
for wrapping text containing both solutions and the post on SHA keys.

https://www.contextgarden.net/Wrapping

Cheers


Benjamin

> On 24 Apr 2020, at 00:45, Rik Kabel  wrote:
> 
> 
> 
> On 4/23/2020 17:50, Wolfgang Schuster wrote:
>> Benjamin Buchmuller schrieb am 23.04.2020 um 23:16: 
>>> Hi Rik, 
>>> 
>>> Thanks for the fast reply! Your example works indeed nicely. However, 
>>> within this solution my problem has shifted now (fully) towards breaking 
>>> after the same number of characters, which seems to work for your sample 
>>> string, but not for the sequences that I need to place. 
>>> 
>>> What I would like to achieve is something like: 
>>> 
>>> 5’-GATTGCTTACTCCTGGTTGG 
>>> TCTTACATTCTGTCGCCTC 
>>> CTACTAGAGCCGGCATATT 
>>> CTAGAAGGGCCGCCTTCATGTGG 
>>> etc. 
>>> 
>>> (There might be hyphens or not, this is not so much important to me.) 
>>> 
>>> But what I get is currently: 
>>> 
>>> 5'-GATTGCTTACTCCTG- 
>>> GTTGGTCTTACATTCT- 
>>> GTCGCCTCCTACTA- 
>>> GAGCCGGCATATTCTA- 
>>> GAAGGGCCGCCTTCATGTGGC- 
>>> etc. 
>>> 
>>> Which looks ragged with \tt. Certainly, this is because ConTeXt applies the 
>>> default hyphenation pattern. But I guess, there might be no “no language” 
>>> pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem 
>>> to make no difference towards the result. 
>> 
>> Hans posted a solution for a similar problem a few years ago [1] 
>> which can be adapted to your problem. 
>> 
>> \startluacode 
>> 
>>  local shared = { 
>>  start  = 1, 
>>  length = 1, 
>>  before = nil, 
>>  after  = nil, 
>>  left   = false, 
>>  right  = false, 
>>  } 
>> 
>>  local all = table.setmetatableindex({ }, function(t,k) 
>>  return shared 
>>  end) 
>> 
>>  languages.hyphenators.traditional.installmethod("dna", 
>>  function(dictionary,word,n) 
>>  return all 
>>  end 
>>  ) 
>> \stopluacode 
>> 
>> \definehyphenationfeatures 
>>   [dna] 
>>   [characters=all, 
>>alternative=dna] 
>> 
>> \starttext 
>> 
>> \startframedtext[width=6cm,style=mono] 
>>   \sethyphenationfeatures[dna] 
>>   \setuphyphenation[method=traditional] 
>>   GATTGCTTACTCCTGGTTGG% 
>>   TCTTACATTCTGTCGCCTC% 
>>   CTACTAGAGCCGGCATATT% 
>>   CTAGAAGGGCCGCCTTCATGTGG% 
>> \stopframedtext 
>> 
>> \stoptext 
>> 
>> [1] https://mailman.ntg.nl/pipermail/ntg-context/2017/089106.html 
>> 
>> Wolfgang 
>> 
> And without lua, just two lines of ConTeXt with a bit of TeX:
> 
> \define[1]\DNA{\handletokens #1\with\DNAspacer}
> \define[1]\DNAspacer{#1\hskip 2.3pt plus .1pt}
> \define[2]\mycommandc{
> \startxrow
> \startxcell o#1 \stopxcell
> \startxcell {\tt\WORD{\DNA{5'-#2}}}\stopxcell
> \stopxrow
> }
> \starttext
> \setupxtable[width=5cm]
> \startxtable
> \mycommandc{C}{gattgcttactcctggttggtcttacattctgtcgcctcctactagagccggcatattctagaagggccgccttcatgtggcctagggcaccatcgcgtacgagggcaatgagtttaccgctgcgaagtctctacgtcacggccaaccacagtcctgctcccaacgaaatttagacgctgtcgtgaaacctgaattcgaggataagccgcgtcatgaagagtctactg}
> \stopxtable
> \stoptext
> 
> Modify the skip as you see fit.
> 
> -- 
> Rik
> 

___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-23 Thread Benjamin Buchmuller
Thanks Wolfgang, this works perfectly. I will add this hint tomorrow to the 
Wiki.

> On 23 Apr 2020, at 23:50, Wolfgang Schuster 
>  wrote:
> 
> Benjamin Buchmuller schrieb am 23.04.2020 um 23:16:
>> Hi Rik,
>> Thanks for the fast reply! Your example works indeed nicely. However, within 
>> this solution my problem has shifted now (fully) towards breaking after the 
>> same number of characters, which seems to work for your sample string, but 
>> not for the sequences that I need to place.
>> What I would like to achieve is something like:
>> 5’-GATTGCTTACTCCTGGTTGG
>> TCTTACATTCTGTCGCCTC
>> CTACTAGAGCCGGCATATT
>> CTAGAAGGGCCGCCTTCATGTGG
>> etc.
>> (There might be hyphens or not, this is not so much important to me.)
>> But what I get is currently:
>> 5'-GATTGCTTACTCCTG-
>> GTTGGTCTTACATTCT-
>> GTCGCCTCCTACTA-
>> GAGCCGGCATATTCTA-
>> GAAGGGCCGCCTTCATGTGGC-
>> etc.
>> Which looks ragged with \tt. Certainly, this is because ConTeXt applies the 
>> default hyphenation pattern. But I guess, there might be no “no language” 
>> pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem to 
>> make no difference towards the result.
> 
> Hans posted a solution for a similar problem a few years ago [1]
> which can be adapted to your problem.
> 
> \startluacode
> 
> local shared = {
> start  = 1,
> length = 1,
> before = nil,
> after  = nil,
> left   = false,
> right  = false,
> }
> 
> local all = table.setmetatableindex({ }, function(t,k)
> return shared
> end)
> 
> languages.hyphenators.traditional.installmethod("dna",
> function(dictionary,word,n)
> return all
> end
> )
> \stopluacode
> 
> \definehyphenationfeatures
>  [dna]
>  [characters=all,
>   alternative=dna]
> 
> \starttext
> 
> \startframedtext[width=6cm,style=mono]
>  \sethyphenationfeatures[dna]
>  \setuphyphenation[method=traditional]
>  GATTGCTTACTCCTGGTTGG%
>  TCTTACATTCTGTCGCCTC%
>  CTACTAGAGCCGGCATATT%
>  CTAGAAGGGCCGCCTTCATGTGG%
> \stopframedtext
> 
> \stoptext
> 
> [1] https://mailman.ntg.nl/pipermail/ntg-context/2017/089106.html
> 
> Wolfgang

___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] Hyphentation/Linebreak after x characters

2020-04-23 Thread Benjamin Buchmuller
Hi Rik,

Thanks for the fast reply! Your example works indeed nicely. However, within 
this solution my problem has shifted now (fully) towards breaking after the 
same number of characters, which seems to work for your sample string, but not 
for the sequences that I need to place.

What I would like to achieve is something like:

5’-GATTGCTTACTCCTGGTTGG
TCTTACATTCTGTCGCCTC
CTACTAGAGCCGGCATATT
CTAGAAGGGCCGCCTTCATGTGG
etc.

(There might be hyphens or not, this is not so much important to me.)

But what I get is currently:

5'-GATTGCTTACTCCTG- 
GTTGGTCTTACATTCT- 
GTCGCCTCCTACTA- 
GAGCCGGCATATTCTA- 
GAAGGGCCGCCTTCATGTGGC- 
etc.

Which looks ragged with \tt. Certainly, this is because ConTeXt applies the 
default hyphenation pattern. But I guess, there might be no “no language” 
pattern or is there? Also, I agree, it’s a bit odd that nright/nleft seem to 
make no difference towards the result.

This is the MWE based on your solution:

\define[2]\mycommandc{
\startxrow
\startxcell o#1 \stopxcell
\startxcell \tt\WORD{5'-#2} \stopxcell
\stopxrow
}

\definebreakpoint[mybreaks][][nright=100,nleft=100,type=1]
\setbreakpoints[mybreaks]

\starttext

\setupxtable[width=5cm]
\startxtable
\mycommandc{C}{GATTGCTTACTCCTGGTTGGTCTTACATTCTGTCGCCTCCTACTAGAGCCGGCATATTCTAGAAGGGCCGCCTTCATGTGGCCTAGGGCACCATCGCGTACGAGGGCAATGAGTTTACCGCTGCGAAGTCTCTACGTCACGGCCAACCACAGTCCTGCTCCCAACGAAATTTAGACGCTGTCGTGAAACCTGAATTCGAGGATAAGCCGCGTCATGAAGAGTCTACTG}
\stopxtable

\stoptext

> On 23 Apr 2020, at 22:02, ntg-context-requ...@ntg.nl wrote:
> 
> Send ntg-context mailing list submissions to
>   ntg-context@ntg.nl
> 
> To subscribe or unsubscribe via the World Wide Web, visit
>   https://mailman.ntg.nl/mailman/listinfo/ntg-context
> or, via email, send a message with subject or body 'help' to
>   ntg-context-requ...@ntg.nl
> 
> You can reach the person managing the list at
>   ntg-context-ow...@ntg.nl
> 
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of ntg-context digest..."
> Today's Topics:
> 
>   1. Re: Hyphentation/Linebreak after x characters inside \WORD?
>  (Rik Kabel)
> 
> From: Rik Kabel 
> Subject: Re: [NTG-context] Hyphentation/Linebreak after x characters inside 
> \WORD?
> Date: 23 April 2020 at 21:46:59 CEST
> To: ntg-context@ntg.nl, benjamin.buchmul...@gmail.com
> 
> 
> 
> 
> On 4/23/2020 15:01, Benjamin Buchmuller wrote:
>> Sorry, I have just realized that the problem might not be \WORD{} actually, 
>> so this one hyphenates:
>> 
>> \define[2]\mycommand{
>>  \startxrow
>>  \startxcell o#1 \stopxcell
>>  \startxcell \tt\WORD #2 \stopxcell
>>  \stopxrow
>>  }
>> 
>> Whereas these ones don’t: 
>> 
>> 
>> \define[2]\mycommand{
>>  \startxrow
>>  \startxcell o#1 \stopxcell
>>  \startxcell \tt\WORD #2-3' \stopxcell
>>  \stopxrow
>>  }
>> 
>> \define[2]\mycommand{
>>  \startxrow
>>  \startxcell o#1 \stopxcell
>>  \startxcell 5'-\tt\WORD #2 \stopxcell
>>  \stopxrow
>>  }
>> 
>> Assuming that this has to do with the presence of “-“ which will be the 
>> preferred breakpoint. So, I guess the questions boils down to how to define 
>> the second argument of
>> 
>> \definebreakpoint[mybreaks][][nright=12,nleft=12,type=1]
>> 
>> in this case or how to “deactivate” the default \setbreakpoints[compound]?
>> 
>> 
>> 
>>> On 23 Apr 2020, at 20:46, Benjamin Buchmuller 
>>> 
>>>  wrote:
>>> 
>>> Hi again,
>>> 
>>> I am reading a CSV file into ConTeXt which contains long DNA sequences (>> 
>>> 40 characters) to place in xtables. So far, this works fine. However, I 
>>> need to uppercase the entries and need to \tt them. When I do this inside 
>>> \WORD however, they don’t hyphenate any more.
>>> 
>>> I’m using:
>>> 
>>> \defineseparatedlist
>>> [mylist]
>>> [
>>> separator={,}, quotechar={"},
>>> command=\mycommand
>>> ]
>>> 
>>> \define[2]\mycommand{
>>> \startxrow
>>> \startxcell o#1 \stopxcell
>>> \startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell
>>> \stopxrow
>>> }
>>> 
>>> Since I don’t have access to each entry, I cant place hyphenation marks 
>>> directly. Is there a way to tell ConTeXt to hyphenate after say, 12 
>>> characters?
>>> 
>>> Thanks for your help.
>>> 
>>> 
>>&

Re: [NTG-context] Hyphentation/Linebreak after x characters inside \WORD?

2020-04-23 Thread Benjamin Buchmuller
Sorry, I have just realized that the problem might not be \WORD{} actually, so 
this one hyphenates:

\define[2]\mycommand{
\startxrow
\startxcell o#1 \stopxcell
\startxcell \tt\WORD #2 \stopxcell
\stopxrow
}

Whereas these ones don’t: 


\define[2]\mycommand{
\startxrow
\startxcell o#1 \stopxcell
\startxcell \tt\WORD #2-3' \stopxcell
\stopxrow
}

\define[2]\mycommand{
\startxrow
\startxcell o#1 \stopxcell
\startxcell 5'-\tt\WORD #2 \stopxcell
\stopxrow
}

Assuming that this has to do with the presence of “-“ which will be the 
preferred breakpoint. So, I guess the questions boils down to how to define the 
second argument of

\definebreakpoint[mybreaks][][nright=12,nleft=12,type=1]

in this case or how to “deactivate” the default \setbreakpoints[compound]?


> On 23 Apr 2020, at 20:46, Benjamin Buchmuller  
> wrote:
> 
> Hi again,
> 
> I am reading a CSV file into ConTeXt which contains long DNA sequences (>> 40 
> characters) to place in xtables. So far, this works fine. However, I need to 
> uppercase the entries and need to \tt them. When I do this inside \WORD 
> however, they don’t hyphenate any more.
> 
> I’m using:
> 
> \defineseparatedlist
>   [mylist]
>   [
>   separator={,}, quotechar={"},
>   command=\mycommand
>   ]
> 
> \define[2]\mycommand{
>   \startxrow
>   \startxcell o#1 \stopxcell
>   \startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell
>   \stopxrow
>   }
> 
> Since I don’t have access to each entry, I cant place hyphenation marks 
> directly. Is there a way to tell ConTeXt to hyphenate after say, 12 
> characters?
> 
> Thanks for your help.
> 
> 
> Benjamin

___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] Hyphentation/Linebreak after x characters inside \WORD?

2020-04-23 Thread Benjamin Buchmuller
Hi again,

I am reading a CSV file into ConTeXt which contains long DNA sequences (>> 40 
characters) to place in xtables. So far, this works fine. However, I need to 
uppercase the entries and need to \tt them. When I do this inside \WORD 
however, they don’t hyphenate any more.

I’m using:

\defineseparatedlist
[mylist]
[
separator={,}, quotechar={"},
command=\mycommand
]

\define[2]\mycommand{
\startxrow
\startxcell o#1 \stopxcell
\startxcell 5’-{\tt\WORD{#2}}-3' \stopxcell
\stopxrow
}

Since I don’t have access to each entry, I cant place hyphenation marks 
directly. Is there a way to tell ConTeXt to hyphenate after say, 12 characters?

Thanks for your help.


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] mtxrun fontloader in recent standalone

2020-04-22 Thread Benjamin Buchmuller
I’ve just updated to the most recent standalone 

ConTeXt  ver: 2020.01.30 14:13 MKIV beta  fmt: 2020.4.22 (LuaTeX 1.11.1)

and I’m running now into troubles with system font indexing:

mtxrun --script fonts --reload

locates fonts in macOS directories appropriately (*.afm fonts placed in 
.../tex/texmf-fonts are not found, but at the moment I don’t care too much), 
however it resolves only to a single font variant for *.ttc instead of all 
variants:

mtxrun --script fonts --list --all --pattern=helvetica

helvetica helvetica
helveticalightoblique /System/Library/Fonts/Helvetica.ttc   
 6
helveticalightoblique helvetica
helveticalightoblique /System/Library/Fonts/Helvetica.ttc   
 6
helveticaneuedeskinterfaceheavy   helveticaneuedeskinterface   
helveticaneuedeskinterfaceheavy   
/System/Library/Fonts/HelveticaNeueDeskInterface.ttc   10
helveticaneuethinitalic   helveticaneue
helveticaneuethinitalic   /System/Library/Fonts/HelveticaNeue.ttc   
 14

As a consequence, when I run

\definefontfamily[mainface][ss][Helvetica Neue]
\setupbodyfont[mainface, 12pt, sans]

I get the light oblique variant instead of the regular one. I have tried to fix 
this via a 

\definefontfamily[mainface][ss][Helvetica Neue][tf=style:normal]

but apparently I understand too little about this setup altogether …

Thanks already for any suggestions!


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] \placetable[location=split] reference ??

2020-04-22 Thread Benjamin Buchmuller
Hi,

I would like to reference a table of the following structure. 

\starttext

\startplacetable[reference=tab1,title={A table},location=split]
\startxtable
\startxrow
\startxcell hi \stopxcell
\stopxrow
\stopxtable
\stopplacetable

In Table \in[tab1]

\stoptext


It has [location=split], which I need this because xtable doesn’t like to be 
placed without a split; and apparently neither does it accept the 
\placetable[ref]{...} syntax. However, the reference is now no longer detected.

I can see that the split table’s caption is about to become "Table 1.a.", 
"Table 1.b" etc. and I appreciate that this is potentially a quite complex 
mechanism anyways, but if there was any chance to  get a reference as “Table 
1”, I would be helped a lot.

On similar lines, is there a way to have “Table 1 (continued).” in the caption?

Cheers


Benjamin


___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


Re: [NTG-context] \placenamedfloat and \setuphead[aftersection=...] broken?

2020-04-03 Thread Benjamin Buchmuller
Thank you, Wolfgang, this works; apparently, the chapter has to be set with 
\startchapter … \stopchapter and footnotes after \chapter won’t be flushed 
unless \startchapter \footnote{something} \stopchapter.

This makes sense to me. 

I guess, internally \head (e.g. \section, \chapter etc.) is simply not 
“converted" to \starthead ... \stophead before the next invocation of \head or 
the end of \stoptext?

Cheers


Benjamin

> On 2 Apr 2020, at 19:51, Wolfgang Schuster 
>  wrote:
> 
> Benjamin Buchmuller schrieb am 02.04.2020 um 19:29:
>> Potentially on the same lines, placing delayed element seems currently not 
>> to work properly (or the syntax has changed?).
>> I think these features of MkIV are very elegant and useful. I’m just 
>> wondering if they are/were temporarily not working (tried on 2019.12.27 
>> 16:34 MKIV beta and the Wiki’s ConTeXt online) or have been disabled/changed 
>> for some reason?
>> Thanks!
>> Benjamin
>> (1) palcenamedfloat
>> ---
>> This is the example from the Wiki:
>> [...]
>> (2) Footnotes at the end of each chapter
>> 
>> Also an example from the Wiki:
>> \startsetups
>>  chapter:after
>>  \ifcase\rawcountervalue[footnote]\relax
>>  \or
>>  \startsubject[title=Footnote]
>>  \placefootnotes
>>  \stopsubject
>>  \else
>>  \startsubject[title=Footnotes]
>>  \placefootnotes
>>  \stopsubject
>>  \fi
>> \stopsetups
>> \setupnotes[location=none]
>> \setupnotation[way=bychapter]
>> \setuphead[chapter][aftersection=\setups{chapter:after}]
> 
> Here is a slightly reformatted version of Hans code which works for me with 
> the latest ConTeXt version (I checked only LMTX).
> 
> \startsetups[chapter:after]
>  \ifcase\rawcountervalue[footnote]\relax
>%
>  \or
>\startsubject[title=Footnote]
>  \placefootnotes
>\stopsubject
>  \else
>\startsubject[title=Footnotes]
>  \placefootnotes
>\stopsubject
>  \fi
> \stopsetups
> 
> \setupnote [footnote] [location=none]
> \setupnotation [footnote] [way=bychapter]
> 
> \setuphead[chapter][aftersection=\setups{chapter:after}]
> 
> \starttext
> 
> \dorecurse{4}
>  {\startchapter[title={Number #1}]
>   A few notes\dorecurse{\numexpr#1-1\relax}{\footnote{Note #1.##1}}.
>   \stopchapter}
> 
> \stoptext
> 
> Wolfgang

___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] \placenamedfloat and \setuphead[aftersection=...] broken?

2020-04-02 Thread Benjamin Buchmuller
Potentially on the same lines, placing delayed element seems currently not to 
work properly (or the syntax has changed?).

I think these features of MkIV are very elegant and useful. I’m just wondering 
if they are/were temporarily not working (tried on 2019.12.27 16:34 MKIV beta 
and the Wiki’s ConTeXt online) or have been disabled/changed for some reason?

Thanks!


Benjamin

(1) palcenamedfloat
---

This is the example from the Wiki:

\starttext


test 
\placefigure[somewhere:alpha][whatever]{alpha}{}

test 
\placefigure[somewhere:beta] [whatever]{beta}{}

test 
\placefigure[somewhere:gamma][whatever]{gamma}{}

test 
\placefigure[somewhere:delta][whatever]{delta}{}

test 
\placefigure{}{}


in 
\in{figure}[whatever]
 bla bla


\placenamedfloat[figure][*l*]



\placenamedfloat[figure][gamma]
\placenamedfloat[figure][beta]



\stoptext

(2) Footnotes at the end of each chapter


Also an example from the Wiki:

\startsetups
 chapter:after
 
\ifcase\rawcountervalue[footnote]\relax

 
\or

 
\startsubject[title=Footnote]

 
\placefootnotes

 
\stopsubject

 
\else

 
\startsubject[title=Footnotes]

 
\placefootnotes

 
\stopsubject

 
\fi
\stopsetups



\setupnotes[location=none]
\setupnotation[way=bychapter]



\setuphead[chapter][aftersection=\setups{chapter:after}]
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] \setupinteraction[style=...] supersedes manual text style for \note

2020-04-01 Thread Benjamin Buchmuller
For the following one, I’m not sure if this is the intended behaviour or not:

I want to set up the “notation” and “note” style manually, which works great 
unless I also call \setupinteraction[state=start,style=normal] (or any other 
style), regardless of calling it before or after setting up “notation” or 
“note”.

MWE (with an assortment of different note positions):

% \setupinteraction[state=start,style=normal] %% uncomment and manual style for 
\note[] is no longer respected

\setupnotes[textcolor=blue,textstyle=italic]
\setupnotation[endnote][headcolor=green,numberconversion=character]

\starttext
This is the footnote\footnote[one]{aha} and the reference\note[one].

This is the endnote\endnote[two]{oho} and the reference\note[endnote][two].

Let's look \in[one].

\startplacefigure[title={And in this float\endnote[three]{hmm} and the 
reference\note[three].}]

\externalfigure[cow]

\stopplacefigure

\page

And look here \in[two].

\placenotes[endnote]
\stoptext

Cheers


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] placelistofsynonyms without tabulate

2020-03-30 Thread Benjamin Buchmuller
Following Aditya’s recommendation on making a glossary with ConTeXt 
(https://tex.stackexchange.com/questions/152248/make-a-glossary-with-context) 
and have looked through several older and newer manuals under “abbreviations” 
and into the source. 

However, I cannot figure out if there is a simple way to define my own command 
to achieve the following:

\definesynonyms[glossary][glossaries][\fullgloss]%[#4]
% I wonder also what #4 is supposed to do?
\setupsynonyms[glossary][headstyle=bold]

\glossary[US]{United States}{The US is a country in the Americas.}
\glossary[UK]{United Kingdom}{The UK is a country in Europe.}

% CURRENT RESULT (guessing from what I understand from the source this is 
converted internally to):

\placelistofglossaries

\starttabulate[|||]
\NC {\bf United Kingdom} \NC The UK is a country in Europe. \NC \NR
\NC {\bf United States} \NC The US is a country in the Americas. \NC \NR
\stoptabulate

% DESIRED RESULT

\unexpanded\def\myglossary#1#2#3{{\bf #1}#2} % or similar

\placelistofglossaries[command=\myglossary]

{\bf United Kingdom.} The UK is a country in Europe. Nice would be even if 
this could be indented at some point, but tastes may vary on 
indention for sure.

{\bf United States.} The US is a country in the Americas.

% or using itemize etc.

I am aware that \placelistofsynonyms has a command=... option, but it doesn’t 
do anything for me. Also, the location=inmarigin option (which I suppose could 
be used to tweak the desired result in a way) stopped working in MKIV (?) and I 
can see in the source that it has a “fixed” assignment to location=left.

Any hints very welcome. :)
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] Changing default rule thickness (globally)

2020-03-25 Thread Benjamin Buchmuller
Hi!

I would like to change the rule thickness that is used by default in ConTeXt. 
However, from the  command documentation 
(http://www.pragma-ade.nl/general/qrcs/setup-en.pdf), I see that I would need 
to basically change this for

\basegrid[rulethickness=...]
\setupbar[rulethickness=...]
\setupchemical[rulethickness=...]
\setupeffect[rulethickness=...]
\setupfillinlines[rulethickness=...]
\setupfillinrules[rulethickness=...]
\setupframed[rulethickness=...]
\setuplinefillers[rulethickness=...]
\setupmarginrules[rulethickness=...]
\setupmixedcolumns[rulethickness=...]
\setupnote[rulethickness=...]
\setupparagraphs[rulethickness=...]
\setupsidebar[rulethickness=...]
\setuptables[rulethickness=...]
\setuptabulation[rulethickness=...]
\setuptextbackground[rulethickness=...]
\setuptextrules[rulethickness=...]
\setupthinrules[rulethickness=...]
\setupxtable[rulethickness=...]

(And for \setupbackgrounds for [top header text footer bottom].) I’m sure there 
is a more elegant way to do this. But how?

Cheers


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___


[NTG-context] \setupfooter[color=red]: red color spills with float over next page

2016-12-19 Thread Benjamin Buchmuller
Hi Hans,

the patch solves the issue. Thank you for the fast reply.

With regard to Pablo’s question: When I would not use crop in the MWE, 
apparently I would get the desired output indeed. However, in the situation I 
was using the command to produce a document, I would need to crop some parts of 
a figure. I should have been a little bit more clear on this, I guess.

Thanks again,


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___

[NTG-context] \setupfooter[color=red]: red color spills with float over next page

2016-12-18 Thread Benjamin Buchmuller
Hi Hans,

I finally managed to make a MWE. The issue is related to me using \clip{…} onto 
external figures I would like to crop in conjunction with a colored footer 
set-up:

\starttext

\setupfooter[color=red]

\setupfootertexts
[]
[]
[any text] % issue related to put something in footer ...
[]

\input knuth

\input knuth

\input knuth

% … and moving to the top of the next page

\startplacefigure
[
width=fit,
title={
\input bryson
},
]
\clip[height=7.0cm]{ % issue related to clip
\externalfigure[fig_4.jpg][height=7.0cm, width=\textwidth]
}
\stopplacefigure

\stoptext

Thank you for your help.


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___

Re: [NTG-context] \setupfooter[color=red]: red color spills with float over next page

2016-12-04 Thread Benjamin Buchmuller
Hi Hans,

thank you for your help. I tried exactly as you suggested, which worked fine, 
but adopting for the case being with 
\setupfootertexts[\strut{\color[MyColor]{footers}}\strut][][][…same…] (further, 
footer texts change in the course of the document and call markings, page 
numbers etc.), I ended up with the same result as before. 

I will provide a minimal example as soon as possible next week. 

Cheers, Benjamin 

> On 4 Dec 2016, at 12:00, ntg-context-requ...@ntg.nl wrote:
> 
> Send ntg-context mailing list submissions to
>   ntg-context@ntg.nl
> 
> To subscribe or unsubscribe via the World Wide Web, visit
>   https://mailman.ntg.nl/mailman/listinfo/ntg-context
> or, via email, send a message with subject or body 'help' to
>   ntg-context-requ...@ntg.nl
> 
> You can reach the person managing the list at
>   ntg-context-ow...@ntg.nl
> 
> When replying, please edit your Subject line so it is more specific
> than "Re: Contents of ntg-context digest..."
> Today's Topics:
> 
>   1. \setupfooter[color=red]: red color spills with float over
>  next page (Benjamin Buchmuller)
>   2. Re: \setupfooter[color=red]: red color spills with float over
>  next page (Hans Hagen)
> 
> From: Benjamin Buchmuller <benjamin.buchmul...@gmail.com>
> Subject: [NTG-context] \setupfooter[color=red]: red color spills with float 
> over next page
> Date: 4 December 2016 at 04:05:49 CET
> To: ntg-context@ntg.nl
> Reply-To: mailing list for ConTeXt users <ntg-context@ntg.nl>
> 
> 
> When I have
> 
> \setupfooter[color=red, style=bold] (same goes with \setupfooter[style=red])
> 
> and a
> 
> tex text text
> 
> % <<<< page breaks here after typesetting >>>>
> 
> \startplacefigure[
>   %location=force, % no matter what I do here
>   title={Caption.}
> ]
> … something …
> \stopplacefigure
> 
> other text
> 
> that is moved to the following page as first object, the entire page 
> including the figure’s rulers, caption, and the regular text prints in red 
> (but not bold!?) when I incorporate the file via \component … into my 
> project, but not when I typeset from within \startcomponent … \stopcomponent.
> 
> Since “bold” does not seem to float the same way, I guess it is related to 
> color handling at page breaks somehow.
> 
> I already tried to \setupfloats[before=\strut] to “force” black bodyfont 
> right before the figure (at least this is what I intended to do), but did not 
> work.
> 
> I’m sorry not to be able to provide a more elaborate minimal example 
> asserting the exact conditionals of this behaviour at the moment as I need to 
> hand in a report next week. Probably the footers have to go black this time.
> 
> Any suggestions?
> 
> Thank you for your help.
> 
> 
> Benjamin
> 
> 
> 
> From: Hans Hagen <pra...@wxs.nl>
> Subject: Re: [NTG-context] \setupfooter[color=red]: red color spills with 
> float over next page
> Date: 4 December 2016 at 11:42:19 CET
> To: ntg-context@ntg.nl
> Reply-To: mailing list for ConTeXt users <ntg-context@ntg.nl>
> 
> 
>> On 12/4/2016 4:05 AM, Benjamin Buchmuller wrote:
>> When I have
>> 
>> \setupfooter[color=red, style=bold] (same goes with \setupfooter[style=red])
>> 
>> and a
>> 
>> tex text text
>> 
>> % <<<< page breaks here after typesetting >>>>
>> 
>> \startplacefigure[
>>  %location=force, % no matter what I do here
>>  title={Caption.}
>> ]
>> … something …
>> \stopplacefigure
>> 
>> other text
>> 
>> that is moved to the following page as first object, the entire page 
>> including the figure’s rulers, caption, and the regular text prints in red 
>> (but not bold!?) when I incorporate the file via \component … into my 
>> project, but not when I typeset from within \startcomponent … \stopcomponent.
>> 
>> Since “bold” does not seem to float the same way, I guess it is related to 
>> color handling at page breaks somehow.
>> 
>> I already tried to \setupfloats[before=\strut] to “force” black bodyfont 
>> right before the figure (at least this is what I intended to do), but did 
>> not work.
>> 
>> I’m sorry not to be able to provide a more elaborate minimal example 
>> asserting the exact conditionals of this behaviour at the moment as I need 
>> to hand in a report next week. Probably the footers have to go black this 
>> time.
>> 
>> Any suggestions?
> 
> not many as i really need an example
> 
> you can try
> 
> \setupfootertexts[\strut{\red foo}\strut}
> 
> ins

[NTG-context] \setupfooter[color=red]: red color spills with float over next page

2016-12-03 Thread Benjamin Buchmuller
When I have

\setupfooter[color=red, style=bold] (same goes with \setupfooter[style=red])

and a

tex text text

%  page breaks here after typesetting 

\startplacefigure[
%location=force, % no matter what I do here
title={Caption.}
]
… something …
\stopplacefigure

other text

that is moved to the following page as first object, the entire page including 
the figure’s rulers, caption, and the regular text prints in red (but not 
bold!?) when I incorporate the file via \component … into my project, but not 
when I typeset from within \startcomponent … \stopcomponent.

Since “bold” does not seem to float the same way, I guess it is related to 
color handling at page breaks somehow.

I already tried to \setupfloats[before=\strut] to “force” black bodyfont right 
before the figure (at least this is what I intended to do), but did not work.

I’m sorry not to be able to provide a more elaborate minimal example asserting 
the exact conditionals of this behaviour at the moment as I need to hand in a 
report next week. Probably the footers have to go black this time.

Any suggestions?

Thank you for your help.


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___

[NTG-context] Another question about definerefereformat

2016-11-13 Thread Benjamin Buchmuller
Here is another question, I was wondering about. 

What is the ConTeXt’s way to provide the “right” (or “left”) argument when 
\definereferenceformat[text=…] is set?

Starting from this example:

\starttext

\definereferenceformat[infig][text={Figure }]

\startplacefigure[reference=fig:A]

Some figure.

\stopplacefigure

This is \infig[fig:A].

\stoptext

I would like to output “This is Figure 1 a.” Obviously I can type “This is 
\infig[fig:A]\,a.” to get the desired result; however it does not seem very 
“ConTeXt-ish” to me as “This is \in{Figure}{a}[fig:A].” is much more concise. 
Is there the possibility to have something like \infig[right=a][fig:A]?

Thanks again.


Benjamin




___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___

[NTG-context] Setupreferencing[interaction=text] breaks referenceformat[text={…}]

2016-11-13 Thread Benjamin Buchmuller
Hi,

I’m not sure if this is the intended behaviour of the system, but I want to 
typeset “This is Figure 1.1 in Chapter A Good Story” in the attached minimal 
example. However, setting up the referencing interaction to text, this typesets 
“This is 1.1 in Chapter A Good Story”. The same holds true, when the reference 
format is not defined via \definereferenceformat, but also in 
\in{Figure}[fig:A].

Here is the minimal example:

\starttext

\setupreferencing[
left={},
right={},
interaction=text, % critical
]

\definereferenceformat[infig][text={Figure }]

\chapter[myreference]{A Good Story}

\startplacefigure[reference=fig:A]

Some figure.

\stopplacefigure

This is \infig[fig:A] in Chapter \about[myreference].

\stoptext

Thank you very much for your help.


Benjamin
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://context.aanhet.net
archive  : https://bitbucket.org/phg/context-mirror/commits/
wiki : http://contextgarden.net
___

[NTG-context] “Case-insensitive” sorting for \placelistofsynonyms?

2014-05-29 Thread Benjamin Buchmuller
Hi list,

according to case-insensitive sorting for \placeregister[…][…, method=…], I 
tried to figure out how to achieve similar results for \placelistofsynonyms 
(has method-key too). 

I tried this modified minimal example (that originally was proposed by Hans 
here: http://www.ntg.nl/pipermail/ntg-context/2010/052950.html), but failed:

\setuplayout[topspace=1cm,height=middle]

\setupbodyfont[11pt]

\starttext

\definesynonyms[abbr][abbrs][\unabbr]

\def\Test#1{\vbox{{\bf#1}\blank\placelistofabbrs[criterium=all,language=cz,method={#1}]}\blank}

wanted result: oá öb Oč Öď Oo Öo oo öo Öq öř Oš oů \blank

\startcolumns[n=2]
 \Test{before} \Test{first} 
 \Test{default}\Test{after}\Test{last}
\stopcolumns

\page

wanted result: oá öb Oč Öď Oo Öo oo öo Öq öř Oš oů \blank

\startcolumns[n=3]
 \Test{mc,mm,uc} \Test{mc,zm,uc} \Test{mc,pm,uc}
 \Test{zc,mm,uc} \Test{zc,zm,uc} \Test{zc,pm,uc}
 \Test{pc,mm,uc} \Test{pc,zm,uc} \Test{pc,pm,uc}
\stopcolumns

\page

wanted result: oá öb Oč Öď Oo Öo oo öo Öq öř Oš oů \blank

\startcolumns[n=3]
 \Test{mm,mc,uc} \Test{zm,mc,uc} \Test{pm,mc,uc}
 \Test{mm,zc,uc} \Test{zm,zc,uc} \Test{pm,zc,uc}
 \Test{mm,pc,uc} \Test{zm,pc,uc} \Test{pm,pc,uc}
\stopcolumns

\page

\dorecurse {2} {
\page \recurselevel:
 \abbr{oá}{oáz}  \abbr{öb}{öbz}  \abbr{Oč}{Očz}  \abbr{Öď}{Öďz}
 \abbr{oo}{ooz}  \abbr{öo}{öoz}  \abbr{Oo}{Ooz}  \abbr{Öo}{Öoz}
 \abbr{Öq}{Öqz}  \abbr{öř}{öřz}  \abbr{Oš}{Ošz}  \abbr{oů}{oůz}
done
}

\stoptext

Is there yet another way to modify sorting behaviour?

Many thanks for your help!
___
If your question is of interest to others as well, please add an entry to the 
Wiki!

maillist : ntg-context@ntg.nl / http://www.ntg.nl/mailman/listinfo/ntg-context
webpage  : http://www.pragma-ade.nl / http://tex.aanhet.net
archive  : http://foundry.supelec.fr/projects/contextrev/
wiki : http://contextgarden.net
___